|
|
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Department of Pharmacology (T.D.P., S.K., D.P.) and Center for the Neurobiology of Learning and Memory (D.P.), University of California, Irvine, Irvine, California
Received for publication April 29, 2004.
Accepted for publication July 22, 2004.
| Abstract |
|---|
|
|
|---|
In a previous study, we molecularly cloned rat brain monoacylglycerol lipase (MGL), a cytosolic serine hydrolase that cleaves 1- and 2-monoacylglycerols into fatty acid and glycerol (Karlsson et al., 1997
), and examined its role in neuronal 2-AG deactivation (Dinh et al., 2002
). We found that MGL is abundantly expressed in discrete areas of the rat brain, including the hippocampus, cortex, and cerebellum, where cannabinoid 1 receptors are also found. We have further shown that adenovirus-induced overexpression of MGL in primary cultures of rat brain neurons curtails the accumulation of 2-AG elicited by activation of glutamate N-methyl-D-aspartate receptors (Dinh et al., 2002
). Although these experiments indicate that MGL overexpression enhances 2-AG hydrolysis in intact neurons, they do not directly examine whether this enzyme is involved in the physiological breakdown of 2-AG. To further investigate this question, in the present study, we have taken two complementary approaches. First, we silenced MGL expression in HeLa cells using RNA interference (RNAi) (Fire et al., 1998
) and examined the impact of MGL knockdown on endogenous 2-AG degradation. Second, we used immunodepletion to determine the quantitative contribution of MGL to the total 2-AGhydrolyzing activity present in rat brain cytosol.
| Materials and Methods |
|---|
|
|
|---|
Adenovirus Production and Cell Infections. We produced adenovirus as described previously (Dinh et al., 2002
). In brief, we subcloned rat MGL cDNA into the plasmid pACYC (pACYC-MGL), cotransfected pACYC-MGL or pACYC (5 µg each) with pJM17 into low-passage human embryonic kidney 293 cells by calcium phosphate precipitation, and isolated adenovirus particles. The adenovirus stock was amplified and titered at the Viral Vector Center of the University of California, Irvine (Irvine, CA). Forty-eight hours before experiments, we infected HeLa cells for 2 h at 37°C with Ad5-Pac (control) or Ad5-MGL at a multiplicity of infection of 50.
Lipid Analyses. We extracted lipids with chloroform/methanol (2:1, v/v) and analyzed lipid products by high-performance liquid chromatography/mass spectrometry (HPLC/MS) as described previously (Giuffrida et al., 2000
). 2-[2H8]AG was purchased from Cayman Chemical. A separate standard curve was created to measure the levels of 2-oleoylglycerol using 1,3-heptadecanoyl-glycerol (500 pmol) (NuCheck Prep, Elysian, MN) as a standard.
RNA and Protein Analyses. We isolated total RNA (RNAqueous; Ambion, Austin, TX) from the brains of Wistar rats (weighing 250300 g) and HeLa cells. We homogenized brains in Tris buffer (50 mM), pH 8.0, containing 0.32 M sucrose and prepared supernatant fraction by ultracentrifugation (100,000g). Protein concentration was determined with Coomassie Plus kit (Pierce Endogen, Rockford, IL) by using bovine serum albumin as a standard. We electrophoresed supernatant proteins (50 µg) on SDS/12% polyacrylamide gel, transferred them to Immobilon membranes (Millipore Corporation, Billerica, MA), and conducted Western blot analyses as described previously (Dinh et al., 2002
) by using an ECL-Plus kit (Amersham Biosciences Inc., Piscataway, NJ) to visualize immunoreactive bands.
Enzyme Assays. We incubated supernatant protein (50 µg) in Tris buffer (50 mM), pH 8.0, with 2-oleoyl-[3H]glycerol (10 µM; 10,000 cpm, American Radiolabeled Chemicals, St. Louis, MO) for 30 min at 37°C. The reactions were stopped, and products were separated by organic solvent extraction (chloroform/methanol, 1:1). We measured [3H]glycerol released in the aqueous phase by liquid scintillation counting.
RNA Interference. Two complementary 64-base pair oligonucleotides containing both sense and antisense 21-mer sequences from the human MGL cDNA and separated by a short hairpin sequence were synthesized: forward, 5'-GATCCCAGTGCTCAACCTTGTGCTGTTCAAGAGACAGCACAAGGTTGAGCAC TTTTTTTGG AA-3'; reverse, 5'-AGCTTTTCCAAAAAAAGTGCTCAACCTTGTGCTGTCTCTTGAACAGCACAAGGTTGAGCACTGG-3' (Integrated DNA Technologies, Coralville, IA). Forward and reverse oligonucleotides were incubated in annealing buffer (100 mM potassium acetate, 30 mM HEPES-KOH, pH 7.4, and 2 mM magnesium acetate) for 3 min at 90°C followed by incubation for 1 h at 37°C. The annealed DNA was ligated to linearized pSilencer 2.1-U6 small interfering RNA expression vector (Ambion) at BamHI and HindIII sites to generate pSIL-siMGL. A sequence not found in the human, mouse, or rat genome was used as a negative control (pSIL-NC) (Ambion). For stable transfection, we seeded HeLa cells at a density of 60 to 75% in six-well plates, and they were grown overnight. The following day, we transfected cells with pSIL-siMGL or pSIL-NC (5 µg each) using Trojene (Avanti Polar Lipids, Alabaster, AL) according to manufacturer's instructions. Forty-eight hours later, the culture medium was replaced with medium containing 200 µg/ml hygromycin B (Calbiochem, La Jolla, CA). Stable clones were isolated after 14 days and maintained in hygromycin B (100 µg/ml).
Real-Time Quantitative Polymerase Chain Reaction. Reverse transcription of 2 µg of total RNA was carried out with 0.2 µg of oligo(dT)1218 primer for 50 min at 42°C using Superscript II RNaseH reverse transcriptase (Invitrogen, Carlsbad, CA), and realtime quantitative polymerase chain reaction was done with an ABI PRISM 7700 sequence detection system (Applied Biosystems, Foster City, CA). We designed primer/probe sets with Primer Express software (Applied Biosystems) and gene sequences available from the GenBank database. Primers and fluorogenic probes were synthesized by TIB Molbiol (Adelphia, NJ). The primer/probe sequences for the human MGL gene were as follows: forward, 5'-CAACCTTGTGCTGCCAAAC-3'; reverse, 5'-CGAGAGAGCACGCTGGAG-3'; TaqMan probe, 5'-TGTCCCTCGGGCCCATCG-3'. Starting RNA levels were quantified by using glyceraldehyde-3-phosphate dehydrogenase as external standard.
Stimulation of 2-AG Accumulation. We seeded HeLa cells stably expressing pSIL-siMGL (HeLa-MGLi) or pSIL-NC (HeLa-NC) (1 x 106) onto Corning 90-mm dishes and grown to 90 to 95%confluence. We rinsed the cells twice for 15 min with HEPES-buffered saline (125 mM NaCl, 5 mM KCl, 9 mM CaCl2, 20 mM HEPES, pH 7.4, and 20 mM glucose) and incubated cells with ionomycin (2 µM) in the same buffer for an additional 15 min to stimulate formation of 2-AG. We stopped the reaction with ice-cold methanol, extracted lipids with chloroform/methanol (2:1, v/v), and analyzed lipid products by HPLC/MS as described above. In some experiments, we preincubated cells with MAFP (1 µM) for 10 min and then stimulated with ionomycin. We then harvested cells in 50 mM ice-cold Trisbuffered saline, pH 8.0, prepared cell supernatant, and assayed for MGL activity as described above.
Immunodepletion of MGL. We coupled 0.1 mg of affinity-purified MGL antibody or rabbit IgG to a Seize X Immunoprecipitation column (Pierce Endogen) according to manufacturer's instructions. Supernatant protein from HeLa (2550 µg) or brain (0.10.15 mg) was incubated in the antibody-coupled column for 24 h at 4°C and recovered by centrifugation (4,000g).
Data Analyses. Results are expressed as mean ± S.E.M. Oneway analysis of variance or Student's t test was performed, when appropriate, using Prism (GraphPad Software Inc., San Diego, CA).
| Results |
|---|
|
|
|---|
|
Low basal levels of 2-AG were detectable by isotope-dilution HPLC/MS in both HeLa-NC and HeLa-MGLi cells (Fig. 1c,
). However, in HeLa-MGLi cells, such levels were significantly higher than in control HeLa-NC cells (P < 0.05, Student's t test) (Fig. 1c). Similar results were obtained when measuring the nonendocannabinoid monoacylglycerol 2-oleoylglycerol (2-OG) (Fig. 1d,
). After a 15-min incubation with the calcium ionophore ionomycin (2 µM), 2-AG accumulation was strongly stimulated in both cell types, but much more so in HeLa-MGLi than in HeLa-NC cells (Fig. 1c,
). The levels of 2-OG were also elevated (Fig. 1d,
). The results indicate that MGL contributes to the degradation of endogenous 2-AG in intact cells and confirm the broad role of this enzyme in the hydrolysis of cellular 2-monoacylglycerols (Karlsson et al., 1997
).
2-AG Hydrolysis in HeLa Cells Is Mediated Primarily by MGL. If MGL-mediated hydrolysis is a primary route of 2-AG degradation in HeLa cells, then pharmacological blockade of 2-AG hydrolysis should increase 2-AG levels in wild-type cells to values similar to those seen in cells that do not express MGL. To test this prediction, we used the potent lipid-hydrolase inhibitor MAFP. At 1 µM, MAFP reduced 2-AG hydrolysis in intact HeLa-NC cells to 15% of control cells (data not shown). When MAFP-treated cells were incubated with ionomycin (2 µM), the 2-AG content in these cells increased to values comparable with those measured in HeLa-MGLi cells (Fig. 2), suggesting that MGL-mediated hydrolysis is a redominant route for 2-AG catabolism in intact HeLa cells.
|
MGL Is a Major 2-AGHydrolyzing Activity in Brain Supernatant. To examine the contribution of MGL to brain 2-AG hydrolysis, we assessed the effect of MGL immunodepletion on total 2-AGhydrolyzing activity in the rat brain. We tested the specificity of our affinity-purified polyclonal antibody (Dinh et al., 2002
) using supernatant fractions of HeLa cells in which rat brain MGL overexpression had been induced through adenovirus-mediated gene transfer (Dinh et al., 2002
). As shown in Fig. 3a, immunodepletion reduced MGL activity in extracts of overexpressing cells by 80%, whereas it had no effect in extracts of vector-infected cells. Moreover, the procedure removed all MGL-like immunoreactivity from the extracts, as assessed by Western blot analyses (Fig. 3b). These results suggest that our antibody specifically recognizes and immunoprecipitates rat MGL but does not significantly interact with human MGL constitutively expressed in HeLa cells. The two proteins have 83% amino acid identity (Karlsson et al., 2001
). Then again, the levels of human MGL in HeLa cells may be below the detection limit of our antibody.
|
Next, we used the same procedure to deplete MGL from soluble fractions of rat brain tissue. Immunodepletion decreased MGL activity by 50% (Fig. 3c) along with a complete loss of detectable MGL immunoreactivity (Fig. 3d). The antibody removed both the
35 and
37 kDa MGL isoforms present in brain tissue, which are believed to arise either from alternative splicing or from as-yet-unidentified post-translational modifications (Karlsson et al., 2001
). To begin to characterize the residual hydrolase activity found in brain supernatants after immunodepletion, we conducted similar immunodepletion experiments in wild-type C57BL6J and faah-/- mice. As shown in Fig. 4a, we found no difference in MGL activity before and after immunodepletion in the two strains, suggesting that the residual activity is probably caused by an as-yet-unidentified enzyme, because FAAH is absent in the soluble fraction of rat brain. However, the activity was completely abrogated by boiling (data not shown) or by the nonselective inhibitor MAFP (Fig. 4b).
|
| Discussion |
|---|
|
|
|---|
Whether this conclusion can be extended to brain neurons is still unclear. Nevertheless, the immunodepletion experiments presented here suggest that MGL may account for as much as 50% of the total MGL activity present in soluble rat brain fractions. Although the residual activity measured after MGL immunodepletion was inhibited by MAFP, it could not be attributed to FAAH because it was present in brain soluble fractions from faah-/- mice. Together, these results suggest that hydrolysis via MGL is a quantitatively significant route for 2-AG catabolism in the rat brain but also imply that additional 2-AGhydrolyzing enzymes may exist. In agreement with this possibility, previous work has shown that the pig brain contains at least two chromatographically distinct 2-AGhydrolyzing activities (Goparaju et al., 1999
).
In conclusion, the functional and pharmacological evidence presented in this study supports a primary role for MGL in mediating 2-AG hydrolysis in intact cells. Because this endocannabinoid lipid has been implicated in a diversity of brain functions, targeting MGL may offer a rational approach for pharmacological intervention in neuroprotection, drug addiction, and feeding (Panikashvili et al., 2001
; Yamaguchi et al., 2001
; Kirkham et al., 2002
; Hanus et al., 2003
; Vigano et al., 2003
).
| Acknowledgements |
|---|
| Footnotes |
|---|
Article, publication date, and citation information can be found at http://molpharm.aspetjournals.org.
ABBREVIATIONS: FAAH, fatty acid amide hydrolase; 2-AG, 2-arachidonoylglycerol; MGL, monoacylglycerol lipase, MAFP, methyl arachidonyl fluorophosphonate; RNAi, RNA interference; HPLC/MS, high-performance liquid chromatography/mass spectrometry; 2-OG, 2-oleoylglycerol; URB597, 3'-carbamoyl-biphenyl-3-yl-cyclohexylcarbamate.
Address correspondence to: Dr. Daniele Piomelli, Department of Pharmacology, University of California, Irvine, 360 Med Surge II, Irvine, CA 92697. E-mail: piomelli{at}uci.edu
| References |
|---|
|
|
|---|
Beltramo M, Stella N, Calignano A, Lin SY, Makriyannis A, and Piomelli D (1997) Functional role of high-affinity anandamide transport, as revealed by selective inhibition. Science (Wash DC) 277: 1094-1097.
Cravatt BF, Demarest K, Patricelli MP, Bracey MH, Giang DK, Martin BR, and Lichtman AH (2001) Supersensitivity to anandamide and enhanced endogenous cannabinoid signaling in mice lacking fatty acid amide hydrolase. Proc Natl Acad Sci USA 98: 9371-9376.
Cravatt BF and Lichtman AH (2003) Fatty acid amide hydrolase: an emerging therapeutic target in the endocannabinoid system. Curr Opin Chem Biol 7: 469-475.[CrossRef][Medline]
Dinh TP, Carpenter D, Leslie FM, Freund TF, Katona I, Sensi SL, Kathuria S, and Piomelli D (2002) Brain monoglyceride lipase participating in endocannabinoid inactivation. Proc Natl Acad Sci USA 99: 10819-10824.
Fire A, Xu S, Montgomery MK, Kostas SA, Driver SE, and Mello CC (1998) Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature (Lond) 391: 806-811.[CrossRef][Medline]
Freund TF, Katona I, and Piomelli D (2003) Role of endogenous cannabinoids in synaptic signaling. Physiol Rev 83: 1017-1066.
Giuffrida A, Rodríguez de Fonseca F, and Piomelli D (2000) Quantification of bioactive acylethanolamides in rat plasma by electrospray mass spectrometry. Anal Biochem 280: 87-93.[CrossRef][Medline]
Goparaju SK, Ueda N, Taniguchi K, and Yamamoto S (1999) Enzymes of porcine brain hydrolyzing 2-arachidonoylglycerol, an endogenous ligand of cannabinoid receptors. Biochem Pharmacol 57: 417-423.[CrossRef][Medline]
Goparaju SK, Ueda N, Yamaguchi H, and Yamamoto S (1998) Anandamide amidohydrolase reacting with 2-arachidonoylglycerol, another cannabinoid receptor ligand. FEBS Lett 422: 69-73.[CrossRef][Medline]
Hanus L, Avraham Y, Ben-Shushan D, Zolotarev O, Berry EM, and Mechoulam R (2003) Short-term fasting and prolonged semistarvation have opposite effects on 2-AG levels in mouse brain. Brain Res 983: 144-151.[CrossRef][Medline]
Hillard CJ, Edgemond WS, Jarrahian A, and Campbell WB (1997) Accumulation of N-arachidonoylethanolamine (anandamide) into cerebellar granule cells occurs via facilitated diffusion. J Neurochem 69: 631-638.[Medline]
Karlsson M, Contreras JA, Hellman U, Tornqvist H, and Holm C (1997) cDNA cloning, tissue distribution, and identification of the catalytic triad of monoglyceride lipase. Evolutionary relationship to esterases, lysophospholipases and haloperoxidases. J Biol Chem 272: 27218-27223.
Karlsson M, Reue K, Xia YR, Lusis AJ, Langin D, Tornqvist H, and Holm C (2001) Exon-intron organization and chromosomal localization of the mouse monoglyceride lipase gene. Gene 272: 11-18.[CrossRef][Medline]
Kathuria S, Gaetani S, Fegley D, Valino F, Duranti A, Tontini A, Mor M, Tarzia G, La Rana G, Calignano A, et al. (2003) Modulation of anxiety through blockade of anandamide hydrolysis. Nat Med 9: 76-81.[CrossRef][Medline]
Kirkham TC, Williams CM, Fezza F, and Di Marzo V (2002) Endocannabinoid levels in rat limbic forebrain and hypothalamus in relation to fasting, feeding and satiation: stimulation of eating by 2-arachidonoyl glycerol. Br J Pharmacol 136: 550-557.[CrossRef][Medline]
Lang W, Qin C, Lin S, Khanolkar AD, Goutopoulos A, Fan P, Abouzid K, Meng Z, Biegel D, and Makriyannis A (1999) Substrate specificity and stereoselectivity of rat brain microsomal anandamide amidohydrolase. J Med Chem 42: 896-902.[CrossRef][Medline]
Lichtman AH, Hawkins EG, Griffin G, and Cravatt BF (2002) Pharmacological activity of fatty acid amides is regulated, but not mediated, by fatty acid amide hydrolase in vivo. J Pharmacol Exp Ther 302: 73-79.
Panikashvili D, Simeonidou C, Ben-Shabat S, Hanus L, Breuer A, Mechoulam R, and Shohami E (2001) An endogenous cannabinoid (2-AG) is neuroprotective after brain injury. Nature (Lond) 413: 527-531.[CrossRef][Medline]
Patricelli MP and Cravatt BF (1999) Fatty acid amide hydrolase competitively degrades bioactive amides and esters through a nonconventional catalytic mechanism. Biochemistry 38: 14125-14130.[CrossRef][Medline]
Piomelli D (2003) The molecular logic of endocannabinoid signalling. Nat Rev Neurosci 4: 873-884.[CrossRef][Medline]
Vigano D, Cascio MG, Rubino T, Fezza F, Vaccani A, Di Marzo V, and Parolaro D (2003) Chronic morphine modulates the contents of the endocannabinoid, 2-arachidonoyl glycerol, in rat brain. Neuropsychopharmacology 28: 1160-1167.[Medline]
Yamaguchi T, Hagiwara Y, Tanaka H, Sugiura T, Waku K, Shoyama Y, Watanabe S, and Yamamoto T (2001) Endogenous cannabinoid, 2-arachidonoylglycerol, attenuates naloxone-precipitated withdrawal signs in morphine-dependent mice. Brain Res 909: 121-126.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
M. L. Yates and E. L. Barker Inactivation and Biotransformation of the Endogenous Cannabinoids Anandamide and 2-Arachidonoylglycerol Mol. Pharmacol., July 1, 2009; 76(1): 11 - 17. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kano, T. Ohno-Shosaku, Y. Hashimotodani, M. Uchigashima, and M. Watanabe Endocannabinoid-Mediated Control of Synaptic Transmission Physiol Rev, January 1, 2009; 89(1): 309 - 380. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Prentki and S. R. M. Madiraju Glycerolipid Metabolism and Signaling in Health and Disease Endocr. Rev., October 1, 2008; 29(6): 647 - 676. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. M. Awumey, S. K. Hill, D. I. Diz, and R. D. Bukoski Cytochrome P-450 metabolites of 2-arachidonoylglycerol play a role in Ca2+-induced relaxation of rat mesenteric arteries Am J Physiol Heart Circ Physiol, May 1, 2008; 294(5): H2363 - H2370. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.-M. Jung, G. Astarita, C. Zhu, M. Wallace, K. Mackie, and D. Piomelli A Key Role for Diacylglycerol Lipase-{alpha} in Metabotropic Glutamate Receptor-Dependent Endocannabinoid Mobilization Mol. Pharmacol., September 1, 2007; 72(3): 612 - 621. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. G. Muccioli, C. Xu, E. Odah, E. Cudaback, J. A. Cisneros, D. M. Lambert, M. L. Lopez Rodriguez, S. Bajjalieh, and N. Stella Identification of a Novel Endocannabinoid-Hydrolyzing Enzyme Expressed by Microglial Cells J. Neurosci., March 14, 2007; 27(11): 2883 - 2889. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Hashimotodani, T. Ohno-Shosaku, and M. Kano Presynaptic Monoacylglycerol Lipase Activity Determines Basal Endocannabinoid Tone and Terminates Retrograde Endocannabinoid Signaling in the Hippocampus J. Neurosci., January 31, 2007; 27(5): 1211 - 1219. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. Pagotto, G. Marsicano, D. Cota, B. Lutz, and R. Pasquali The Emerging Role of the Endocannabinoid System in Endocrine Regulation and Energy Balance Endocr. Rev., February 1, 2006; 27(1): 73 - 100. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||