|
|
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Departments of Pharmacology (H.A.S., M.F.B., P.G.P., W.F.H., S.R., A.C.S.) and Therapeutic Radiology (S.R.) and the Developmental Therapeutics Program, Yale Cancer Center, Yale University School of Medicine, New Haven, Connecticut; and Department of Chemistry (M.T.), Hunter College, City University of New York, New York, New York
Received July 12, 2004; accepted November 11, 2004
Abstract
Overexpression of endoplasmic reticulum-localized NADPH: cytochrome c (P450) reductase (NPR) in Chinese hamster ovary cells increases the hypoxic/aerobic differential toxicity of the mitomycins. Because considerable evidence indicates that DNA cross-links are the major cytotoxic lesions generated by the mitomycins, we proposed that bioactivation of the mitomycins in the nucleus close to the DNA target would influence the cytotoxicity of these drugs. The simian virus 40 large T antigen nuclear localization signal was fused to the amino-terminal end of a human NPR protein that lacked its membrane anchor sequence. Immunofluorescent imaging of transfected cell lines expressing the fusion protein confirmed the nuclear location of the enzyme. Regardless of the oxygenation state of the cell, mitomycin C (MC) cytotoxicity was enhanced in cells with overexpressed NPR localized to the nuclear compartment compared with cells overexpressing an endoplasmic reticulum localized enzyme. Enhanced cytotoxicity in cells treated under hypoxic conditions correlated with increases in genomic DNA alkylations, with more MC-DNA adducts being formed when the enzyme was expressed closer to its DNA target. No change was observed in the hypoxic/aerobic differential toxicity as a function of enzyme localization. These findings indicate that drug efficacy is increased when the subcellular site of drug activation corresponds to its site of action.
Enzymes capable of bioreductively activating the mitomycins include NADPH:cytochrome c (P450) reductase (NPR; EC 1.6.2.4
[EC]
), NAD(P)H:quinone oxidoreductase (NQO1; DT-diaphorase; EC 1.6.99.2
[EC]
), and NADH:cytochrome b5 reductase (NBR; EC 1.6.2.2
[EC]
) (for reviews, see Sartorelli et al., 1994
; Belcourt et al., 1998a
). NPR activates the mitomycins through a one-electron reductive mechanism, producing a very short-lived semiquinone anion radical intermediate with a half-life in the microsecond range in the presence of oxygen (Kalyanaraman et al., 1980
; Halliwell and Gutteridge, 1989
). The semiquinone anion radical intermediate is susceptible to redox cycling, reacting with oxygen to regenerate the parent molecule. Thus, treatment of NPR-transfected CHO cells overproducing NPR with the mitomycins results in an oxygen-sensitive differential toxicity to these drugs, with hypoxic cells being more sensitive than oxygenated cells (Belcourt et al., 1996b
).
NQO1 reduction of the mitomycins proceeds by a two-electron reductive mechanism, producing the longer lived hydroquinone intermediate with a half-life of approximately 15 s (Penketh et al., 2001
). CHO cells overproducing this enzyme are sensitized to MC regardless of the degree of oxygenation, indicating that this intermediate is not subject to redox cycling (Belcourt et al., 1996a
; Seow et al., 2004a
,b
).
NBR activates the mitomycins through a one-electron reductive pathway (Hodnick and Sartorelli, 1993
) and, when overproduced as a cytoplasmic protein in CHO cells, sensitizes cells differentially to the mitomycins, with greater kill of hypoxic cells than aerobic cells (Belcourt et al., 1998b
; Holtz et al., 2003
). MC metabolism by the membrane-bound and soluble forms of this enzyme proceeds with similar kinetics (Belcourt et al., 1998b
). These findings are consistent with the production of the semiquinone anion radical by NBR and the subsequent redox cycling of this intermediate in the presence of oxygen. NPR resides in the endoplasmic reticulum, whereas NBR is known to localize predominantly in the mitochondrial outer membrane (Pietrini et al., 1992
) and NQO1 is located in the cytosol (Seow et al., 2004a
). The locations of major MC-activating enzymes suggest that activation of this antineoplastic agent in a cellular region distal to its presumed cytotoxic target, nuclear DNA, may not result in optimal cell killing. We have shown that nuclear overexpression of NBR (Holtz et al., 2003
) or NQO1 (Seow et al., 2004b
) close to its DNA target results in enhanced cell kill. The present report provides comparable findings for NPR, arguably the most important of the one-electron MC-activating enzymes, by demonstrating that localization of NPR-overexpressed activity to the nucleus of CHO cells enhances MC sensitivity relative to cells expressing a similar overexpressed level of this enzyme activity in its normal subcellular location, the endoplasmic reticulum.
Materials and Methods
Materials. MC was contributed by the Bristol-Myers Squibb Co. (Wallingford, CT). NADH, NADPH, NAD+, chloroquine, rotenone, and HEPES were purchased from Sigma-Aldrich (St. Louis, MO). Glutamine, hypoxanthine, thymidine, G418 (Geneticin), trypsin, penicillin, and streptomycin were purchased from Invitrogen (Carlsbad, CA). Tissue culture flasks and 60-, 100-, and 150-mm tissue culture dishes were acquired from Costar (Cambridge, MA). Dicumarol, potassium ferricyanide, and ethanol were obtained from Aldrich Chemical Co. (Milwaukee, WI). 2-Mercaptoethanol was from Bio-Rad (Hercules, CA). Na2HPO4·2H2O, dextrose, CaCl2, glycerol, Tris, EDTA, KH2PO4, KCl, and NaCl were obtained from J. T. Baker (Phillipsburg, NJ).
Cell Culture. The cell line used in this study is a variant of the CHO-K1 cell line termed CHO-K1/dhfr and was obtained from the American Type Culture Collection (Manassas, VA). This cell line is deficient in dihydrofolate reductase. The cells were maintained in Iscove's modified Dulbecco's medium (Invitrogen) supplemented with 10% fetal bovine serum (Hyclone Laboratories, Logan, UT), 2 mM glutamine, 0.1 mM hypoxanthine, 0.01 mM thymidine, and antibiotics (100 units/ml penicillin, 100 µg/ml streptomycin). Transfected lines were maintained in the identical medium supplemented with 1 mg/ml G418 to provide for selection of the expression vector. Cells were grown as monolayers in tissue culture flasks, petri dishes, or glass milk dilution bottles at 37°C under an atmosphere of 95% air, 5% CO2 in a humidified incubator. The doubling time of CHO-K1/dhfr cultures is 19 h.
Plasmid Constructions. To generate a chimeric protein capable of localizing NPR to the nucleus, sequences encompassing the SV40 large T antigen nuclear localization signal (NLS) (Kalderon et al., 1984
; Vancurova et al., 1994
) were fused to a truncated human NPR gene (Yamano et al., 1989
) lacking its membrane anchor sequences using PCR methodologies with the following oligonucleotides: 5' oligonucleotide, 5'-CGCGGTACCAAGCTTGCCACCATGGATAAAGTTTTAAACAGAGAGGAATCTTCTAGTGATGATGAGGCTACTGCTGACTCTCAACATTCTACTCCTCCAAAAAAGAAGAGAAAGGTAGAAGACCCCGCTAGCGTCCCCGAGTTCACCAAAATTCAG-3'; 3' oligonucleotide, 5'-CGCGGATCCTCTAGACTAAATACTTGGCCCTGCTTCATCA TATTCTTGTTTGGATATCCACATCCCGCTCCACACGTCCAGGGAGTAGCG-3'.
The 5' oligonucleotide encodes a HindIII restriction site (italicized), the translational initiation codon (bold), the SV40 sequences encompassing the nuclear localization signals (underlined), and sequences complementary to the NPR gene beginning at nucleotide 151 of the coding sequence (double underlined). The 3' oligonucleotide encodes an XbaI site (italicized) and a 15-amino acid region encoding the muscle actin epitope (underlined) (McHugh and Lessard, 1988
), recognized by the HUC1-1 antibody (MP Biomedicals, Irvine, CA) (Montecucco et al., 1995
), fused in frame to sequences complementary to the carboxy-terminal end of the NPR gene (double underlined). An unaltered NPR gene, except for a fusion of the 15-amino acid muscle actin epitope to the final NPR amino acid, was generated by PCR using the 3' oligonucleotide depicted above and the following 5' oligonucleotide: 5'-CGCGGATCCAAGCTTGGTACCTGGCCACCATGGGAGACTCCCACGTGGA-3'. The 5' oligonucleotide encodes a HindIII restriction site (italicized), the translational initiation codon (bolded), and sequences complementary to the NPR gene beginning at nucleotide 1 of the coding sequence (double underlined).
PCR was performed using these oligonucleotides and a cDNA encoding the full-length NPR gene. The amplified PCR product was extracted with phenol/chloroform, precipitated with 2.5 volumes of ethanol, and resuspended in 50 µl of Tris-EDTA (10 mM Tris-HCl, pH 8.0, 1 mM EDTA). After digestion of 5 µl of the amplified cDNA with HindIII and XbaI (Roche Diagnostics, Indianapolis, IN), the fragment was subcloned into the eukaryotic expression plasmid pRC/CMV (Invitrogen), and recombinants were screened by restriction analysis. The plasmid, designated pRC/CMV-NLS-NPR, contains the promoter sequences from the immediate early gene of the human cytomegalovirus and the appropriate sequences for polyadenylation and selection (neomycin resistance); it inserts stably into the genome of transfected cell lines.
Transfections. Transfections were performed by the Ca3(PO4)2-DNA coprecipitation method essentially as described by Sambrook et al. (1989
) and modified by Belcourt et al. (1998b
). Single colonies were introduced into wells of a 24-well plate using sterile cotton-tipped applicators (General Medical Corp., Richmond, VA). After expansion, the isolates were screened for expression of the NPR cDNA gene. Isolates having elevated enzyme activity were cloned by flow cytometric single cell sorting, and the resulting clones were rescreened. Vector-transfected control clones were CHO-K1/dhfr cells transfected with the plasmid without a cDNA insert.
Assays of Enzyme Activity. Exponentially growing cells (approximately 5 x 106 total cells) were harvested by trypsinization, washed in cell culture medium containing 10% fetal bovine serum to inactivate the trypsin, washed with phosphate-buffered saline (138 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, and 1.8 mM KH2PO4, pH 7.4), and then resuspended in 2 ml of the same buffer. Cells were disrupted by sonication using a Branson sonicator (Branson Ultrasonics Corp., Danbury, CT) with three 15-s bursts at a setting of 25 with 1 min of cooling on ice between each sonication burst. Cell disruption was confirmed microscopically. NQO1 activity was measured as the dicumarol-inhibitable reduction of dichlorophenol indophenol, measured at 600 nm with a Beckman model 25 UV/Vis spectrophotometer (Beckman Coulter, Fullerton, CA) using an extinction coefficient of 21 mM1 cm1 at 30°C (Ernster, 1967
). The final concentration of dicumarol was 100 µM. NPR activity was assayed in cell extracts by monitoring the rate of ferricytochrome c reduction at 550 nm (extinction coefficient of 21 mM1 cm1) at 30°C (Yasukochi and Masters, 1976
). NBR activity was measured as NADH:ferricyanide reductase at 420 nm (extinction coefficient of 1.02 mM1 cm1) at 30°C essentially as described by Yubisui and Takeshita (1982
) but using a final concentration of 0.34 mM NADH. Protein concentrations were assayed using the bicinchoninic protein assay reagent (Pierce Chemical, Rockford, IL) (Smith et al., 1985
).
Aerobic/Hypoxic Experiments. Exponentially growing monolayers of CHO-K1/dhfr, CHO-NLS-NPR-9A, CHO-NPR-8A, and CHO-NPR-16 cells were seeded in glass milk dilution bottles at 2 x 105 cells per bottle and were used in mid-exponential phase (approximately 3 to 4 days of growth). Hypoxia was induced by gassing the cultures with a humidified mixture of 95% N2,5%CO2 (<10 ppm O2) at 37°C for 2 h through a rubber septum fitted with 13-gauge (inflow) and 18-gauge (outflow) needles. After induction of hypoxia, cells were exposed to 2.5, 5, 7.5, and 10 µM MC for 1 h; drugs were injected through the septum without compromising the hypoxia. Cells under aerobic conditions were treated with MC in an identical manner for 1 h in a humidified atmosphere of 95% air, 5% CO2 at 37°C. Treated cells were washed, harvested by trypsinization, and assayed for survival by measuring their ability to form macroscopic colonies (Rockwell, 1977
). Both aerobic and hypoxic vehicle controls (70% ethanol) were included in each experiment; the surviving fractions were normalized using these vehicle controls. The plating efficiencies (colonies/100 plated cells; means ± standard deviations) for CHO-K1/dhfr, CHO-NPR-16, CHO-NPR-8A, and CHO-NLS-NPR-9A cells were 85 ± 5, 74 ± 5, 84 ± 1, and 77 ± 3, respectively. The surviving fractions for the aerobic vehicle-treated controls (means ± standard deviations) were 1.07 ± 0.09, 1.01 ± 0.03, 1.02 ± 0.04, and 0.95 ± 0.05, whereas the surviving fractions for the hypoxic vehicle-treated controls were somewhat lower, reflecting the toxic effects of the hypoxia: 0.58 ± 0.05, 0.55 ± 0.03, 0.54 ± 0.04, and 0.45 ± 0.02 for CHO-K1/dhfr, CHO-NPR-16, CHO-NPR-8A, and CHO-NLS-NPR-9A cells, respectively.
Immunofluorescence Microscopy. Cells were seeded on poly-D-lysine-coated glass slides and cultured for 2 days as described above. After a 15-min fixation in 20% formaldehyde, the cells were permeabilized with cold acetone for 5 min and then incubated with a 1:128 dilution of an anti-muscle actin monoclonal antibody (HUC1-1; MP Biomedicals), washed, and then incubated with a fluorescein isothiocyanate-conjugated anti-mouse IgG (Sigma-Aldrich) diluted to 1:128. Cells were counterstained using 10 µg/ml Hoechst 33342 (Molecular Probes, Eugene OR). Cells were visualized and photographed at 40x magnification using a Zeiss Axioskop fluorescence microscope (Carl Zeiss, Jena, Germany) equipped with appropriate excitation/emission filters and a SPOT charge-coupled device camera (Diagnostic Instruments, Sterling Heights, MI).
Total [3H]MC-DNA Adducts. Cells in suspension (1 x 107 cells/ml) were treated with 10 µM [3H]MC (0.18 mCi/mmol; donated by Kyowa Hakkao Kogyo Co, Tokyo, Japan) for 2 h under aerobic or hypoxic conditions that were established by continuously gassing the cells with either 95% air, 5% CO2 or 95% N2, 5% CO2, respectively, starting 2 h before drug exposure. Genomic DNA was isolated from 1 x 107 cells using the PURGENE DNA purification system (Gentra Systems, Inc., Minneapolis, MN) as described by the manufacturer and reported previously (Holtz et al., 2003
; Seow et al., 2004b
). In brief, cells were lysed and treated with 100 mg/ml proteinase K overnight followed by 20 mg/ml RNase A for 2 h at 37°C. Isolated DNA was washed two times with 70% ethanol to remove noncovalently bound [3H]MC, and the DNA was resuspended in 10 mM Tris-HCl, 1 mM EDTA, pH 7.0. DNA samples with A260/A280 ratios of 1.8 to 1.9 were isolated by this methodology. An aliquot was used to quantify the number of [3H]MC-DNA adducts using a Beckman scintillation spectrometer, and DNA concentration was determined spectrophotometrically at A260. Radioactivity in the sample was normalized to the total DNA concentration.
Results
CHO cells were transfected with plasmids encoding a wild-type NPR cDNA that produced a protein localized to its normal subcellular compartment, the endoplasmic reticulum (CHO-NPR-16), an NPR cDNA with a 15-amino acid muscle actin epitope carboxyl-terminal fusion (CHO-NPR-8A), or a truncated NPR cDNA with the membrane anchor sequence deleted and the region of the SV40 large T antigen sequence, which localizes this protein to the nucleus, added (CHO-NLS-NPR-9A). This latter construct also contained a carboxyl-terminal fusion to the 15-amino acid muscle actin epitope to allow visualization of the NPR protein by immunofluorescence. Cells transfected with these constructs were cloned and screened for NPR enzymatic activity. Three clones with relatively similar levels of NPR enzyme activity, CHO-NLS-NPR-9A, CHO-NPR-8A, and CHO-NPR-16, overexpressing NPR by 9-, 8-, and 16-fold, respectively, were changed only in the levels of expression of NPR specific activity, with no significant change in two other enzyme systems important for MC bioreduction in these cell lines (i.e., NQO1 and NBR), compared with parental cells (Table 1). CHO-NPR-8A is included to control for any effects on enzyme-specific activity of the carboxyl-terminal fusion of the 15-amino acid actin epitope.
|
The subcellular location of the NPR enzyme in cells transfected with the NLS fusion protein was examined by indirect immunofluorescence microscopy and confirmed by colocalization with DNA stained with the Hoechst 33342 dye in the same cells. After incubation with the HUC1-1 monoclonal antibody specific for the 15-amino acid muscle actin epitope of the fusion protein, CHO-NLS-NPR-9A cells exhibited highly fluorescent nuclear staining (Fig. 1A) that colocalized with the nuclear DNA staining identified by the Hoechst 33342 dye (Fig. 1C), indicating the successful localization of this enzyme to the nuclear compartment. Cells of the CHO-NPR-16A transfectant that expressed a form of NPR that does not partition into the nucleus exhibited primarily cytosolic staining, as shown in Fig. 1B, and did not colocalize with the nuclear DNA observed in these cells counterstained with Hoechst 33342 dye (Fig. 1D). In CHO-K1/dhfr parental cells incubated with the HUC1-1 monoclonal antibody (Fig. 1C), no fluorescence was observed, demonstrating that the antibody was specific for the epitope. In these cells, fluorescence was observed when visualized using the Hoechst filter set that served as a control (Fig. 1E). We have shown previously that the wild-type NPR enzyme, containing the amino terminal membrane anchor sequence (retained in CHO-NPR-16 and CHO-NPR-8A), localizes to the microsomal fraction of CHO-K1/dhfr cells (Belcourt et al., 1996b
).
|
Using a clonogenic assay, the cytotoxicity of MC to the parental cell line and the three NPR-overexpressing cell lines was measured under both aerobic and hypoxic conditions. Parental cell sensitivity to MC is shown in Fig. 2A, which demonstrates slightly greater cell kill under hypoxic conditions; these results are in agreement with our findings in a previous report (Belcourt et al., 1998b
). Elevation of the wild-type NPR enzyme activity by 16-fold resulted in the CHO-NPR-16 cell line becoming markedly more sensitive to MC, with greater increases in cytotoxicity occurring under hypoxia than under aerobic conditions (Fig. 2A). This result is consistent with previous studies (Belcourt et al., 1996b
) and presumably indicates the increased generation of the semiquinone anion radical intermediate of MC by the NPR enzyme, with redox cycling and consequent inactivation of most of this intermediate under aerobic, but not hypoxic, conditions. The control cell line CHO-NPR-8A, containing an NPR cDNA clone modified only through the addition of a carboxyl-terminal fusion of the 15-amino acid muscle actin epitope to the NPR enzyme, yielded an increase in MC sensitivity under hypoxia comparable with CHO-NPR-16, with no increase in the cytotoxicity under aerobic conditions over that produced in CHO-NPR-16 cells (Fig. 2B).
|
Nuclear localization of the NPR enzyme resulted in even greater sensitivity of CHO cells to MC, compared with the endoplasmic reticulum-localized enzyme, regardless of the oxygenation state of the cells (Fig. 2C). No change was observed, however, in the aerobic/hypoxic differential toxicity as a function of enzyme localization. Despite expressing only 60% of the amount of NPR enzyme activity present in CHO-NPR-16 cells (Table 1), the CHO-NLS-NPR-9A cells were at least 18- and 25-fold more sensitive to MC at 7.5 µM under aerobic and hypoxic conditions, respectively (Fig. 2C). Compared with parental cells treated with 10 µM MC, the CHO-NLS-NPR-9A cell line exposed to 7.5 µM drug was 29- and 840-fold more sensitive under aerobic and hypoxic conditions, respectively. A cell line that spontaneously reverted from an overexpressed NLS-localized NPR enzyme to the parental level and distribution of NPR activity resulted in a loss of hypersensitivity to MC (data not shown).
By treating cells with 10 µM[3H] MC for 2 h under hypoxic conditions, striking increases in the number of genomic DNA alkylations were observed (Table 2). Thus, in cells that overexpressed NPR activity in the endoplasmic reticulum, the number of MC-DNA adducts increased by 35% over that of wild-type parental cells. Overexpression of NPR activity by 9- and 13-fold in the nucleus produced increases in MC-DNA adducts of 54 and 116%, respectively, in hypoxia over that occurring in parental cells exposed to [3H]MC under identical conditions. Furthermore, nuclear overexpression of NPR activity by 9- and 13-fold under hypoxia produced increases in MC-DNA adducts of 14 and 87%, respectively, over that occurring in cells overexpressing NPR activity by 16-fold in the endoplasmic reticulum. In contrast, overexpression of NPR activity in aerobic cells in either the endoplasmic reticulum or the nucleus did not produce significant increases in the number of MC-DNA adducts over that of parental cells, reflecting the fact that NPR activity does not participate in the activation of MC under aerobic conditions because of redox cycling. CHO parental and the CHO-NPR-16, CHO-NLS-NPR-9A, and CHO-NLS-NPR-13A transfectants exposed to MC under conditions of hypoxia exhibited increases of 53, 94, 200, and 330% in the production of MC-DNA adducts over corresponding aerobic cells, reflecting preferential alkylation of DNA by [3H]MC under hypoxic conditions.
|
Discussion
The bioreduction of MC can occur through either a one- or a two-electron reduction mechanism, producing intermediates with markedly different reaction kinetics. The product of the two-electron reduction of MC, the hydroquinone intermediate, has a half-life of approximately 10 s in aqueous buffer at physiological temperature and pH (Penketh et al., 2001
). Moreover, relative to the one-electron reduction intermediate of MC, the semiquinone anion radical, the hydroquinone is not subject to reoxidation by molecular oxygen (Ross et al., 1994
), and thus is a highly reactive electrophile that is probably the major precursor of the MC-DNA cross-links in living cells (Butler et al., 1985
). Considering the 15-s half-life of the hydroquinone, its subcellular distribution should not be diffusion limited. On the other hand, the semiquinone anion radical intermediate, produced by NPR, reacts with oxygen at a rate comparable with diffusion-controlled reactions, regenerating the nontoxic parental compound (Kalyanaraman et al., 1980
; Halliwell and Gutteridge, 1989
). In the presence of oxygen, the half-life of the semiquinone intermediate is estimated to be approximately 2 x 108 s (Butler et al., 1985
). Thus, in the presence of oxygen, the semiquinone anion radical is essentially innocuous. However, under reducing conditions, the generation of the semiquinone anion radical does result in a highly reactive alkylating species capable of cross-linking DNA (Cera et al., 1989
). Some studies suggest that the mitosenyl semiquinone anion radical is a better alkylating and cross-linking agent than is the mitosenyl hydroquinone (Egbertson and Danishefsky, 1987
), although more compelling evidence implies that disproportionation of the semiquinone anion radical to the hydroquinone intermediate must occur for the activation cascade to proceed to the formation of DNA cross-links (Hoey et al., 1988
; Machtalere et al., 1988
; Suresh Kumar et al., 1997
). Given the potential importance of NPR in the activation of MC, coupled with the greater reactivity and shorter half-life of the semiquinone anion radical, we sought to explore whether the subcellular site of MC bioreduction by NPR, which generates the semiquinone anion radical through a one-electron reduction of MC, could affect the sensitivity of CHO cells to this drug. Previous studies by this laboratory have shown that nuclear localization of the one-electron reducing system NBR (Holtz et al., 2003
) and the two-electron reducing enzyme NQO1 (Seow et al., 2004b
) markedly increased the cytotoxicity of MC.
CHO cell clones were developed that overexpressed NPR activity from cDNA constructs encoding either an endoplasmic reticulum (overexpression of NPR by 16-fold for CHO-NPR-16 and 8-fold for CHO-NPR-8A) or nuclear (overexpression of NPR by 9-fold for CHO-NLS-NPR-9A and 13-fold for CHO-NLS-NPR-13A) localized form of NPR. In each of the transfected clones, the levels of other known oxidoreductases present in these cells, capable of bioreductively activating MC, were similar to those of the parental cell line. Immunofluorescence microscopy demonstrated that in CHO-NLS-NPR-9A cells the chimeric NPR protein localized to the nucleus. Subcellular fractionation studies with wild-type NPR established that this protein colocalizes with the cellular microsomal fraction (Belcourt et al., 1996b
).
Compared with parental cells, elevating the expression of the unmodified, endoplasmic reticulum-localized human NPR protein in CHO-NPR-16 caused significant increases in cell sensitivity to MC under both aerobic and hypoxic conditions, with a markedly greater increase in cell kill occurring under hypoxia. This resulted in an increase in the hypoxic/aerobic differential toxicity of MC, as we observed previously in NPR-transfected cells (Belcourt et al., 1996b
). A similar result was observed with CHO-NPR-8A cells, indicating that the fusion of the 15-amino acid actin epitope to the carboxy terminus of NPR did not adversely affect the ability of this enzyme to reduce MC. Because the NPR-catalyzed one-electron reduction product of MC, the semiquinone anion radical, is known to be highly reactive and short-lived, we reasoned that activation of MC close to the site of its presumed target for its cytotoxic action, nuclear DNA, might increase the efficacy of the drug. Numerous studies have demonstrated the ability of the mitomycins to cross-link complementary DNA strands at the two-amino function of guanine residues in the sequence 5'-CpG-3' (for review, see Tomasz, 1995
). These lesions are so lethal that a single genomic DNA inter-strand cross-link will kill susceptible bacterial cells (Szybalski and Iyer, 1964
). In mammalian cells, the degree of cytotoxicity of several mitomycins, including MC, correlates with the number of DNA cross-links formed, supporting the concept that the critical lesion responsible for the cytotoxicity of the mitomycins is DNA cross-linking (Keyes et al., 1991
). Moreover, a panel of DNA repair-deficient CHO cells has been used to genetically implicate mitomycin-induced DNA cross-links as a major cytotoxic lesion (Hughes et al., 1991
).
To test the hypothesis that MC cytotoxicity is increased when the subcellular site of drug activation is close to its site of action, the cell line CHO-NLS-NPR-9A and CHO-NLS-NPR-13A, overexpressing the nuclear-localized form of NPR activity, was tested for changes in sensitivity to MC relative to a cell line, CHO-NPR-16, overexpressing an endoplasmic reticulum-localized form of the enzyme. Despite expressing only 56 and 80% of the level of NPR activity as CHO-NPR-16 cells, CHO-NLS-NPR-9A and CHO-NLS-NPR-13A cells, respectively, were markedly more sensitive to MC than CHO-NPR-16 under both aerobic and hypoxic conditions; the hypoxic/aerobic differential was similar in both cell lines. A considerable increase in cytotoxicity is apparent under aerobic conditions, notwithstanding the increased generation of the redox-sensitive semiquinone anion radical. The generation of the semiquinone anion radical in the nucleus possibly allows it to react with nuclear DNA before reacting essentially completely with oxygen and recycling back to parental MC. However, recent evidence suggests that the biological effects of the semiquinone anion radical may be caused by its disproportion to the hydroquinone (Suresh Kumar et al., 1997
). It is therefore more likely that the increased intracellular concentration of the semiquinone anion radical allows greater disproportionation to the hydroquinone intermediate under aerobic conditions, resulting in increased cytotoxicity. Moreover, the activation of MC in the cytoplasm has been suggested to result in the alkylation of nucleophiles other than nuclear DNA, with the resulting loss of active drug, as the reactive hydroquinone electrophile migrates toward its nuclear DNA target (Seow et al., 2004b
). In addition, the proximity of the hydroquinone intermediate to nuclear DNA has been suggested to be important for mitomycin toxicity because this prevents the shunting of the hydroquinone into an alternative, noncytotoxic pathway, culminating in the formation of 2,7-diaminomitosene (Palom et al., 1998
). Previous results with NBR (Holtz et al., 2003
) and NQO1 (Seow et al., 2004b
) and the present findings with NPR clearly indicate that the subcellular site of MC bioactivation can influence the cytotoxicity of this antibiotic.
Because reduction of MC by NPR and NBR generates the one-electron reduction intermediate, the semiquinone anion radical, we hypothesized that agents that generate short-lived, highly reactive alkylating intermediates may require activation close to their targets to be maximally effective. Drug activation in the cytosol by NPR and NBR allows the reduced mitomycin intermediates to generate cytotoxicity under hypoxic conditions, presumably because they can now reach and cross-link nuclear DNA before spontaneously rearranging and reacting with other macromolecules or water. Likewise, the nuclear localization of NPR enhances the cytotoxicity of MC relative to that of wild-type, endoplasmic reticulum localized NPR, suggesting that, at the subcellular level, proximity to the DNA target is important for the degree of cell kill by the semiquinone anion radical and hydroquinone intermediates.
An important clinical implication from this work is that, depending upon the nature of the therapeutic agent, the subcellular location of an activating protein delivered by gene therapy methodologies should be considered when designing the constructs. Drug activation at the wrong subcellular location could lead to resistance to the therapeutic agent of interest. Likewise, it may be possible to exploit this concept to overcome natural or acquired cellular resistance to an agent by relocating an activating enzyme to a more appropriate subcellular site.
Footnotes
This research was supported in part by National Cancer Institute grant CA80845 (to A.C.S.) and American Cancer Society grant EDT-62N (to S.R.).
H.A.S. and M.F.B. contributed equally to this article.
Article, publication date, and citation information can be found at http://molpharm.aspetjournals.org.
ABBREVIATIONS: MC, mitomycin C; NPR, NADPH:cytochrome c (P450) reductase; NQO1, NAD(P)H:quinone oxidoreductase; NBR, NADH: cytochrome b5 reductase; CHO, Chinese hamster ovary; SV40, simian virus 40; NLS, nuclear localization signal; PCR, polymerase chain reaction.
1 Current address: Vion Pharmaceuticals, Inc., New Haven, CT 06511. ![]()
2 Current address: Athersys, Inc., Cleveland, OH 44115. ![]()
Address correspondence to: Dr. Alan C. Sartorelli, Department of Pharmacology, Yale University School of Medicine, 333 Cedar St., New Haven, CT 06520. E-mail: alan.sartorelli{at}yale.edu
References
Belcourt MF, Hodnick WF, Rockwell S, and Sartorelli AC (1996a) Bioactivation of mitomycin antibiotics by aerobic and hypoxic Chinese hamster ovary cells overexpressing DT-diaphorase. Biochem Pharmacol 51: 16691678.[CrossRef][Medline]
Belcourt MF, Hodnick WF, Rockwell S, and Sartorelli AC (1996b) Differential toxicity of mitomycin C and porfiromycin to aerobic and hypoxic Chinese hamster ovary cells overexpressing human NADPH:cytochrome c (P-450) reductase. Proc Natl Acad Sci USA 93: 456460.
Belcourt MF, Hodnick WF, Rockwell S, and Sartorelli AC (1998a) Exploring the mechanistic aspects of mitomycin antibiotic bioactivation in Chinese hamster ovary cells overexpressing NADPH:cytochrome C (P-450) reductase and DT-diaphorase. Adv Enzyme Regul 38: 111133.[CrossRef][Medline]
Belcourt MF, Hodnick WF, Rockwell S, and Sartorelli AC (1998b) The intracellular location of NADH:cytochrome b5 reductase modulates the cytotoxicity of the mitomycins to Chinese hamster ovary cells. J Biol Chem 273: 88758881.
Butler J, Hoey BM, and Swallow AJ (1985) Reactions of the semiquinone free radicals of anti-tumour agents with oxygen and iron complexes. FEBS Lett 182: 9598.[CrossRef][Medline]
Cera C, Egbertson M, Teng SP, Crothers DM, and Danishefsky SJ (1989) DNA cross-linking by intermediates in the mitomycin activation cascade. Biochemistry 28: 56655669.[CrossRef][Medline]
Egbertson M and Danishefsky SJ (1987) Modeling of the electrophilic activation of mitomycins: chemical evidence for the intermediacy of a mitosene semiquinone as the active electrophile. J Med Chem Soc 109: 22042205.
Ernster L (1967) DT-diaphorase. Methods Enzymol 10: 309317.
Haffty BG, Son YH, Papac R, Sasaki CT, Weissberg JB, Fischer D, Rockwell S, Sartorelli AC, and Fischer JJ (1997) Chemotherapy as an adjunct to radiation in the treatment of squamous cell carcinoma of the head and neck: results of the Yale Mitomycin Randomized Trials. J Clin Oncol 15: 268276.
Halliwell B and Gutteridge JMC (1989) The chemistry of oxygen radicals and other oxygen-derived species, in Free Radicals in Biology and Medicine pp 2385, Clarendon Press, Oxford, UK.
Hodnick WF and Sartorelli AC (1993) Reductive activation of mitomycin C by NADH:cytochrome b5 reductase. Cancer Res 53: 49074912.
Hoey BM, Butler J, and Swallow AJ (1988) Reductive activation of mitomycin C. Biochemistry 27: 26082614.[CrossRef][Medline]
Holtz KM, Rockwell S, Tomasz M, and Sartorelli AC (2003) Nuclear overexpression of NADH:cytochrome b5 reductase activity increases the cytotoxicity of mitomycin C (MC) and the total number of MC-DNA adducts in Chinese hamster ovary cells. J Biol Chem 278: 50295034.
Hughes CS, Irvin CG, and Rockwell S (1991) Effect of deficiencies in DNA repair on the toxicity of mitomycin C and porfiromycin to CHO cells under aerobic and hypoxic conditions. Cancer Commun 3: 2935.[Medline]
Kalderon D, Roberts BL, Richardson WD, and Smith AE (1984) A short amino acid sequence able to specify nuclear location. Cell 39: 499509.[CrossRef][Medline]
Kalyanaraman B, Perez-Reyes E, and Mason RP (1980) Spin-trapping and direct electron spin resonance investigations of the redox metabolism of quinone anticancer drugs. Biochim Biophys Acta 630: 119130.[Medline]
Keyes SR, Loomis R, DiGiovanna MP, Pritsos CA, Rockwell S, and Sartorelli AC (1991) Cytotoxicity and DNA crosslinks produced by mitomycin analogs in aerobic and hypoxic EMT6 cells. Cancer Commun 3: 351356.[Medline]
Suresh Kumar G, Lipman R, Cummings J, and Tomasz M (1997) Mitomycin C-DNA adducts generated by DT-diaphorase. Revised mechanism of the enzymatic reductive activation of mitomycin C. Biochemistry 36: 1412814136.[CrossRef][Medline]
Machtalere G, Houee-Levin C, Gardes-Albert M, Ferradini C, and Hickel B (1988) Pulse radiolysis study of the reduction mechanism of an antitumor antibiotic, mitomycin C. Cr Acad Sci II 307: 1722.
McHugh KM and Lessard JL (1988) The nucleotide sequence of a rat vascular smooth muscle alpha-actin cDNA. Nucleic Acids Res 16: 4167.
Montecucco A, Savini E, Weighardt F, Rossi R, Ciarrocchi G, Villa A, and Biamonti G (1995) The N-terminal domain of human DNA ligase I contains the nuclear localization signal and directs the enzyme to sites of DNA replication. EMBO (Eur Mol Biol Organ) J 14: 53795386.[Medline]
Palom Y, Belcourt MF, Suresh Kumar GS, Arai H, Kasai M, Sartorelli AC, Rockwell S, and Tomasz M (1998) Formation of a major DNA adduct of the mitomycin metabolite 2,7-diaminomitosene in EMT6 mouse mammary tumor cells treated with mitomycin C. Oncol Res 10: 509521.[Medline]
Penketh PG, Hodnick WF, Belcourt MF, Shyam K, Sherman DH, and Sartorelli AC (2001) Inhibition of DNA cross-linking by mitomycin C by peroxidase-mediated oxidation of mitomycin C hydroquinone. J Biol Chem 276: 3444534452.
Pietrini G, Aggujaro D, Carrera P, Malyszko J, Vitale A, and Borgese N (1992) A single mRNA, transcribed from an alternative, erythroid-specific, promoter, codes for two non-myristylated forms of NADH-cytochrome b5 reductase. J Cell Biol 117: 975986.
Roberts KB, Urdaneta N, Vera R, Vera A, Gutierrez E, Aguilar Y, Ott S, Medina I, Sempere P, Rockwell S, et al. (2000) Interim results of a randomized trial of mitomycin C as an adjunct to radical radiotherapy in the treatment of locally advanced squamous-cell carcinoma of the cervix. Int J Cancer 90: 206223.[CrossRef][Medline]
Rockwell S (1977) In vivo-in vitro tumor systems: new models for studying the response of tumors to therapy. Lab Anim Sci 27: 831851.[Medline]
Rockwell S and Knisely JPS (1997) Hypoxia and angiogenesis in experimental tumor models: therapeutic implications, in Regulation of Angiogenesis (Goldberg ID and Rosen EM eds) pp 33560, Birkhaus Verlog, Basel, Switzerland.
Rockwell S and Sartorelli AC (1990) Mitomycin C and radiation, in Antitumor Drug-Radiation Interactions (Hill BT and Bellamy AS eds) pp 12839, CRC Press, Boca Raton, FL.
Ross D, Beall H, Traver RD, Siegel D, Phillips RM, and Gibson NW (1994) Bioactivation of quinones by DT-diaphorase, molecular, biochemical and chemical studies. Oncol Res 6: 493500.[Medline]
Sambrook J, Fritsch EF, and Maniatis T (1989) in Molecular Cloning: A Laboratory Manual, pp 16.3216.36, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
Sartorelli AC (1988) Therapeutic attack of hypoxic cells of solid tumors: presidential address. Cancer Res 48: 775778.
Sartorelli AC, Hodnick WF, Belcourt MF, Tomasz M, Haffty B, Fischer JJ, and Rockwell S (1994) Mitomycin C: a prototype bioreductive agent. Oncol Res 6: 501508.[Medline]
Sartorelli AC, Tomasz M, and Rockwell S (1993) Studies on the mechanism of the cytotoxic action of the mitomycin antibiotics in hypoxic and oxygenated EMT6 cells. Adv Enzyme Regul 33: 317.[CrossRef][Medline]
Seow HA, Penketh PG, Baumann RP, and Sartorelli AC (2004a) Bioactivation and resistance to mitomycin C. Methods Enzymol 382: 221233.[Medline]
Seow HA, Penketh PG, Belcourt MF, Tomasz M, Rockwell S, and Sartorelli AC (2004b) Nuclear overexpression of NAD(P)H:quinone oxidoreductase (NQO1) in Chinese hamster ovary cells increases the cytotoxicity of mitomycin C under aerobic and hypoxic conditions. J Biol Chem 279: 3160631612.
Smith PK, Krohn RI, Hermanson GT, Mallia AK, Gartner FH, Provenzano MD, Fujimoto EK, Goeke NM, Olson BJ, and Klenk DC (1985) Measurement of protein using bicinchoninic acid. Anal Biochem 150: 7685.[CrossRef][Medline]
Szybalski W and Iyer V (1964) Crosslinking of DNA by enzymatically or chemically activated mitomycins and porfiromycins, bifunctionally "alkylating" antibiotics. Fed Proc 23: 946957.[Medline]
Tomasz M (1995) Mitomycin C: small fast and deadly (but very selective). Chem Biol 2: 575579.[CrossRef][Medline]
Vancurova I, Jochova J, Lou W, and Paine PL (1994) An NLS is sufficient to engage facilitated translocation by the nuclear pore complex and subsequent intranuclear binding. Biochem Biophys Res Commun 205: 529536.[CrossRef][Medline]
Yamano S, Aoyama T, McBride OW, Hardwick JP, Gelboin HV, and Gonzalez FJ (1989) Human NADPH-P450 oxidoreductase: complementary DNA cloning, sequence and vaccinia virus-mediated expression and localization of the CYPOR gene to chromosome 7. Mol Pharmacol 36: 8388.[Abstract]
Yasukochi Y and Masters BS (1976) Some properties of a detergent-solubilized NADPH-cytochrome c(cytochrome P-450) reductase purified by biospecific affinity chromatography. J Biol Chem 251: 53375344.
Yubisui T and Takeshita M (1982) Purification and properties of soluble NADH-cytochrome b5 reductase of rabbit erythrocytes. J Biochem 91: 14671477.
This article has been cited by other articles:
![]() |
S.-L. Wang, J.-F. Han, X.-Y. He, X.-R. Wang, and J.-Y. Hong Genetic Variation of Human Cytochrome P450 Reductase as a Potential Biomarker for Mitomycin C-Induced Cytotoxicity Drug Metab. Dispos., January 1, 2007; 35(1): 176 - 179. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||