MolPharm xPharm- The Comprehensive Pharmacology Reference

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
 QUICK SEARCH:   [advanced]


     


0026-895X/03/6405-1101-1108$20.00
Mol Pharmacol 64:1101-1108, 2003

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Incles, C. M.
Right arrow Articles by Neidle, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Incles, C. M.
Right arrow Articles by Neidle, S.

Acquired Cellular Resistance to Flavopiridol in a Human Colon Carcinoma Cell Line Involves Up-Regulation of the Telomerase Catalytic Subunit and Telomere Elongation. Sensitivity of Resistant Cells to Combination Treatment with a Telomerase Inhibitor

Christopher M. Incles, Christoph M. Schultes, Lloyd R. Kelland, and Stephen Neidle

Cancer Research UK Biomolecular Structure Group, the School of Pharmacy, University of London, London, United Kingdom (C.M.I., C.M.S., S.N.); and Antisoma Research Laboratories, St. George's Hospital Medical School, Cranmer Terrace, London, United Kingdom (L.R.K.).

Received February 10, 2003; accepted July 22, 2003


    Abstract
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Flavopiridol is a broad-spectrum inhibitor of cyclin-dependent kinases and of global transcription via the inhibition of positive transcription elongation factor b (P-TEFb). Although flavopiridol is currently undergoing phase II clinical trials, acquired cellular resistance to the compound during treatment is a potential problem, as it is with almost all current anticancer agents. A HCT116 human colon carcinoma cell line with an acquired 8-fold resistance to flavopiridol has been established. We report here that there are changes in these resistant cells in terms of telomere length and telomerase activity, whereas no change in the expression of the P-TEFb subunits CDK9, cyclin T1, cyclin T2a, or cyclin T2b was observed. The level of mRNA expression for the telomerase catalytic subunit hTERT was increased over 2-fold in the resistant cells, and mean telomere length was found to be 2 kb longer than the parental length, although telomerase activity was unchanged. The level of mRNA expression for the telomeric binding protein Pot1 was also increased. We also report that treatment of HCT116 cells with a combination of the G-quadruplex interacting telomerase inhibitor BRACO-19 and flavopiridol results in a 3-fold decrease in population doubling and prevents recovery from treatment with either compound alone. Treatment of flavopiridol-resistant cells with BRACO-19 alone also led to rapid inhibition of cell growth, which is not observed in the parental line. The finding that only the resistant line, with up-regulated telomerase, responds to this G-quadruplex inhibitor is consistent with the hypothesis that the mechanism of BRACO-19 down-regulation of cell growth directly involves the targeting of telomeres and telomerase.


Go


View this table:
[in this window]
[in a new window]
 
TABLE 1 Primers

 

Cyclin-dependent kinases (CDKs), together with their cyclin regulatory subunits and downstream effectors, play a major role in cell-cycle progression. Proteins that inhibit the action of CDKs, such as p53 and p16, are frequently mutated in human cancer, resulting in uncontrolled CDK activity and cellular proliferation (Senderowicz and Sausville, 2000Go). Flavopiridol (HMR-1275; L-868275; NSC-649890; N-methylpiperidinyl chlorophenyl flavone), is an inhibitor of CDKs and is currently undergoing phase II clinical trials (Zhai et al., 2002Go). The compound has been shown to inhibit several CDKs, including CDK1, CDK2, CDK4, and CDK7, with IC50 values ranging from 40 to 400 nM (Losiewicz et al., 1994Go; Carlson et al., 1996Go). More recently, flavopiridol has also been shown to inhibit receptor tyrosine kinases, such as epidermal growth factor receptor; receptor associated tyrosine kinases, such as Src; and transducing signal kinases, such as phosphokinase C and Erk-1 (Sedlacek, 2001Go). The basis of the inhibitory effect of flavopiridol is probably the competitive inhibition of the ATP binding site found in these proteins (De Azevedo et al., 1996Go).

Several studies have also demonstrated that flavopiridol is a potent inhibitor of transcription in mammalian cells. The compound was found to inhibit transcription globally at concentrations in the 300 nM range (Lam et al., 2001Go), as a result of the direct inhibition of the elongation phase of transcription [inhibiting positive transcription elongation factor b (P-TEFb)]. P-TEFb is a multisubunit protein that interacts with the C-terminal domain of RNA polymerase II to promote transcription (Chao and Price, 2001Go; Taube et al., 2002Go). It comprises CDK9 and cyclin T1, T2a, T2b, or K subunits; flavopiridol inhibition of transcription may occur by inhibition of the CDK9 domain in this complex. Flavopiridol has also been demonstrated to bind to duplex DNA although this only occurs at high concentrations (> 500 nM) (Bible et al., 2000aGo).

Resistance to chemotherapeutic agents is one of the most severe problems in the treatment of human cancers. The mechanisms underlying resistance to flavopiridol have not yet been fully characterized, although several cell lines with resistance to flavopiridol have been generated (see for example, Robey et al., 2001Go; Smith et al., 2001Go). It has been shown that flavopiridol resistance in human MCF-7 breast cancer cells is associated with an increase in the expression of the ATP-binding cassette half-transporter ABCG2 (Robey et al., 2001Go). However, this is not necessarily the case in other cell lines, because it has been found that flavopiridol-resistant OV202 ovarian carcinoma cells do not overexpress this transporter (Bible et al., 2000bGo). Moreover, a HCT116 human colon carcinoma cell line with acquired resistance to flavopiridol did not overexpress the related multidrug transporters P-glycoprotein MRP1, and no changes in drug accumulation or efflux were noted between resistant and parental cells (Smith et al., 2001Go). This study also found no change in CDK2 or CDK4 levels or activity and only a small change in the expression of cyclins A, B, D2, or D3. Small increases in cyclin E levels were observed in the resistant cells although transfection with this protein did not result in a resistant phenotype.

Telomeres comprise repetitive short DNA sequences together with associated proteins that occur at the ends of all eukaryotic chromosomes, the human repeat being TTAGGG (Moyzis et al., 1988Go). Telomeric DNA in human cancers typically ranges in length from 2 to 6 kb. The primary role of telomeres is to protect chromosomes from aberrant recombination or end-to-end fusions, although in somatic cells they progressively shorten because of the "end-replication effect" of DNA polymerase being unable to fully replicate the ends. Telomere shortening to a critical length can activate senescence and/or apoptotic pathways (Duan et al., 2001Go; Karlseder et al., 2002Go). To prevent these from occurring, telomeres are maintained in length in the overwhelming majority of tumor cells by the action of the enzyme telomerase and by telomere end-capping with various proteins (Morin, 1989Go). Telomerase activity is detectable in only a subset of normal cells but is present in more than 80% of tumor cells and primary tumors (Kim et al., 1994Go). A number of observations, notably that inhibition of telomerase limits the growth of tumor cells (Hahn et al., 1999Go), have led to proposals that telomerase is a potential target for cancer chemotherapy (see, for example, Neidle and Parkinson, 2002Go; Shay and Wright, 2002). One approach for telomerase inhibition is to promote the formation of secondary structures (G-quadruplexes) within telomeric DNA itself, which cannot be recognized by the RNA template component of telomerase. G-quadruplex stabilization can be achieved by small molecules, such as the trisubstituted acridine compound BRACO-19, which inhibits 50% of telomerase activity at a concentration of 160 nM (Read et al., 2001Go; Gowan et al., 2002Go).

Telomerase activity and telomere status are increasingly recognized as important influences on the development of resistance to a number of chemotherapeutic agents. Telomere elongation is associated with resistance to 5-fluorouracil and cis-diamminedichloroplatinum, and telomere dysfunction leads to increases in sensitivity to DNA double-strand break-inducing agents such as doxorubicin and actinomycin (Lee et al., 2000Go; Kuranaga et al., 2001Go). Interestingly, telomerase inhibition in human malignant glioblastoma cells leads to an increase in susceptibility to cisplatin-induced apoptosis (Kondo et al., 1998Go). These results suggest that telomere stabilization, possibly involving an up-regulation of telomerase activity, has a role in the maintenance of the resistant phenotype to these compounds. This is consistent with the frequent observations of elevated telomerase levels correlating with disease progression.

In the present study, we have characterized an HCT116 human colon carcinoma cell line with an acquired 8-fold resistance to flavopiridol, in terms of telomere length and telomerase activity. Flavopiridol-resistant cells were found to overexpress mRNA for the telomerase catalytic subunit (hTERT) and showed telomere elongation and elevated expression of mRNA for the telomere binding protein Pot1. Flavopiridol was shown not to interact with telomeric DNA, and no changes in telomerase activity were detectable. In addition, the resistant cells exhibited a decrease in the expression of p53 and p21 proteins, whereas cyclin D1 protein expression was unchanged, as was expression of cyclin T1, cyclin T2a/b, CDK9, and CDK2 proteins. These data suggest that a change in the expression of P-TEFb is probably not involved in the acquisition and maintenance of flavopiridol resistance, whereas telomere stabilization may be required in the generation of the resistant phenotype. This is supported by the observation that treatment with a combination of flavopiridol and the G-quadruplex-interacting telomerase inhibitor BRACO-19 prevents the regrowth of cells during treatment with cytotoxic doses of flavopiridol.


    Materials and Methods
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Tissue Culture and Compounds. HCT116 human colon carcinoma cells and flavopiridol resistant HCT116 cells were donated by Dr. V. Smith, Institute of Cancer Research (Smith et al., 2001Go) and were grown as a monolayer maintained in Dulbecco's modified Eagle's media containing 10% (v/v) fetal bovine serum (Invitrogen, Paisley, Scotland, UK), 2 mM L-glutamine, and minimal essential medium nonessential amino acids (Invitrogen) in a 37°C, 5% CO2 atmosphere. Media were changed weekly. Cells were harvested by washing with phosphate-buffered saline (Dulbecco's phosphate-buffered saline solution A; ICR, London, UK), incubating in trypsin-EDTA (0.05% trypsin in 0.02% EDTA; Invitrogen) at 37°C, neutralizing with media and seeding at appropriate concentrations into tissue culture flasks (Costar; Corning Glassworks, Corning, NY). Flavopiridol was obtained from Dr. V. Smith (ICR, Sutton, UK) and was formulated in DMSO (Sigma), then diluted down with distilled water. The resistant cells had been generated by exposure to increasing concentrations of flavopiridol (starting at 100 nM and increasing to 400 nM) over a period of 3 months. The level of resistance in these cells was checked by a standard growth inhibition assay (see below). They were found to be 8-fold resistant to flavopiridol, in agreement with the original observations.

Sulforhodamine B Growth Inhibition Assay. This was used to screen cells for toxicity to each of the compounds described and was carried out as described in Smith et al. (2001Go) after 96-h exposure to each compound.

Reverse Transcription and PCR. RNA was extracted from cell pellets using the QIAGEN RNeasy Minikit following the manufacturer's instructions. The total RNA concentration was determined by measuring absorbance at 260 nm using a GeneQuant (Amersham Biosciences, Little Chalfont, Buckinghamshire, UK). The RNA was stored at -80°C until required.

Reverse transcription was carried out using the cDNA cycle kit (Invitrogen) following the manufacturer's instructions, using the primers detailed below. PCR reactions all contained 1x reaction buffer (without MgCl2), 200 µM dNTP mix, 1 µM forward primer, 1 µM reverse primer, and Red Hot DNA Polymerase (0.025 units). MgCl2 was also added as required. All DNA primers were obtained from Cruachem Ltd (Glasgow, Scotland, UK). Reaction products were resolved on a 1% agarose gel (Invitrogen).

Determination of Telomere Length. Telomere length was determined using both Slot and Southern blotting techniques as described previously (Counter et al., 1992Go; Bryant et al., 1997Go). Probes were constructed by combining 10 µM concentrations of the oligonucleotides SLOT1 (TTAGGGTTAGGGTTAGGGTTAGGG) or CENT1 (GTTTTGAAACACTCTTTTTGTAGAATCTGC) (Oswell, Southampton, UK), 1x kinase buffer, sterile water, 10 µCi of [{gamma}32-P]ATP and 1.6 units of T4 polynucleotide kinase, then incubating for 1 h at 37°C and were purified using a Bio-spin chromatography column (BioRad, Hemel Hempstead, Hertfordshire, UK). Total genomic DNA was extracted from cell pellets using the QIAamp blood kit (QIAGEN) following the manufacturer's protocol, and 40 µg was resolved on an 8% agarose gel under pulsed-field conditions that was transferred to a nylon membrane (Hybond-XL; Amersham Biosciences). Slot blots were carried out using 100 and 50 ng of genomic DNA. Both membranes were hybridized with probe overnight at 42°C. Bound probe was detected by exposing the membrane to a phosphor screen (Amersham Biosciences) for at least 1 h. The screen was scanned using the Storm 820 PhosphorImager and the bands visualized using ImageQuant software (ver. 3.3). Slot blots were then stripped and reprobed with the control (CENT1/centromere) probe.

Fluorescence Resonance Energy Transfer (FRET). All oligonucleotides and their fluorescent conjugates were purchased from Oswell (Southampton, UK). DNA was initially dissolved as a 50 µM stock solution in purified water; further dilutions were carried out in the relevant buffer. The ability of the compounds to stabilize G-quadruplex DNA was investigated using a fluorescence resonance energy transfer (FRET) assay modified to be used as a high-throughput screen in a 96-well format. The labeled oligonucleotide F21T (5'-FAM-dGGG(TTAGGG)3-TAMRA-3') used as the FRET probe was diluted from stock to the correct concentration (400 nM) in a 50 mM potassium cacodylate buffer, pH 7.4, and then annealed by heating to 85°C for 10 min., followed by cooling to room temperature in the heating block. Compounds were stored as 10 mM stock solutions in DMSO; final solutions (at 2x concentration) were prepared using water or 1 M HCl in the initial 1:10 dilution, after which 50 mM potassium cacodylate buffer, pH 7.4, was used in all subsequent steps. Experiments were performed in 96-well plates, which were prepared by aliquoting 50 µl of the annealed DNA to each well, followed by 50 µl of the compound solutions. Measurements were made on an Opticon DNA Engine (MJ Research, Waltham, MA) with excitation at 450 to 495 nm and detection at 515 to 545 nm. Fluorescence readings were taken at intervals of 0.5°C over the range 30 to 100°C, with a constant temperature being maintained for 30 s before each reading to ensure a stable value. Final analysis of the data was carried out using a script written in the program Origin 7.0 (OriginLab Corp., Northampton, MA).

Western Blotting. Western blot analysis of proteins was carried out using asynchronous cells in exponential growth phase as described previously (Sharp et al., 1994Go). Bands were detected using enhanced chemiluminescence (PerkinElmer Life Sciences, Boston, MA). Antibodies were obtained from Santa Cruz Biochemicals (p53, cyclin T2a/b, cyclin T1, CDK9, CDK2, {beta}-tubulin) CN Biosciences Ltd, UK (p21), and Stratech Scientific Ltd, UK (cyclin D1). Secondary antibodies were purchased in each case from Amersham Biosciences.

Telomere Repeat Amplification Protocol (TRAP) Assay. The TRAP assay was used to assess telomerase activity in a cell-free assay according to the method described previously (Gowan et al., 2002Go). In our assays, 5 and 20 ng of protein were used in each reaction.

Growth Curves and Combination Treatment with BRACO-19 and Flavopiridol. Wild-type or flavopiridol resistant HCT116 cells (1 x 105) were seeded and treated twice weekly with 2 µM BRACO-19 (a concentration that greatly exceeds the concentration for 50% telomerase inhibition but is noncytotoxic) and 0.04 µM flavopiridol (IC25). Cells were harvested once weekly and counted using a hemocytometer; 1 x 105 cells were reseeded and retreated. Treatment continued until fewer cells were counted than were initially seeded. For the growth curves, 1 x 105 of each cell type was seeded and counted once weekly, before 1 x 105 cells were reseeded. Media was changed once weekly.


    Results
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Flavopiridol Resistance Is Accompanied by an Increase in hTERT Expression and Increased Telomere Length but No Increase in Telomerase Activity. Because telomere elongation and increases in telomerase activity have been observed in the resistance to the cancer chemotherapeutic agents 5-fluorouracil and cis-diamminedichloroplatinum, we first set out to measure these parameters in the flavopiridol-resistant cells. First, however, both the flavopiridol-resistant HCT116 and the parental wild-type (WT) cells were screened for flavopiridol toxicity using a sulforhodamine B staining assay. In agreement with previous results, the resistant cells displayed an 8-fold resistance to flavopiridol compared with WT cells (IC50 values of 0.08 ± 0.03 and 0.61 ± 0.06 µM, respectively). No cross-resistance to BRACO-19 was observed. Southern blotting showed that the mean telomere length in the resistant cells was approximately 2 kb greater than that of the parental line (with a mean telomere length in the 4- to 5-kb range) (Fig. 1a). Slot blotting was also used to measure telomere length and produced identical results (data not shown).



View larger version (35K):
[in this window]
[in a new window]
 
Fig. 1. a, Southern blot measurement of telomere length in (lane 1) HCT116 and (lane 2) HCT116 flavopiridol-resistant cells. Molecular weights are labeled as determined using a 10-kb molecular ruler (Abgene, Epsom, UK). b, graph comparing the growth of flavopiridol-resistant HCT116 and wild-type HCT116 cells. The population doubling times for the flavopiridol-resistant and the parental cells were 1.02 and 0.96 days, respectively (n = 3). c, RT-PCR for hTERT (top) and GAPDH (bottom) in HCT116-1 (lane 1), HCT116-2 (lane 2), HCT116-flavopiridol resistant-1 (lane 3), and HCT116-flavopiridol resistant-2 (lane 4). d, graphical representation of telomerase activity in HCT116 and HCT116 flavopiridol-resistant cells. Telomerase activity is plotted as disintegrations per minute counted (n = 3) (p = 0.009).

 

Because of the activity of flavopiridol as a cell cycle inhibitor, one possible basis of resistance may be a selection for slower-growing cells. Hence, such a subpopulation would be intrinsically resistant to compounds that act upon cell-cycle components. To examine whether this was the case, we compared the growth rates of both the WT and flavopiridol-resistant HCT116 cells. The growth curve (Fig. 1b) demonstrates that both the WT and flavopiridol-resistant HCT116 cells displayed identical growth kinetics. Hence, flavopiridol resistance does not seem to be a result of any changes in the rate of cellular growth.

RT-PCR against hTERT revealed that the mRNA for this protein is overexpressed in the resistant cells at a level 2.5-fold greater than that of the parental cells (Fig. 1c). However, TRAP assay analysis revealed that despite these observations, telomerase activity in the resistant cells was slightly decreased compared with that of the parental cells (Fig. 1d). To rule out any inhibitory effect of flavopiridol on telomerase activity, TRAP assays were also performed in its presence. No effect on telomerase activity was observed at concentrations below 20 µM (data not shown). Additional RT-PCR was performed against the telomerase RNA component (hTR) and the telomerase associated protein TEP1. Neither protein demonstrated any changes in mRNA expression (data not shown).

In addition to screening for any changes in hTERT expression, we examined the cells to ascertain whether there were any changes with regard to telomere stability in the resistant cells. We hypothesized that because of their roles in telomere maintenance and in the cis-regulation of telomerase activity, the telomere-associated proteins TTAGGG repeat binding factor 1 (TRF1; Broccoli et al., 1997Go; van Steensel and de Lange, 1997Go), TRF2 (van Steensel et al., 2000Go), and Pot1 (Baumann and Cech, 2001Go) may be differently expressed in the resistant cells. Western blotting demonstrated that there was no change in the expression of TRF2. TRF1 mRNA expression was also unchanged. RT-PCR for Pot1, however, revealed that mRNA for this protein is overexpressed in the resistant cells (Figs. 2, a and b).



View larger version (87K):
[in this window]
[in a new window]
 
Fig. 2. a, RT-PCR analysis of Pot1 (top) and GAPDH (bottom) expression in wild-type HCT116 cells (lanes 1 and 3) and in HCT116 flavopiridol-resistant cells (lanes 2 and 4). Each reaction contained 900 ng of total RNA. b, top, Western blot analysis of TRF2 expression in wild-type HCT116 cells (lane 1) and HCT116 flavopiridol-resistant cells (lane 2). Bottom, RT-PCR for TRF1. Amounts used were 15 µg and 900 ng of protein and RNA, respectively.

 

Flavopiridol-Resistant Cells Exhibit Decreased Expression of p53 and p21 with No Change in Cyclin D1 Expression. The finding that the resistant cells possess elongated telomeres despite the lack of change in telomerase activity suggested that telomere elongation may be taking place via other means. It has previously been shown that non-telomerase-mediated telomere elongation, or alternative lengthening of telomeres, is preceded by increases in cyclin D1 and a decrease in p53 expression and that p53 status is associated with telomere stability and drug resistance (Lee et al., 2000Go; Opitz et al., 2001Go). To examine whether this was the case in the flavopiridol-resistant cells, we performed Western blots for p53, p21, and cyclin D1. As shown in Fig. 3, the resistant cells displayed a reduction in the expression of both p53 and p21, but no change in cyclin D1 expression compared with the parental cells.



View larger version (81K):
[in this window]
[in a new window]
 
Fig. 3. Western blot analysis of p53, p21, cyclin D1, and {beta}-tubulin protein from) wild-type HCT116 (lanes 1 and 2 and HCT116 flavopiridol-resistant total cell lysates (lanes 3 and 4).

 

Expression of the P-TEFb Subunits CDK9, Cyclin T1, and Cyclin T2a/b Are Unchanged in Flavopiridol-Resistant Cells. Because of the potent and specific inhibition of P-TEFb by flavopiridol (Chao and Price, 2000Go), we performed Western blotting and RT-PCR to investigate whether up-regulation of P-TEFb was responsible for the acquisition flavopiridol resistance. The flavopiridol-resistant cells did not exhibit any change in the expression of mRNA or protein for CDK9, cyclin T1, or cyclin T2a or T2b (Fig. 4). In addition, we were unable to detect any changes in the expression of CDK2 in the resistant cells.



View larger version (73K):
[in this window]
[in a new window]
 
Fig. 4. Western blots for CDK2, CDK9, cyclin T1, and cyclin T2a/b. In each, lane 1 contains wild-type HCT116 cell protein and lane 2 contains HCT116 flavopiridol-resistant cell protein. Both lanes contain 15 µg of protein.

 

Combinations of BRACO-19 and Flavopiridol Prevent the Cellular Recovery That Occurs with Either Compound Alone. The potential link between flavopiridol resistance and the telomerase/telomere pathways suggested that by using combinations of flavopiridol and a telomerase inhibitor, we might be able to prevent the growth of cells that are resistant to flavopiridol alone. We began by treating HCT116 cells with 2 µM BRACO-19 alone, 40 nM flavopiridol alone (at the IC25 concentration), or a combination of both compounds. Treatment of HCT116 cells with BRACO-19 alone led to a slight decrease in cell growth (Fig. 5a). Treatment with flavopiridol alone also initially reduced cell growth, but this was followed by a slow recovery of growth rate as resistance began to develop. However, treatment with the BRACO-19 + flavopiridol combination led to a complete inhibition of cell growth after 21 days of treatment. This data indicates that the presence of BRACO-19 prevents the emergence of cells with resistance to flavopiridol.



View larger version (26K):
[in this window]
[in a new window]
 
Fig. 5. a, graph showing the response of wild-type HCT116 cells to treatment with 2 µM BRACO-19, 40 nM flavopiridol, or a combination of the two. Cells (1 x 105) were seeded initially; the experiment was terminated when less than 1 x 105 were counted (n = 4). b, FRET-based analysis of the melting of quadruplex DNA in the presence of BRACO-19, flavopiridol, or a combination of the two. The melting curves for BRACO-19 alone and with flavopiridol are statistically identical. Flavopiridol alone did not produce quadruplex stabilization. c, the effect of treatment with 2 µM BRACO-19, 40 nM flavopiridol, or a combination of the two on the growth of flavopiridol-resistant HCT116 cells (n = 3).

 

It is also clear that the converse is true, where treatment with the combination prevents cells growing through BRACO-19 treatment. Because flavopiridol has been shown to bind to DNA, we hypothesized that the combination might be influencing the binding affinity of BRACO-19 at the telomere. In addition, because flavopiridol-resistant cells possess elongated telomeres, telomere elongation may result in an increased number of DNA binding sites for flavopiridol. Hence, in a population of cells with increased telomere length, BRACO-19 would be essentially sequestered by the telomeric DNA and less would be available to interact with its target. To examine whether this was the case, we performed FRET assays in the presence of flavopiridol, BRACO-19, or a combination of the two. The FRET probe used is designed to resemble the human 3' telomeric single-stranded DNA overhang and has been shown to form G-quadruplexes under the conditions employed in the assay.

The melting curve obtained using BRACO-19 alone is exactly as one would expect for a G-quadruplex-stabilizing compound, where rapid increases in melting temperature are evident with small increases in concentration (Fig. 5b). This shows that the presence of BRACO-19 is stabilizing the secondary structure formed. Using flavopiridol in the same assay, however, we were unable to detect any changes in DNA stability, even at concentrations of 12 µM. Moreover, when BRACO-19 and flavopiridol were added to the reaction in combination (at a ratio of 5:1), no changes were observed compared with the melting profile obtained using BRACO-19 alone. This demonstrates that flavopiridol alone is not binding to G-quadruplex DNA and flavopiridol does not influence the DNA binding characteristics of BRACO-19.

The behavior of cells treated with the BRACO-19 + flavopiridol combination demonstrates that the combination prevents recovery from treatment with either compound alone. Although the basis for this synergy is not totally clear, the observation suggests that a factor(s) that mediates the recovery with BRACO-19 would prevent flavopiridol resistance and vice versa. To examine whether this is the case, we treated flavopiridol-resistant HCT116 cells with 2 µM BRACO-19. As Fig. 5c shows, compared with treatment with a vehicle control (DMSO) or flavopiridol alone, BRACO-19 significantly inhibits the growth of the resistant cells. The extent of the growth inhibition by BRACO-19 treatment is comparable with the response of these cells to treatment with the BRACO-19 + flavopiridol combination.


    Discussion
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
We have characterized an HCT116 cell line in this study with an acquired 8-fold resistance to the CDK inhibitor flavopiridol. This resistant line shows increased telomerase activity and telomere length compared with the parental line. A previous study on this resistant cell line detected few molecular changes, although small increases in cyclin E expression and associated kinase activities were found (Smith et al., 2001Go). Changes in telomere-associated features were not examined.

Because flavopiridol is a potent and specific inhibitor of P-TEFb, we initially examined the expression of this protein; up-regulation of target proteins is frequently associated with resistance to a number of chemotherapeutic agents, including thymidylate synthase inhibitors (Welsh et al., 2000Go). However, because we were unable to detect any changes in the expression of the P-TEFb subunits CDK9, cyclin T1, and cyclin T2, we conclude that changes in the expression of P-TEFb are not involved in the maintenance of flavopiridol resistance in HCT116 cells. Although expression of various ATP-binding pumps is a mechanism of resistance to several drugs, including paclitaxel (Kamazawa et al., 2002Go) and doxorubicin (Dolfini et al., 1997Go), no change in the expression of this protein was detectable in the cell line used in this study (Smith et al., 2001Go). This suggests that, in the HCT116 cell line at least, flavopiridol resistance is achieved by other mechanisms that are likely to be based on the cell cycle.

Expanding on recent studies indicating that telomere stabilization is involved in resistance to several anticancer drugs, we characterized the resistant line in terms of telomere length. Telomere shortening and telomere dysfunction increase cellular sensitivity to some DNA double-strand break-inducing agents (Lee et al., 2000Go; Kuranaga et al., 2001Go). We have detected a significant increase in mean telomere length in the resistant cells that was approximately 2 kb greater than that in parental cells. In addition, mRNA levels for the telomere-associated proteins hTERT and Pot1 were elevated, and expression of p53 and p21 proteins was decreased. These findings show that telomere stabilization is a characteristic of the resistance phenotype, although not necessarily a functional requirement. The capping of free telomeric ends by proteins such as hTERT and Pot1 protects telomeres from recognition as double-strand breaks and the induction of cell cycle arrest. It has also been suggested that some cells with very short telomeres escape senescence by means of telomere end-capping (Karlseder et al., 2002Go). The slight decrease in telomerase activity observed here in the resistant cells agrees well with this, because the presence of hTERT is more important than telomerase activity per se. This is likely to be controlled post-translationally or may represent a splice variant of hTERT. Several other proteins are thought to have roles in maintaining telomere organization, including RAD50, ATM, and TRF2 (Blackburn, 2001Go), although we observed little change in TRF2 expression in the resistant cells. Sufficient TRF2 may be present at basal levels to facilitate telomere stabilization in the resistant cells.

Telomeres have also been postulated to be storage sites for DNA damage-response proteins (Wright et al., 1996Go). Hence, a mechanism by which telomere elongation leads to resistance to double-strand break-inducing agents may be via sequestration of the proteins that induce apoptosis or simply by allowing the cells to tolerate greater insults by reducing the chances of senescence/apoptotic pathways occurring. Although flavopiridol has been shown to bind to duplex DNA (Bible et al., 2000aGo), this occurred only at relatively high concentrations of the compound (> 500 nM) and is unlikely to contribute to the mechanism of telomere stabilization as part of the resistance phenotype. Our own observations agree with this, because flavopiridol was shown neither to bind to telomeric DNA nor to effect G-quadruplex stability in vitro.

A clue to the mechanism by which telomere elongation occurs in these cells is provided by the observed decreases in p53 and p21 expression in the resistant cells. P53 has recently been implicated in the control of telomere length, where it has been shown to bind to the single-stranded telomeric overhang and is required for activation of the senescence pathways triggered by telomere shortening/uncapping (Stansel et al., 2001Go; Harrington and Robinson, 2002Go). Furthermore, inactivation of p53 is associated with alternative lengthening of telomeres, which is believed to occur via recombination events (Dunham et al., 2000Go). Although our resistant cells did not exhibit the characteristically long heterologous telomeres associated with alternative lengthening of telomeres, we cannot rule out some degree of homologous recombination occurring. Indeed, this would fit in well with the observation that telomerase activity in the resistant cells is unchanged despite the increases in telomere length. Interestingly, it has been reported recently that there is an increase in telomere length together with a decrease in telomerase activity in doxorubicin-resistant stomach cancer cells (Kim et al., 2002Go). These data suggest that telomere elongation/stabilization may be occurring in resistance to a large variety of drugs.

Therefore, if the mechanism underlying flavopiridol resistance is cell-cycle related, a downstream effect may be an alteration in p53 expression that indirectly leads to the changes we have seen in telomere length and capping. On the other hand, telomere lengthening and stabilization may be a prerequisite for the development of flavopiridol resistance in these cells. Whichever may be the case, these results provide a good rationale for treatment of cancer cells using combinations of telomerase inhibitors/telomere interacting compounds and cell-cycle inhibitors such as flavopiridol.

In support of this, our data also show that a combination of flavopiridol and the G-quadruplex telomerase inhibitor BRACO-19 (Read et al., 2001Go; Gowan et al., 2002Go) has a strongly synergistic effect on the inhibition of tumor cell growth. Long-term treatment of the wild-type HCT116 cells with flavopiridol alone results in a decrease in growth, which reaches a plateau at ~50% growth inhibition, after which a gradual recovery is eventually observed (data not shown). These cells do not respond to BRACO-19 alone. The combination (with BRACO-19 at a subcytotoxic dose) results in complete inhibition of cellular growth. Furthermore, we have shown that treatment of flavopiridol-resistant cells with BRACO-19 alone leads to rapid inhibition of cellular growth, which is not observed in the WT cells. The flavopiridol-resistant cells also responded to treatment with the combination by rapid growth arrest. It is currently unclear whether this growth arrest is reversible, although if the effect of BRACO-19 is to cause growth arrest by telomere shortening/uncapping, then it is unlikely that cells will recover. It is notable that growth-arrest in the resistant line occurs rapidly after administration and there is no indication of the extended time lag before response that is characteristic of classic catalytic-site telomerase inhibitors (Pascolo et al., 2002Go).


    Acknowledgements
 
We thank Sharon Gowan and Mike Walton for their advice and technical assistance. Initial aspects of these studies were performed in the Cancer Research UK Centre for Cancer Therapeutics at The Institute of Cancer Research, and we are grateful to Professor Paul Workman for the provision of facilities and for the resistant cell line.


    Footnotes
 
The Institute of Cancer Research Cancer Research UK provided research studentships (to C.M.I. and C.M.S.) and funded these studies at the Institute of Cancer Research and then at The School of Pharmacy.

ABBREVIATIONS: CDK, cyclin-dependent kinase; P-TEFb, positive transcription elongation factor b; DMSO, dimethyl sulfoxide; PCR, polymerase chain reaction; FRET, fluorescence resonance energy transfer; TRAP, telomere repeat amplification protocol; WT, wild type; RT, reverse transcriptase; kb, kilobase(s); FAM, 6-carboxylfluorescein hexylamine; TAMRA, 6-carboxyltetramethylrhodamine hexylamine.

Address correspondence to: Prof. S. Neidle, The School of Pharmacy, 29-39 Brunswick Square, London WC1N 1AX, UK. E-mail: stephen.neidle{at}ulsop.ac.uk


    References
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Baumann P and Cech T (2001) Pot1, the putative telomere end-binding protein in fission yeast and humans. Science (Wash DC) 292: 1171-1175.[Abstract/Free Full Text]

Bible K, Bible R, Svingen P, Xu K, and Kaufmann S (2000a) Flavopiridol binds to duplex DNA. Cancer Res 60: 2419-2428.[Abstract/Free Full Text]

Bible K, Svingen P, and Kaufmann S (2000b) Characterization of an ovarian carcinoma cell line resistant to cisplatin and flavopiridol. Clin Cancer Res 6: 661-670.[Abstract/Free Full Text]

Blackburn EH (2001) Switching and signalling at the telomere. Cell 106: 661-673.[CrossRef][Medline]

Broccoli D, Chong L, and de Lange T (1997) Human telomeres contain two distinct Myb-related proteins, TRF1 and TRF2. Nat Genet 17: 231-235.[CrossRef][Medline]

Bryant J, Kent G, and Griffith J (1997) Measurement of telomeric DNA content in human cells. Biotechniques 23: 476-484.[Medline]

Carlson B, Sausville E, and Worland P (1996) Inhibition of cdk2, cdk4 and cdk7 by flavopiridol and structural analogues (Abstract), in Proceedings of the American Association for Cancer Research; 2000 Apr 1-5; San Francisco, California. Vol. 37, pp 42419. American Association for Cancer Research, Philadelphia, PA.

Chao H, Fujinaga K, Marion J, Taube R, Peterlin B, and Price D (2000) Flavopiridol inhibits P-TEFb and blocks HIV-1 replication. J Biol Chem 275: 28345-28348.[Abstract/Free Full Text]

Chao H and Price D (2001) Flavopiridol inhibits P-TEFb and blocks most RNA polymerase 2 transcription in vivo. J Biol Chem 276: 31793-31799.[Abstract/Free Full Text]

Counter C, Hirte H, and Harley C (1992) Telomere shortening associated with chromosome instability is arrested in immortal cells which express telomerase activity. EMBO (Eir Mol Biol Organ) J 11: 1921-1929.

De Azevedo W, Sausville E, and Kim S (1996) Structural basis for specificity and potency of a flavonoid inhibitor of human cdk2, a cell-cycle kinase. Proc Natl Acad Sci USA 93: 2735-2740.[Abstract/Free Full Text]

Duan J, Zhang Z, and Tong T (2001) Senescence delay of human diploid fibroblasts induced by anti-sense p16INK4a expression. J Biol Chem 276: 48325-48331.[Abstract/Free Full Text]

Dunham M, Neumann A, and Reddel R (2000) Telomere maintenance by recombination in human cells. Nat Genet 26: 447-450.[CrossRef][Medline]

Dolfini E, Molinari A, Flens A, and Monti A (1997) Characterization of a clonal human colon adenocarcinoma line intrinsically resistant to doxorubicin. Br J Cancer 76: 67-76.[Medline]

Gowan S, Harrison J, Patterson L, Read M, Neidle S, and Kelland L (2002) A G-quadruplex-interactive potent small-molecule inhibitor of telomerase exhibiting in vitro and in vivo antitumor activity. Mol Pharmacol 61: 1154-1162.[Abstract/Free Full Text]

Hahn C, Stewart S, Knoll J, and Weinberg RA (1999) Inhibition of telomerase limits the growth of human cancer cells. Nat Med 5: 1164-1169.[CrossRef][Medline]

Harrington L and Robinson M (2002) Telomere dysfunction: multiple pathways to the same end. Oncogene Rev 21: 592-597.

Kamazawa S, Kigawa J, Iba T, and Terakawa N (2002) Multidrug resistance gene-1 is a useful predictor of Paclitaxel-based chemotherapy for patients with ovarian cancer. Gynecol Oncol 86: 171-176.[CrossRef][Medline]

Karlseder J, Smogorzewska A, and de Lange T (2002) Senescence induced by altered telomere state, not telomere loss. Science (Wash DC) 295: 2446-2449.[Abstract/Free Full Text]

Kim N, Prowse K, Harley C, Wright W, and Shay J (1994) Specific association of human telomerase activity with immortal cells and cancer. Science (Wash DC) 266: 2011-2015.[Abstract/Free Full Text]

Kim J, Lee G, and Chung I (2002) A novel telomere elongation in an adriamycin-resistant stomach cancer cell line with decreased telomerase activity. Mol Cell 13: 228-236.

Kondo Y, Tanaka Y, and Cowell J (1998) Inhibition of telomerase increases the susceptibility of human malignant glioblastoma cells to cisplatin-induced apoptosis. Oncogene 16: 2243-2248.[CrossRef][Medline]

Kuranaga N, Shinomiya N, and Mochizuki H (2001) Long term cultivation of colorectal carcinoma cells with anti-cancer drugs induces drug resistance and telomere elongation: an in vitro study. BMC Cancer 1: 2407-2418.

Lam L, Pickeral O, Peng A, Hurt E, Zhao H, Davis E, Wahl L, Monks A, Sausville E, and Staudt L (2001) Genomic-scale measurement of mRNA turnover and the mechanisms of action of the anti-cancer drug flavopiridol. Genome Biol 2: 1-11.

Lee K, Rudolph L, and DePinho R (2000) Telomere dysfunction alters the chemotherapeutic profile of transformed cells. Proc Natl Acad Sci USA 98: 3381-3386.

Losiewicz M, Carlson BA, Kaur G, Sausville E, and Worland P (1994) Potent inhibition of cdc2 kinase activity by the flavonoid L86-8275. Biochem Biophys Res Commun 201: 589-595.[CrossRef][Medline]

Morin GB (1989) The human telomere transferase enzyme is a ribonucleoprotein that synthesises TTAGGG repeats. Cell 51: 521-529.

Moyzis R, Buckingham J, Cram L, and Wu J (1988) A highly conserved repetitive DNA sequence (TTAGGG)n, present at the telomeres of human chromosomes. Proc Natl Acad Sci USA 65: 6622-6626.

Neidle S and Parkinson GN (2002) Telomere maintenance as a target for anticancer drug discovery. Nat Rev Drug Discov 1: 383-393.[CrossRef][Medline]

Opitz O, Suliman Y, and Rustig A (2001) Cyclin D1 overexpression and p53 inactivation immortalise primary oral keratinocytes by a telomerase-independent mechanism. J Clin Investig 108: 725-732.[CrossRef][Medline]

Pascolo E, Wenz C, Lingner J, Hauel N, Priepke H, Kauffmann I, Garin-Chesa P, Rettig WJ, Damm K, and Schnapp A (2002) Mechanism of human telomerase inhibition by BIBR 1532, a synthetic, non-nucleosidic drug candidate. J Biol Chem 277: 15566-15572.[Abstract/Free Full Text]

Read MA, Harrison RJ, Romagnoli B, Tanious FA, Gowan SH, Reszka AP, Wilson WD, Kelland LR, and Neidle S (2001) Structure-based design of selective and potent G quadruplex-mediated telomerase inhibitors. Proc Natl Acad Sci USA 98: 4844-4849.[Abstract/Free Full Text]

Robey R, Litman T, and Bates S (2001) Overexpression of the ATP-binding cassette half-transporter, ABCG2, in flavopiridol-resistant human breast cancer cells. Clin Cancer Res 7: 145-152.[Abstract/Free Full Text]

Sedlacek H (2001) Mechanisms of action of flavopiridol. Crit Rev Oncol Hematol 38: 139-170.[Medline]

Senderowicz A and Sausville E (2000) Preclinical and clinical development of cyclin-dependent kinase modulators. J Natl Cancer Inst 92: 367-387.

Shag JW and Wright WE (2002) Telomerase: a target for cancer therapeutics. Cancer Cell 2: 257-265.[CrossRef][Medline]

Sharp S, Jarman M, and Kelland L (1994) Effects of a new anti-oestrogen, idoxifene, on cisplatin and doxorubicin-sensitive and -resistant human ovarian cancer cell lines. Br J Cancer 70: 409-414.[Medline]

Smith V, Raynaud F, Workman P, and Kelland LR (2001) Characterisation of a human colorectal carcinoma cell line with acquired resistance to flavopiridol. Mol Pharmacol 60: 1-9.[Abstract/Free Full Text]

Stansel R, Subramanian D, and Griffith J (2001) p53 binds telomeric single strand overhangs and t-loop junctions in vitro. J Biol Chem 277: 11625-11628.

Taube R, Lin X, Irwin D, Fujinaga K, and Peterlin BM (2002) Interaction between P-TEFb and the C-terminal domain of RNA polymerase II activates transcriptional elongation from sites upstream or downstream of target genes. Mol Cell Biol 22: 321-331.[Abstract/Free Full Text]

van Steensel B, Bianchi A, and de Lange T (2000) Control of human telomere length by TRF1 and TRF2. Mol Cell Biol 20: 1659-1668.[Abstract/Free Full Text]

van Steensel B and de Lange T (1997) Control of human telomere length by the human telomeric protein TRF-1. Nature (Lond) 385: 740-743.[CrossRef][Medline]

Welsh S, Titley J, and Aherne GW (2000) Comparison of thymidylate synthase (TS) protein up-regulation after exposure to TS inhibitors in normal and tumor cell lines and tissues. Clin Cancer Res 6: 2538-2546.[Abstract/Free Full Text]

Wright WE, Brasiskyte D, Piatyszek M, and Shay JW (1996) Experimental elongation of telomeres extends the lifespan of immortalxnormal cell hybrids. EMBO (Eur Mol Biol Organ) J 15: 1734-1741.[Medline]

Zhai S, Senderowicz A, Sausville E, and Figg W (2002) Flavopiridol, a novel cyclin-dependent kinase inhibitor, in clinical development. Ann Pharmacother 36: 905-911.[Abstract]




This article has been cited by other articles:


Home page
Mol. Pharmacol.Home page
R. J. Ward and C. Autexier
Pharmacological Telomerase Inhibition Can Sensitize Drug-Resistant and Drug-Sensitive Cells to Chemotherapeutic Treatment
Mol. Pharmacol., September 1, 2005; 68(3): 779 - 786.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
C. Douarre, D. Gomez, H. Morjani, J.-M. Zahm, M.-F. O'Donohue, L. Eddabra, P. Mailliet, J.-F. Riou, and C. Trentesaux
Overexpression of Bcl-2 is associated with apoptotic resistance to the G-quadruplex ligand 12459 but is not sufficient to confer resistance to long-term senescence
Nucleic Acids Res., April 14, 2005; 33(7): 2192 - 2203.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Incles, C. M.
Right arrow Articles by Neidle, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Incles, C. M.
Right arrow Articles by Neidle, S.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
All ASPET Journals Molecular Pharmacology Pharmacological Reviews
 Molecular Interventions Drug Metabolism and Disposition

Copyright © 2003 by the American Society for Pharmacology and Experimental Therapeutics