|
|
|
|
Section on Molecular Neuroscience, Laboratory of Cellular and Molecular Regulation, National Institute of Mental Health (S.H.H., Y.C., L.E.E.), and Division of Biological Sciences, National Cancer Institute (C.V.), National Institutes of Health, Bethesda, Maryland
Received April 23, 2003; accepted August 29, 2003.
| Abstract |
|---|
|
|
|---|
Both elevated extracellular potassium and the cholinergic secretogogue nicotine stimulate calcium influx-dependent enkephalin secretion and gene transcription in chromaffin cells (Eiden et al., 1984
; Siegel et al., 1985
; Kley et al., 1986
). Activity-dependent neuropeptide gene regulation throughout the neuroendocrine axis is mediated through signaling to gene-specific cis-regulatory elements (MacArthur and Eiden, 1996
). One way this might occur is via protein kinase A-dependent activation (phosphorylation) of CREB. Neuropeptide genes examined so far that are transcriptionally responsive to cell depolarization [e.g., enkephalin, vasoactive intestinal polypeptide (VIP), and substance P] contain a proximal cAMP response element (CRE) that can bind CREB and therefore mediate classic cAMP responsiveness via protein kinase A-dependent CREB phosphorylation (Montminy and Bilezikjian, 1987
). CREB can also be activated by calcium via the stimulation of calmodulin kinase IV, which can directly phosphorylate and activate CREB at Ser-133 (Shaywitz and Greenberg, 1999
). A second pathway for activity-dependent neuropeptide gene regulation involves the activation of immediate early genes (IEGs) such as Fos and Jun in response to calcium influx (Morgan and Curran, 1991
). Fos and Jun, as members of AP-1 complexes, can transactivate neuropeptide genes at the same elements that bind CREB (Kobierski et al., 1991
; Anouar et al., 1999
). The proximal CRE of the proenkephalin A gene, called the ENKCRE-2, has been shown to mediate transcriptional responsiveness to both cAMP and increased intracellular calcium, which can be mimicked in F9 cells by cotransfection with junD, indicating that the ENKCRE-2 is capable of binding and transactivation through both CREB and AP-1 (Van Nguyen et al., 1990
; Kobierski et al., 1991
).
Various, and probably cell-type-specific, mechanisms of calcium signaling may therefore drive neuropeptide gene activation during stimulus-secretion synthesis coupling. Electrophoretic mobility shift assays (EMSAs) have been used to identify binding to the ENKCRE-2 of CREB but not AP-1 in rat striatum (Konradi et al., 1993
) and of AP-1 but not CREB in rat hippocampus (Sonnenberg et al., 1989
). However, it was not possible to establish in these studies that the dominant gel-shift complex that was formed in highly heterogeneous brain nuclear extracts was composed of proteins contributed specifically by enkephalin-expressing cells. Nuclear protein extracts taken from chromaffin cells have been reported to form EMSA complexes with ENKCRE-2-containing oligonucleotides, which mainly contain AP-1 with smaller amounts of CREB-immunoreactive protein (Bacher et al., 1996
; MacArthur, 1996
). Because these cultures contain predominantly enkephalin-expressing cells, the probability that complex-forming proteins are present in the same cell population expressing the endogenous proenkephalin gene is higher than it is in brain tissue nuclear extracts. Nevertheless, these experiments, carried out in molar excess of the DNA target, do not provide information on the role of relative binding affinity in recruitment of a given trans-acting factor that is present in vast molar excess to the endogenous single-copy gene of interest. Furthermore, a direct link between endogenous enkephalin gene transcription and reporter gene transcriptional behavior has not been made in these cells, such that the results of EMSA with the ENKCRE-2 can be directly applied to the presumptive regulatory behavior of the endogenous neuropeptide gene. Here, we demonstrate parallel regulation of endogenous PEnk mRNA production and PEnk reporter gene transcription in response to depolarization of bovine chromaffin cells, allowing the direct application of reporter-gene behavior to hypotheses about depolarization-induced regulation of the cognate endogenous neuropeptide gene. Our results suggest that calcium-dependent transcriptional activation is mediated mainly through calcineurin-dependent phosphorylation of CREB, acting at the ENKCRE-2 of the proenkephalin gene.
| Materials and Methods |
|---|
|
|
|---|
Cell Culture and Drug Treatments. Primary cultures of bovine chromaffin cells were prepared by perfusion of freshly obtained bovine (steer) adrenal glands with 0.1% Worthington collagenase and 30 units/ml DNase in standard release medium buffer with modifications that were described recently (Hahm et al., 1998
). Cells were differentially plated in T150 flasks (approximately 100 million cells/flask) overnight, and nonadherent (chromaffin) cells were replated the next day at 0.5 x 106 cells/well in 24-well plates (Costar, Cambridge, MA). Cells were cultured in Dulbecco's modified Eagle's medium with high glucose (Invitrogen) containing 5% heat-inactivated fetal bovine serum (Cambrex Bio Science Walkersville, Inc., Walk-ersville, MD) and supplemented with 100 units/ml penicillin and 100 µg/ml streptomycin, 50 µg/ml cytosine arabinofuranoside (Sigma), and 100 units/ml nystatin. In all experiments except as indicated, drug treatments were initiated 24 h after replating into 24-well dishes by removal of medium and addition of fresh medium containing inhibitors or vehicle. After a 30-min preincubation with inhibitors, medium was removed and replaced with inhibitors or vehicle containing 40 mM KCl (isotonic replacement of NaCl), 25 µM forskolin, 0.1 µM PMA, or medium alone. Medium and cells were harvested for peptide measurements 72 h later. Cells were harvested for RNA measurements 18 to 24 h later.
Radioimmunoassay for Met-Enkephalin and VIP. Met-enkephalin and VIP were assayed directly in aliquots of culture medium and in lyophilized 0.1 N HCl extracts of chromaffin cells as described previously (Hahm et al., 1998
; Lee et al., 1999
).
Northern Blot Analysis. Northern blot analysis of proenkephalin A mRNA was performed using total RNA isolated from cells maintained in 24-well plates by extracting with SDS-EDTA-Trisproteinase K buffer containing 10 mM Tris, pH 7.4, 1% SDS, 5 mM EDTA, and 100 µg/ml proteinase K, as described previously (Hahm et al., 1998
). Total RNA samples isolated from 0.5 x 106 cells/well were denatured and separated using 1% agarose-formaldehyde gel, electrotransferred onto a nylon membrane, and hybridized with 32P-labeled bovine proenkephalin A cDNA probe. The membrane was washed and autoradiographed, and proenkephalin mRNA bands were quantified by densitometric scanning of autoradiograms as described previously (Hahm et al., 1998
). Uniformity of total chromaffin cell RNA per lane was ensured by quantification of ethidium bromide-stained ribosomal (18S and 28S) RNA before electrophoretic transfer of RNA onto the nylon membrane.
Quantitative Reverse Transcriptase-Polymerase Chain Reaction. Quantitative reverse transcriptase-polymerase chain reaction was used to assess proenkephalin mRNA levels in some experiments. RNA isolation, reverse transcription, and quantification of proenkephalin A transcripts was carried out as described previously (Hamelink et al., 2002a
) using primer/probe sets optimized for bovine PEnk designed with the Primer Express software package (PerkinElmer Life and Analytical Sciences, Boston, MA) as follows: forward primer, TCCCCTTTCCCATCAGTGAC; reverse primer, CCAGCGCAGCAGTCTTTCA; and probe, CAGAAGCCTTCCTCTGCCCCC.
Nuclear Extract Preparation. Chromaffin cell nuclear extracts were prepared from cells treated with 40 mM KCl (or with vehicle) for 10 h and maintained in 6-well plates precoated with poly-D-lysine (1 ml of 100 µg/ml for 7 min/well) at a density of 4 x 106 cells/well, as described earlier (MacArthur et al., 1993
), with minor modifications. All the steps were taken at 4°C. Cells maintained in six-well plates were washed two times with Tris-buffered saline and scraped off the plate using 0.3 ml of freshly prepared buffer A (10 mM Hepes, pH 7.9, 10 mM KCl, 0.1 mM EDTA, 0.1 mM EGTA, 1 mM DTT, 0.5 mM phenylmethylsulfonyl fluoride, 0.5 mM benzamidine, 5 µg/ml leupeptin, 5 µg/ml aprotinin, and 2 µg/ml pepstatin), transferred to a microcentrifuge tube and allowed to swell on ice for 15 min. Cells were then lysed by adding 10 µl of 10% NP40 and vortexing four times for 1 s each. Samples were centrifuged for 30 s at 13,000 rpm, and nuclear pellets were resuspended in 35 µl of buffer C (20 mM HEPES, pH 7.9, 0.4 M NaCl, 1 mM EDTA, 1 mM EGTA, 1 mM DTT, 1 mM phenylmethylsulfonyl fluoride, and protease inhibitors as described above). Nuclear proteins were extracted by vigorously rocking the sample containing nuclei for 15 min. Samples were then centrifuged for 5 min at 13,000 rpm, and the supernatants containing nuclear proteins were stored at -80°C in small aliquots.
Electrophoretic Mobility Shift Assays. For gel-shift assays, binding reactions were performed in the presence of 3 µg of nuclear proteins and 100,000 to 140,000 cpm of double-stranded probe, which was produced by labeling annealed complementary oligonucleotides for the ENK-CRE2 sequence (gggcctgcgtcaacagcag) with [32P]ATP using T4 polynucleotide kinase (Promega, Madison, WI) in a 10-µl reaction containing 10 mM Tris, pH 7.5, 25 mM NaCl, 1 mM DTT, 1 mM EDTA, and 5% glycerol at room temperature for 20 min. Unincorporated nucleotides were removed using the Sephadex G-50 column-purification method. In supershift assays, nuclear extract was preincubated with the probe for 10 min and incubated for an additional 20 min after mixing with 1 µl of Transcruz antibodies (Santa Cruz Biotechnology, Inc., Santa Cruz, CA). The specificity of antibodies used was shown previously (Anouar et al., 1999
). Samples were resolved using 5% polyacrylamide gels at 4°C, and the gels were dried and autoradiographed.
Transient Transfection Experiments. Chromaffin cells were transfected using the Profection mammalian transfection system (Promega). Cells were plated in poly-D-lysine-coated 12-well plates at a density of 1 x 106 cells/well and were allowed to attach for approximately 16 h. Cells were transfected for 15 h according to the manufacturer's instructions, with 1.5 µg/well of either pENK12-luc reporter construct or pENK12-mCRE2 construct, which contains a double base-pair mutation within the ENK-CRE2 sequence, together with 1.5 µg of pRC-RSV-
-galactosidase construct. In cotransfection experiments, an additional 2.0 µg of the dominant-negative expression vector for CREB or Fos (or an empty vector) was included. After transfection, cells were carefully washed two times with complete medium and allowed to recover for 5 to 8 h before treating with KCl. Cells were harvested 40 to 48 h after treatment using 200 µl of reporter lysis buffer, and 20 µl of the lysate was used (in duplicate) for the luciferase assay.
Reporter Constructs and Expression Vectors. pENK12-Luc was constructed by subcloning the EcoRI/HincII fragment of pENKAT-12 (Comb et al., 1986
), obtained from Dr. Steven Hyman (Harvard University, Boston, MA) and containing 406 bp of the human proenkephalin gene, including 193 bp of the 5' flank, exon I (70 bp), intron A (87 bp), and exon II (53 bp), into the multiple cloning site of the pGL3-basic luciferase reporter (Promega). pENK-mCRE2 was constructed using the Transformer site-directed mutagenesis kit (BD Biosciences Clontech, Palo Alto, CA) and a complementary set of 30-bp oligonucleotides containing 2-bp substitutions within the CRE-2 sequence (ggcgtagggcctgcgAcTgctgcagcccgc; substituted bases are shown in uppercase letters). The dominant-negative bZIP expression vectors, A-CREB and A-Fos, have been described previously (Olive et al., 1997
; Ahn et al., 1998
) and were subcloned into either the pRc/CMV500 or pRc/RSV500 plasmids (Invitrogen).
Determination of Phosphorylated CREB by Immunoblotting. Immunoblotting assay was performed according to the protocol set forth by Cell Signaling Technology, Inc. (Beverly, MA). Chromaffin cells, plated in 10-cm dishes, were washed with phosphate-buffered saline and scraped off with 300 µl of lysis buffer plus 200 µl of 2x SDS sample buffer. Samples were lysed by sonicating for 15 s. After denaturing at 95 to 100°C for 5 min, cell lysates were centrifuged at 12,000 rpm for 10 min. The supernatant fractions (cell extract) were collected and subjected to SDS-polyacrylamide gel electrophoresis (for 1.5 h at 125 V) on 14% Tris-glycine polyacrylamide gels (NOVEX, San Diego, CA) followed by transfer to polyvinylidene difluoride membranes by electroblotting for 1.5 h at 25 V. Blots were incubated with a 1:1000 dilution of mouse monoclonal antibody specific for Ser-133-phosphorylated CREB (Cell Signaling Technology), followed by peroxidase-labeled anti-mouse second antibody (1:4000 dilution). Immunoreactive bands were detected using an enhanced chemiluminescence Western blotting kit (Amersham Biosciences UK Ltd., Little Chalfont, Buckinghamshire, UK). The optical density of phospho-CREB bands was measured using an Image Station 440 computer-controlled imaging system (Eastman Kodak, Rochester, NY).
| Results |
|---|
|
|
|---|
|
Both cAMP and protein kinase C have been implicated in calcium-initiated signal transduction pathways leading to gene activation in various cell types; however, enkephalin gene transcription stimulated by cell depolarization in chromaffin cells is distinct from that initiated by the elevation of cAMP or activation of protein kinase C in several ways. PEnk mRNA up-regulation by forskolin and PMA was sensitive to blockade by the protein synthesis inhibitor cycloheximide (CHX) at 0.5 µg/ml (Fig. 1), a dose at which the induction of new protein synthesis was completely inhibited, with a minimum effect on ambient protein levels (Table 1). The induction of PEnk mRNA by KCl, however, was completely insensitive to blockade by CHX (Fig. 1), indicating that under the culture conditions used in this study, calcium signaling to the PEnk gene requires only pre-existing protein machinery and is independent of the immediate early gene induction that is reported to occur in chromaffin cells in response to KCl, forskolin, and PMA treatment (Bacher et al., 1996
).
|
A second feature of calcium-initiated signaling to the PEnk gene that is distinct from regulation by cAMP or protein kinase C is its dependence on calcineurin. Ascomycin is a potent and selective inhibitor of KCl-induced PEnk mRNA up-regulation without effect on induction by either PMA or forskolin (Fig. 2). In addition to inhibiting calcineurin as part of a drug-FKBP12 complex, ascomycin and other FK506 derivatives are capable of actions that do not involve calcineurin but may modulate calcium signals, such as interaction with inositol phosphate-3 and ryanodine receptors in neuroendocrine cells (Steiner et al., 1997
). A series of cyclophilin- and immunophilin-binding agents were therefore tested for potency and efficacy in inhibiting KCl-induced up-regulation of enkephalin biosynthesis (Fig. 3). These included ascomycin; the potent FK506 analog L-683590; the mixed calcineurin antagonist L-685818; cyclosporin A, which inhibits calcineurin after binding to the immunophilin cyclophilin rather than to FKBP12; and finally rapamycin, an FKBP12-binding immunosuppressant which lacks calcineurin inhibitory activity in vitro (Bierer, 1994
; Dumont et al., 1996
). These compounds had a rank order of potency and efficacy in inhibiting the KCl-induced enkephalin biosynthesis expected if the inhibition of calcineurin activation was their primary mechanism of action in inhibiting PEnk mRNA induction by KCl (Bierer, 1994
). The inhibition of calcineurin, although blocking calcium-dependent PEnk biosynthesis, had no effect on enkephalin release elicited by elevated potassium levels (Fig. 3F), indicating that the steps downstream of calcium influx leading to exocytosis, unlike those leading to enhanced proenkephalin gene transcription, are not calcineurin-dependent.
|
|
Despite their very different mechanisms of action, both forskolin (data not shown) and KCl caused an increase in CREB phosphorylation in chromaffin cells (Fig. 4). As an indication that CREB phosphorylation is probably involved in depolarization-induced signaling to the PEnk gene, increased CREB phosphorylation after KCl treatment was blocked by both D600 and ascomycin, at concentrations that inhibit KCl-induced up-regulation of enkephalin-peptide biosynthesis and PEnk mRNA levels in chromaffin cells (Fig. 4).
|
A human PEnk minimal promoter (pENK12-Luc) containing the cAMP- and calcium-responsive cis-regulatory elements ENKCRE-1, ENKCRE-2, and AP-2 was transfected into bovine chromaffin cells to demonstrate the mechanism of KCl-induced proenkephalin biosynthesis at the level of transcriptional activation of the proenkephalin A gene. Stimulation of reporter-gene activity was examined after exposure to 40 mM KCl. Exposure to KCl elicited a 2- to 3-fold increase in reporter-gene activity that was similar to the KCl-induced increase in endogenous PEnk mRNA. Depolarization-induced up-regulation of pENK12-Luc reporter-gene activity was blocked by both ascomycin and D600, indicating that the minimal promoter was able to mimic the regulated behavior of the endogenous gene (Fig. 5). Calcium responsiveness was dependent on the ENKCRE-2 element, because its mutation to a nonconsensus sequence resulted in abrogation of stimulation of the transfected minimal promoter by KCl (Fig. 6). This hypothesis was confirmed by EMSA analysis of protein complexes formed between the ENKCRE-2 and chromaffin cell nuclear extracts. A gel-shift band present in both stimulated and unstimulated chromaffin cells was supershifted with antibodies directed against CREB (Fig. 7).
|
|
|
To confirm that KCl induction of pENK12-Luc reporter gene in chromaffin cells is mediated by CREB but not by AP-1, cotransfection experiments were performed using dominant-negative expression vectors for CREB and AP-1 (Olive et al., 1997
; Ahn et al., 1998
). Coexpression of pENK12-Luc with the dominant-negative CREB expression vector A-CREB blocked KCl-stimulated pENK12-Luc transcription, whereas coexpression with dominant-negative Fos expression vector A-Fos had no effect. This result suggests that binding of CREB, rather than AP-1, to the ENKCRE-2 mediates calcium-initiated transcriptional activation of the proenkephalin gene in chromaffin cells (Fig. 8).
|
Induction of PEnk mRNA by forksolin or pituitary adenylyl cyclase-activating protein is not blocked by 10 µM H89 (Fig. 9), confirming the previously reported cAMP-dependent/protein kinase A-independent pathway for activation of CRE-containing target genes in chromaffin cells (Hamelink et al., 2002a
). Induction of PEnk mRNA by 40 mM KCl, however, is selectively blocked by this serine/threonine protein kinase inhibitor (Fig. 9), implicating two potential CREB kinases, protein kinase A and mitogen- and stress-activated protein kinase isoform 1 (MSK1) (Davies et al., 2000
), in regulation of CREB phosphorylation after the activation of calcineurin.
|
| Discussion |
|---|
|
|
|---|
Previous reports on the regulation of proenkephalin biosynthesis regulation by depolarization in chromaffin cells have emphasized the potential role of IEGs in transcriptional regulation. Thus, depolarization has been reported previously to increase the abundance of mRNAs encoding IEGs, including c-Jun and c-Fos in bovine chromaffin cells, and increased PEnk mRNA abundance elicited by potassium depolarization has been reported to be blocked by the inhibition of new protein synthesis (Bacher et al., 1996
). However, such experiments do not distinguish between the action of IEGs per se, and nonspecific effects of cycloheximide in inhibiting the production of rapidly turning over but constitutively expressed proteins permissive for enkephalin gene transcription. Furthermore, increased gene transcription upon depolarization with nicotine or histamine is not blocked by c-Fos antisense oligonucleotide treatment, suggesting that newly synthesized c-Fos is not involved in this signaling pathway (Farin et al., 1990
). Finally, third and fourth messengers acting downstream of calcium influx to mediate the calcium responsiveness of the PEnk gene in chromaffin cells have not yet been characterized. Thus, the signaling pathway lying between calcium influx and cis-activation through the ENKCRE-2 in chromaffin cells remains largely uncharacterized.
To appropriately dissect the signal transduction pathway for stimulus-secretion synthesis coupling, it is critical to be able to compare it with other signal transduction pathways present in chromaffin cells, both to provide specificity controls for pharmacological inhibitors and exogenous signal transduction proteins and to determine whether other pathways converge on the calcium-transduction pathway. Here, we demonstrate that PEnk gene transcription in short-term chromaffin cell cultures is responsive to KCl, PMA, and forskolin, allowing the pathways that stimulate PEnk gene transcription and initiated by these agents to be directly compared. It is clear from both the analysis of protein-synthesis dependence and inhibition by immunosuppressive agents that the potassium depolarization/calcium influx-regulated pathway is distinct from both PMA- and cAMP-initiated signaling pathways that converge on the enkephalin gene. Specifically, KCl signaling to the endogenous PEnk gene is sensitive to inhibition by calcineurin antagonists, as reported for calcium signaling to CRE-containing reporter genes in pancreatic and lymphoid cell lines (Schwaninger et al., 1993
; Krüger et al., 1997
).
The calcineurin inhibitors used in this study blocked KCl-induced PEnk mRNA elevation and peptide synthesis without affecting secretion, demonstrating involvement of calmodulin-dependent phosphatase activity in mediating stimulus-synthesis coupling in chromaffin cells. Blockade of depolarization-induced PEnk gene up-regulation by ascomycin and cyclosporin A, but not by rapamycin, firmly implicates calcineurin as a calmodulin-dependent downstream component of this calcium-initiated signal transduction pathway. Calcium-initiated secretion, on the other hand, seems to be independent of calcineurin activation in chromaffin cells.
The signal transduction pathway leading to enhanced transcription of the proenkephalin gene under depolarizing conditions established here can be summarized as the following: Ca2+ influx
calmodulin/calcineurin activation
CREB activation
PEnk transcriptional up-regulation via ENKCRE2. This signal transduction pathway relies only on pre-existing rather than newly induced IEG products. Other workers have observed that the elevation of proenkephalin A mRNA levels by potassium depolarization, like that evoked after treatment with forskolin or PMA, requires new protein synthesis; i.e., it is blocked by cycloheximide (Bacher et al., 1996
). Cycloheximide sensitivity has also been reported for the induction of enkephalin mRNA by nicotine (Farin et al., 1990
), which, like potassium depolarization, is dependent on calcium influx (Eiden et al., 1984
) and is blocked by L-type calcium-channel blockers. The IEG-independent transcriptional effects of depolarization reported here may have been overlooked in previous reports in which cycloheximide concentrations were not titrated to the minimal dose required to inhibit de novo protein synthesis, avoiding potential effects on resting protein levels over a 24- to 72-h period.
Clear demonstration of a role for both calcineurin and CREB in coupling depolarization-induced calcium influx to enkephalin gene transcription in chromaffin cells represents an important advance in delineating the cellular components of activity-dependent signaling to the nucleus in homeostatic regulation of the secretory products of neuroendocrine cells. Steps downstream of calcineurin linking it to the phosphorylation and activation of CREB and the generality of this pathway to stimulus-secretion synthesis coupling in other neuronal systems can now be established. Inhibition of calcineurin/CREB-dependent calcium signaling to the proenkephalin A gene by the serine/threonine kinase inhibitor H89 suggests that one of the H89-sensitive CREB kinases, such as protein kinase A or MSK1 (Arthur and Cohen, 2000
; Davies et al., 2000
), is also a component in this pathway. There is as yet no evidence for calcineurin-dependent activation of either of these CREB kinases; however, one well-established pathway for MSK1 activation is via the extracellular signal-regulated kinase (ERK) cascade (Deak et al., 1998
). In myocytes, the activation of ERK by
-agonists is reported to require calcineurin (Zou et al., 2001
). Whether this pathway is accessed by calcineurin upon calcium influx after depolarization in neuroendocrine cells is a subject for future investigation; however, the observation that ERK1/2 phosphorylation is stimulated by elevated KCl in bovine chromaffin cells (Chen and Eiden, unpublished data) supports this possibility.
| Acknowledgements |
|---|
| Footnotes |
|---|
Address correspondence to: Dr. Lee E. Eiden, Building 36, Room 2A-11, National Institute of Mental Health, National Institutes of Health, 9000 Rockville Pike, Bethesda, MD 20892. E-mail: eiden{at}codon.nih.gov
| References |
|---|
|
|
|---|
Anouar Y, Lee HW, Hsu C-M, and Eiden LE (1999) Both inducible and constitutive AP-1-like transcription factors are utilized for transcriptional activation of the galanin gene by different first and second messenger pathways. Mol Pharmacol 56: 162-169.
Arthur JS and Cohen P (2000) MSK1 is required for CREB phosphorylation in response to mitogens in mouse embryonic stem cells. FEBS Lett 482: 44-48.[CrossRef][Medline]
Bacher B, Wang X, Schulz S, and Höllt V (1996) Induction of proenkephalin gene expression in cultured bovine chromaffin cells is dependent on protein synthesis of AP-1 proteins. J Neurochem 66: 2264-2271.[Medline]
Bierer BE (1994) Cyclosporin A, FK506 and rapamycin: binding to immunophilins and biological action. Chem Immunol 59: 128-155.[Medline]
Comb M, Birnberg NC, Seasholtz A, Herbert E, and Goodman HM (1986) A cyclic AMP- and phorbol ester-inducible DNA element. Nature (Lond) 323: 353-356.[CrossRef][Medline]
Davies SP, Reddy H, Caivano M, and Cohen P (2000) Specificity and mechanism of action of some commonly used protein kinase inhibitors. Biochem J 351: 95-105.[CrossRef][Medline]
Deak M, Clifton AD, Lucocq LM, and Alessi DR (1998) Mitogen- and stress-activated protein kinase-1 (MSK1) is directly activated by MAPK and SAPK2/p38 and may mediate activation of CREB. EMBO (Eur Mol Biol Organ) J 17: 4426-4441.[CrossRef][Medline]
Dumont FJ, Ok H, Lin S, Kastner CA, Cryan H, Martin MM, Wiederrecht G, and Staruch MJ (1996) Mixed agonist/antagonist activity of an FK-506-related immunosuppressant: Biological and biochemical characterization. J Pharmacol Exp Ther 276: 1078-1088.
Eiden LE, Giraud P, Dave J, Hotchkiss JA, and Affolter H-U (1984) Nicotinic receptor stimulation activates both enkephalin release and biosynthesis in adrenal chromaffin cells. Nature (Lond) 312: 661-663.[CrossRef][Medline]
Farin CJ, Kley N, and Höllt V (1990) Mechanisms involved in the transcriptional activation of proenkephalin gene expression in bovine chromaffin cells. J Biol Chem 265: 19116-19121.
Fischer-Colbrie R, Iacangelo A, and Eiden LE (1988) Neural and humoral factors separately regulate neuropeptide Y, enkephalin and chromogranin A and B mRNA levels in rat adrenal medulla. Proc Natl Acad Sci USA 85: 3240-3244.
Hahm SH, Hsu CM, and Eiden LE (1998) PACAP activates calcium influx-dependent and -independent pathways to couple met-enkephalin secretion and biosynthesis in chromaffin cells. J Mol Neurosci 11: 1-15.[Medline]
Hamelink C, Lee HW, Grimaldi M, and Eiden LE (2002a) Coincident elevation of cAMP and calcium influx by PACAP-27 synergistically regulates vasoactive intestinal polypeptide gene transcription through a novel PKA-independent signaling pathway. J Neurosci 22: 5310-5320.
Hamelink C, Lee HW, Hsu C-M, and Eiden LE (2002b) Role of protein kinases in neuropeptide gene regulation by PACAP in chromaffin cellsa pharmacological and bioinformatic analysis. Ann NY Acad Sci 971: 474-490.[Medline]
Kley N (1988) Multiple regulation of proenkephalin gene expression by protein kinase C. J Biol Chem 263: 2003-2008.
Kley N, Loeffler JP, Pittius CW, and Höllt V (1986) Proenkephalin A gene expression in bovine adrenal chromaffin cells is regulated by changes in electrical activity. EMBO (Eur Mol Biol Organ) J 5: 967-970.[Medline]
Kobierski LA, Chu HM, Tan Y, and Comb MJ (1991) cAMP-dependent regulation of proenkephalin by JunD and JunB: positive and negative effects of AP-1 proteins. Proc Natl Acad Sci USA 88: 10222-10226.
Konradi C, Kobierski LA, Nguyen TV, Heckers S, and Hyman SE (1993) The cAMP-response-element-binding protein interacts, but Fos protein does not interact, with the proenkephalin enhancer in rat striatum. Proc Natl Acad Sci USA 90: 7005-7009.
Krüger M, Schwaninger M, Blume R, Oetjen E, and Knepel W (1997) Inhibition of CREB- and cAMP response element-mediated gene transcription by the immunosuppressive drugs cyclosporin A and FK506 in T cells. Naunyn-Schmiedeberg's Arch Pharmakol 356: 433-440.[CrossRef][Medline]
Lee HW, Hahm SH, Hsu C-M, and Eiden LE (1999) Pituitary adenylate cyclase-activating polypeptide regulation of vasoactive intestinal polypeptide transcription requires Ca2+ influx and activation of the serine/threionine phosphatase calcineurin. J Neurochem 73: 1769-1772.[CrossRef][Medline]
MacArthur L (1996) AP-1 related proteins bind to the enkephalin CRE-2 element in adrenal chromaffin cells. J Neurochem 67: 2256-2264.[Medline]
MacArthur L and Eiden LE (1996) Neuropeptide genes: targets of activity-dependent signal transduction. Peptides 17: 721-728.[CrossRef][Medline]
MacArthur L, Koller KJ, and Eiden LE (1993) Enkephalin gene transcription in bovine chromaffin cells is regulated by calcium and protein kinase A signal transduction pathways: identification of DNase I-hypersensitive sites. Mol Pharmacol 44: 545-551.[Abstract]
Montminy MR and Bilezikjian LM (1987) Binding of a nuclear protein to the cyclic-AMP response element of the somatostatin gene. Nature (Lond) 328: 175-178.[CrossRef][Medline]
Morgan JI and Curran T (1991) Stimulus-transcription coupling in the nervous system: involvement of the inducible proto-oncogenes fos and jun. Annu Rev Neurosci 14: 421-451.[CrossRef][Medline]
Olive M, Krylov D, Echlin DR, Gardner K, Taparowsky E, and Vinson C (1997) A dominant negative to activation protein-1 (AP1) that abolishes DNA binding and inhibits oncogenesis. J Biol Chem 272: 18586-18594.
Pruss RM and Stauderman KA (1988) Voltage-regulated calcium channels involved in the regulation of enkephalin synthesis are blocked by phorbol ester treatment. J Biol Chem 263: 13173-13178.
Ross ME, Evinger MJ, Hyman SE, Carroll JM, Mucke L, Comb M, Reis DJ, Joh TH, and Goodman HM (1990) Identification of a functional glucocorticoid response element in the phenylethanolamine N-methyltransferase promoter using fusion genes introduced into chromaffin cells in primary culture. J Neurosci 10: 520-530.[Abstract]
Sabban EL, Hiremagalur B, Nankova B, and Kvetnansky R (1995) Molecular biology of stress-elicited induction of catecholamine biosynthetic enzymes. Ann NY Acad Sci 771: 327-338.[Medline]
Schwaninger M, Blume R, Oetjen E, Lux G, and Knepel W (1993) Inhibition of cAMP-responsive element-mediated gene transcription by cyclosporin A and FK506 after membrane depolarization. J Biol Chem 268: 23111-23115.
Shaywitz AJ and Greenberg ME (1999) CREB: A stimulus-induced transcription factor activated by a diverse array of extracellular signals. Annu Rev Biochem 68: 821-861.[CrossRef][Medline]
Siegel RE, Eiden LE, and Affolter HU (1985) Elevated potassium stimulates enkephalin biosynthesis in bovine chromaffin cells. Neuropeptides 6: 543-552.[CrossRef][Medline]
Sonnenberg JL, Rauscher FJ 3rd, Morgan JI, and Curran T (1989) Regulation of proenkephalin by fos and jun. Science (Wash DC) 246: 1622-1625.
Steiner JP, Connolly MA, Valentine HL, Hamilton GS, Dawson TM, Hester L, and Snyder SH (1997) Neurotrophic actions of nonimmunosuppressive analogues of immunosuppressive drugs FK506, rapamycin and cyclosporin A. Nature (Lond) Med 3: 421-428.
Van Nguyen, Kobierski L, Comb M, and Hyman SE (1990) The effect of depolarization on expression of the human proenkephalin gene is synergistic with cAMP and dependent upon a cAMP-inducible enhancer. J Neurosci 10: 2825-2833.[Abstract]
Wilson SP (1991) Regulation of proenkephalin synthesis in adrenal medullary chromaffin cells. J Neurochem 56: 945-952.[CrossRef][Medline]
Wong DL, Anderson LJ, and Tai TC (2002) Cholinergic and peptidergic regulation of phenylethanolamine N-methyltransferase gene expression. Ann NY Acad Sci 971: 19-26.[Medline]
Zigmond RE and Sun Y (1997) Regulation of neuropeptide expression in sympathetic neurons. Paracrine and retrograde influences. Ann NY Acad Sci 814: 181-197.[Medline]
Zou Y, Yao A, Zhu W, Kudoh S, Hiroi Y, Shimoyama M, Uozumi H, Kohmoto O, Takahashi T, Shibasaki F, et al. (2001) Isoproterenol activates extracellular signal-regulated protein kinases in cardiomyocytes through calcineurin. Circulation 104: 102-108.
This article has been cited by other articles:
![]() |
A. Franko, S. Mayer, G. Thiel, L. Mercy, T. Arnould, H.-T. Hornig-Do, R. J. Wiesner, and S. Goffart CREB-1{alpha} Is Recruited to and Mediates Upregulation of the Cytochrome c Promoter during Enhanced Mitochondrial Biogenesis Accompanying Skeletal Muscle Differentiation Mol. Cell. Biol., April 1, 2008; 28(7): 2446 - 2459. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Lindemeyer, J. Leemhuis, S. Loffler, N. Grass, W. Norenberg, and D. K. Meyer Metabotropic Glutamate Receptors Modulate the NMDA- and AMPA-Induced Gene Expression in Neocortical Interneurons Cereb Cortex, November 1, 2006; 16(11): 1662 - 1677. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||