|
|
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Department of Pharmacology, Johannes Gutenberg University, Mainz, Germany (M.F., K.L., A.P., T.H., U.F., H.K.); and Centro de Investigaciones Biológicas, Consejo Superior de Investigaciones Científicas, Madrid, Spain (F.R.-P.)
Received October 28, 2004; accepted March 18, 2005
| Abstract |
|---|
|
|
|---|
protein resulted in a reduction of human iNOS mRNA and protein expression, whereas human iNOS promoter activity was not affected. An important RNA binding protein regulated by the p38 MAPK pathway and involved in the regulation of the stability of several mRNAs is tristetraprolin. RNase protection, quantitative real-time polymerase chain reaction, and Western blot experiments showed that cytokines used to induce iNOS expression in DLD-1 cells also enhanced tristetraprolin expression. SB203580 incubation reduced cytokine-mediated enhancement of tristetraprolin expression. Overexpression or down-regulation of tristetraprolin in stably transfected DLD-1- or A549/8 cells consistently resulted in enhanced or reduced iNOS expression by modulating iNOS-mRNA stability. In UV cross-linking experiments, recombinant tristetraprolin did not interact with the human iNOS mRNA. However, coimmunoprecipitation experiments showed interaction of tristetraprolin with the KH-type splicing regulatory protein (KSRP), which is known to recruit mRNAs containing AU-rich elements to the exosome for degradation. This tristetraprolin-KSRP interaction was enhanced by cytokines and reduced by SB203580 treatment. We conclude that tristetraprolin positively regulates human iNOS expression by enhancing the stability of human iNOS mRNA. Because tristetraprolin does not directly bind to the human iNOS mRNA but interacts with KSRP, tristetraprolin is likely to stabilize iNOS mRNA by capturing the KSRP-exosome complex.
A number of ARE binding proteins have been identified that can interact with AU- and U-rich regions. These include AUF-1 (Zhang et al., 1993
), the ELAV protein family members [the most important is HuR, (Brennan and Steitz, 2001
)], the KH-type splicing regulatory protein [KSRP (Chen et al., 2001
)], and tristetraprolin (Carballo et al., 1998
).
HuR is known to stabilize several inducible ARE-containing mRNAs (Brennan and Steitz, 2001
). Gel retardation experiments showed high-affinity interaction of HuR with the human iNOS 3'-UTR (Rodriguez-Pascual et al., 2000
). Therefore, enhancing or reducing HuR expression in human DLD-1 cells resulted in up- or down-regulation, respectively, of cytokine-induced iNOS expression (Rodriguez-Pascual et al., 2000
).
In contrast to HuR, tristetraprolin, a zinc finger protein, has been shown to destabilize the mRNAs of several immediate-early genes, such as c-fos, interleukin (IL) 3, interferon (IFN)
, tumor necrosis factor (TNF)
, and granulocyte/macrophage colony stimulating factor (Blackshear, 2002
). Tristetraprolin/ mice develop a severe inflammatory phenotype because of an increased expression of pro-inflammatory cytokines such as TNF-
and granulocyte/macrophage colony stimulating factor. This enhanced cytokine expression is a consequence of the loss of the negative regulation at the post-transcriptional level (Carballo et al., 1998
).
In line with these data, Chen et al. (2001
) showed tristetraprolin-dependent ARE-mRNA degradation activity of the human exosome (a complex of exonucleases that catalyzes the 3'
5' decay pathway of mRNAs. By interaction with different ARE-binding proteins, such as KSRP and tristetraprolin, the exosome is recruited to these mRNAs to degrade them subsequently (Chen et al., 2001
).
Analyses of the mechanisms of stabilization of ARE-containing mRNAs revealed the critical involvement of the p38 mitogen-activated protein kinase (p38 MAPK) (Kracht and Saklatvala, 2002
). Pharmacological inhibition of p38 MAPK
and -
(by SB203580) or inhibition of these enzymes by overexpression of dominant-negative isoforms resulted in enhanced degradation of different ARE-containing mRNAs, such as the cyclooxygenase-2 mRNA (Ridley et al., 1998
) and the TNF-
mRNA (Mahtani et al., 2001
). It is interesting that in rat primary mesangial cells, p38 MAPK
and
regulate iNOS expression in opposite directions (Lui et al., 2004
).
The exact pathway by which p38 MAPK stabilizes ARE-containing mRNAs is not known. p38 MAPK was found either directly or via the MAPK-activated protein kinase 2 (MAPKAPK-2/MK2) to control the expression and posttranslational modification of tristetraprolin (Carballo et al., 2001
; Tchen et al., 2004
), suggesting that, at least in part, the p38 MAPK-mediated stabilization of ARE-mRNAs may work by modulating tristetraprolin expression/activity.
In the current study, we first analyzed the effect of p38 MAPK inhibition on iNOS expression. Our experiments showed no influence of the p38 MAPK inhibitor SB203580 on cytokine-induced human iNOS promoter activity, but did show inhibition of cytokine-induced iNOS mRNA and protein expression. Overexpression of a dominant-negative isoform of murine p38 MAPK
also decreased cytokine-induced iNOS expression. To further elucidate the molecular mechanism of p38 MAPK-mediated iNOS mRNA regulation, we analyzed the involvement of tristetraprolin in this post-transcriptional regulation. The data show that the cytokines inducing human iNOS expression also enhanced tristetraprolin expression. In addition, SB203580 incubation reduced the cytokine-mediated enhancement of tristetraprolin expression. Overexpression of tristetraprolin resulted in a marked increase in iNOS expression, which was based on mRNA stabilization. UV cross-link experiments failed to show any interaction of tristetraprolin with the human iNOS mRNA. However, coimmunoprecipitation experiments showed cytokine-enhanced interactions of tristetraprolin with KSRP, which is known to be essential for the degradation of ARE-containing mRNAs by the exosome. Therefore, tristetraprolin seems to be involved indirectly in regulation of human iNOS expression by interaction with KSRP. By capturing the KSRP-exosome complex, tristetraprolin seems to dislodge this complex from the iNOS mRNA. This results in enhanced mRNA stability and thereby enhanced iNOS expression.
| Materials and Methods |
|---|
|
|
|---|
-D-thiogalactoside, polyvinylpyrrolidone, tRNA, bovine serum albumin, actinomycin D, protein A-agarose beads, monoclonal anti-
-tubulin and monoclonal anti-FLAG antibodies, and horseradish peroxidase-coupled anti-rabbit and anti-mouse IgG were purchased from Sigma (Deisenhofen, Germany). Monoclonal anti-iNOS antibodies were obtained from R&D systems, Wiesbaden, Germany. Isotopes were obtained from PerkinElmer Life and Analytical Sciences (Köln, Germany). Restriction enzymes, Taq polymerase, Klenow DNA polymerase, dNTPs, oligo-dT primer, Ficoll 400, pGEX-2T and glutathione-agarose affinity beads were purchased from Amersham Biosciences (Freiburg, Germany). The monoclonal anti-HA antibodies were obtained from New England Biolabs (Heidelberg, Germany). RNase A, RNase T1, DNase I, T3 and T7 RNA polymerase, FuGene and complete EDTA-free protease inhibitor cocktail tablets were obtained from Roche Diagnostics (Mannheim, Germany). The QuantiTect Probe RT-PCR Kit was from QIAGEN (Hilden, Germany). All oligonucleotides and dual-labeled probes were from MWG Biotech (Ebersberg, Germany). Human IFN-
, IL1-
, and TNF-
were obtained from Strathmann (Hannover, Germany). FCS, DMEM, and RPMI 1640 medium were purchased from PAN-Systems (Nürnberg, Germany). G-418 and SB203580 were purchased from Calbiochem (Bad Soden, Germany). Zeocin, pZeoSV2(), and pCDNA3 were purchased from Invitrogen (Groningen, The Netherlands). pCR-Script was from Stratagene (Heidelberg, Germany), and psiRNA-hH1-GF-Pzeo was obtained from InvivoGen (San Diego, CA). The Bradford reagent mix for determination of protein concentration was obtained from Bio-Rad (Munich, Germany). The dual-luciferase reporter assay system and passive lysis buffer were purchased from Promega (Heidelberg, Germany). The polyclonal anti-tristetraprolin antibody was a kind gift of Dr. William Rigby (Department of Medicine, Dartmouth Medical School, Lebanon, NH), the polyclonal anti-KSRP antibody was a kind gift of Dr. Ching-Yi Chen (Department of Biochemistry and Molecular Genetics, University of Alabama, Birmingham, AL), and the monoclonal anti-KSRP antibody was a kind gift of Dr. Douglas L. Black (Howard Hughes Medical Institute, UCLA, Los Angeles, CA).
Cell Culture, Cytokine Treatment, and RNA Isolation. Human alveolar epithelial A549/8 cells and human colon carcinoma DLD-1 cells were grown in DMEM with 2 mM L-glutamine, penicillin/streptomycin, and 5 or 10% heat-inactivated fetal bovine serum, respectively. Eighteen hours before cytokine activation, cells were washed with phosphate-buffered saline and incubated with DMEM containing 2 mM L-glutamine in the absence of serum and phenol red. iNOS expression in DLD-1 cells was induced with a cytokine mixture (CM) containing 100 U/ml IFN-
, 50 U/ml IL-1
, and 10 ng/ml TNF-
for the corresponding time periods depending on the experiment. In some experiments, cells were treated with SB203580 at various concentrations 1 h before and during cytokine incubation. Afterward, supernatant of the cells (300 µl) was used to measure NO2 by the Griess reaction or the Sievers Nitric Oxide Analyzer (ADInstruments, Spechbach, Germany), and cells were processed for RNA isolation by guanidinium thiocyanate/phenol/chloroform extraction as described previously (Rodriguez-Pascual et al., 2000
) or for protein extraction as described below.
RNase Protection Analyses. To obtain a human tristetraprolin cDNA fragment a PCR reaction with the primers hTTP-5P1 (5'-CCGGATCCCCCGGGCCACCCTCCTGTGC-3') and hTTP-3P1 (5'-GGAAGCTTGAGAAGGCAGAGGGTGACAG-3') was performed. The PCR fragments were digested with HindIII and BamHI and cloned into pCR-Script to generate pCR-hTTP. DNA sequences of the clones were determined using the dideoxy chain termination method with a sequencing kit from Pfizer.
To generate radiolabeled human iNOS,
-actin, luciferase, and tristetraprolin antisense probes for RNase protection assays, 0.5 µg of the linearized plasmids pCR-NOS II-human, pCR-
-actin-human, pXcm-GAPDH-human (Witteck et al., 2003
), pCR-luc-pGl2 (Rodriguez-Pascual et al., 2000
), and pCR-hTTP were in vitro-transcribed using T3 or T7 RNA polymerase and [
-32P]UTP. To quantify human iNOS, luciferase, and tristetraprolin mRNA levels, RNase protection experiments were performed as described previously (Rodriguez-Pascual et al., 2000
). In all experiments,
-actin- or GAPDH mRNA was also determined for normalization purposes. Densitometric analyses were performed using filmless autoradiographic analysis (Bio-Rad). The protected fragments of iNOS, luciferase, tristetraprolin,
-actin, and GAPDH were 386, 230, 174, 109, and 108 nucleotides, respectively.
Quantitative Reverse Transcription/Polymerase Chain Reaction (qRT-PCR). One-Step RT-PCR was performed with the QuantiTect RT PCR Kit (QIAGEN) in 25-µl reactions in a 96-well spectrofluorometric thermal cycler (iCycler; Bio-Rad). RNA was isolated as described above. For real-time qRT-PCR (RT reaction, 50°C for 30 min, 95°C for 15 min; PCR reaction, 94°C for 15 s, 60°C for 60 s, 40 cycles), the oligonucleotides listed below served as sense and antisense primers and Taqman hybridization probes. Taqman hybridization probes were double-labeled with 6-carboxyfluorescein as reporter fluorophore and 5-carboxytetramethylrhodamine as quencher. All primers and dual-labeled probes (5'-6-carboxyfluorescein, 3'-5-carboxytetramethylrhodamine) were from MWG-Biotech. Fluorescence was monitored at each 60°C step. iNOS: sense, TGCAGACACGTGCGTTACTCC; antisense, GGTAGCCAGCATAGCGGATG; hybridization probe, TGGCAAGCACGACTTCCGGGTG; GAPDH: sense CCCATGTTCGTCATGGGTGT; antisense, TGGTCATGAGTCCTTCCACGATA; hybridization probe, CTGCACCACCAACTGCTTAGCACCC; tristetraprolin: sense, TTCGCCCACTGCAACCTC; antisense, CGCCCACTCTCTGAGAAGGTC; hybridization probe, CCCCTCGCGCTACAAGACTGAGCTATG; luciferase: sense, AAAAAGTTGCGCGGAGGAG; antisense, TTTTTCTTGCGTCGAGTTTTCC; hybridization probe, TGTGTTTGTGGACGAAGTACCGAAAGGTCTTAC. Each experimental reaction was performed in triplicate. All primer/probes sets had efficiencies of 100% (±10%).
To calculate the relative expression of iNOS, luciferase, or tristetraprolin mRNA in DLD-1- or A549/8 cells, the 2(
C(T)) method (Livak and Schmittgen, 2001
) was used. According to this method, the C(T) values for iNOS, luciferase, or tristetraprolin mRNA expression in each sample were normalized to the C(T) values of GAPDH mRNA in the same sample. Then the values of untreated cell samples were set at 100%, and the percentage of iNOS, luciferase, or tristetraprolin expression was calculated.
Actinomycin D Experiments. To analyze the effects of experimental interventions on the iNOS mRNA stability, cells were incubated as indicated and iNOS expression was induced by cytokines for 6 h. Then, 10 µM actinomycin D was added and RNAs were prepared 0 to 18 h thereafter. Relative iNOS and GAPDH mRNA amounts were determined by qRT-PCR, and iNOS mRNA was normalized to GAPDH mRNA. The relative amount of iNOS mRNA at 0 h actinomycin was set 100%. Curve fittings of the resulting actinomycin D time curves were performed by nonlinear regression using Prism 3.0 (GraphPad Software, San Diego, CA).
Analysis of Human iNOS Promoter Activity in Stably and Transiently Transfected Cells. To investigate the effect of inhibition of the p38 MAPK on cytokine-induced iNOS promoter activity and iNOS mRNA expression, pools of stably transfected DLD-1 cells containing a 16-kb fragment of the human iNOS promoter (GenBank accession number AC005697 [GenBank] ) cloned in front of a luciferase reporter gene were incubated for 18 h with DMEM without FCS and without phenol red. Before cytokine activation, the cells were pretreated for 1 h with the p38 MAPK inhibitor SB203580 at the concentrations indicated. Then, cells were incubated with the cytokine mixture for the time periods indicated, and RNAs were isolated as described above. To analyze luciferase activity, the cells were lysed in 1x passive lysis buffer and luciferase activity was determined using the dual-luciferase reporter assay system.
DLD-1 cells were transiently transfected by lipofection with FuGene (Roche) according to the manufacturer's recommendations. 1.5 µg of the plasmid pNOS2(16)Luc (containing a 16-kb fragment of the human iNOS promoter) were combined with 0.5 µg of the Renilla reniformis reporter gene plasmid pRL-SV40 for normalization of transfection efficiency. After overnight incubation, cells were incubated for 5 h with or without CM. Then the cells were lyzed in 1x passive lysis buffer provided by the dual luciferase reporter assay system, and firefly and R. reniformis luciferase activities were determined in 40 and 20 µl of the extracts, respectively. The light units of the firefly luciferase were normalized by those of R. reniformis luciferase after subtraction of extract background.
Western Blot Experiments. To study the expression of iNOS protein, total cell protein was fractionated into nuclear and cytoplasmic extracts as described previously (Greenberg and Ziff, 1984
). For iNOS Western blots, 10 to 50 µg of cytoplasmic proteins were separated on 7.5% polyacrylamide gels and transferred to nitrocellulose membranes by semi-dry electroblotting. All further steps were performed as described previously (Rodriguez-Pascual et al., 2000
). For the detection of human iNOS, an anti-iNOS-antibody was used. Immune complexes were detected by using anti-mouse horseradish peroxidase-conjugated immunoglobulin. The immunoreactive proteins on the blots were visualized by the enhanced chemiluminescence detection system (Amersham Biosciences).
To study the expression of human tristetraprolin (endogenous or HA-tagged) and the transfected dominant-negative isoform of p38 MAPK
(FLAG-tagged) cytoplasmic extracts (1050 µg of protein) were separated on 10% SDS polyacrylamide gels and transferred to nitrocellulose membranes by semidry electroblotting. All further steps were performed as described previously (Rodriguez-Pascual et al., 2000
). For the detection of endogenous tristetraprolin, a polyclonal anti-tristetraprolin-antibody (Brooks et al., 2002
) was used. For detection of HA-tagged tristetraprolin and dominant-negative FLAG-tagged p38 MAPK
protein monoclonal anti-HA-antibodies (HA-TAG 262K; New England Biolabs) and anti-FLAG-antibodies (Anti-FLAG M2; Sigma) were used, respectively. For detection of KSRP a polyclonal anti-KSRP antibody (Gherzi et al., 2004
) or a monoclonal anti-KSRP antibody (Hall et al., 2004
) was used. Immune complexes were detected by using anti-mouse or anti-rabbit horseradish peroxidase-conjugated immunoglobulin. The immunoreactive proteins on the blots were visualized by the enhanced chemiluminescence detection system (Amersham Biosciences).
Immunoprecipitation. For immunoprecipitation, cell extracts were digested for 30 min at 30°C with RNase A (40 µg) and RNase T1 (100,000 U). Then, these extracts were preincubated with protein A-agarose beads (Sigma) in RIPA buffer [50 mM Tris-HCl, pH 7.4, 150 mM NaCl, 50 mM NaF, 10 mM Na3VO4, 10 mM sodium pyrophosphate, 50 mM disodium glycerol phosphate, 10 nM okadaic acid, 2 mM EDTA, 10% glycerol, 1% Nonidet P-40, and 1/50 (v/v) complete EDTA-free protease inhibitor cocktail] for 1 h at 4°C. These precleared extracts were incubated with polyclonal or monoclonal antibodies or a rabbit preimmune serum (negative control) overnight at 4°C in RIPA buffer. Thereafter, protein-antibody complexes were captured by incubating with protein A-agarose beads for 5 h at 4°C in RIPA buffer. Beads were washed three times with RIPA buffer, and coimmunoprecipitated proteins were analyzed by Western Blotting.
Purification of GST-TTP Protein. To generate pGEX-HA-hTTP, a bacterial expression plasmid coding for a GST-HA-tristetraprolin fusion protein (GST-TTP), the plasmid pCMV-hTTP-Flag (Lai et al., 1999
), kindly provided by Dr. Blackshear) was digested with HindIII. The fragment was purified by gel electrophoresis and cloned into pCR-Script (Stratagene) to generate pCR-HA-hTTP. Then pCR-HA-hTTP was digested with ClaI and EcoRV, and the ends were blunted by treatment with the Klenow enzyme. The fragment was purified by gel electrophoresis and cloned into pGEX-2T (Amersham Biosciences) digested with SmaI. DNA sequences of the clones were determined using the dideoxy chain termination method with a sequencing kit from Pfizer. Purified GST-TTP fusion protein was prepared using the plasmid pGEX-HA-hTTP as described previously (Rodriguez-Pascual et al., 2000
). The yield of the purification procedure was determined by comparison to a bovine serum albumin standard on Coomassie blue-stained SDS-PAGE. The electrophoresis revealed a 63-kDa band corresponding to the fusion protein. The same procedure was used to purify GST protein from Escherichia coli cultures transformed with the plasmid pGEX-2T.
UV Cross-Linking Experiments. cDNAs encoding for subfragments of human iNOS 3'-UTR have been described previously (Rodriguez-Pascual et al., 2000
). To obtain the 5'-UTR and coding sequence (cds) of the human iNOS mRNA and the 3'-UTR of the human c-fos mRNA, PCR reactions were performed using the primers N25UTR-5P1 (5'-CCAAGCTTATAACTTT-GTAGCGAGTCG-3') and N25UTR-3P1 (5'-CCAAGCTTCTCTATGGCTTTACAAAGC-3'), N2-cds-5P1 (5'-CCAGATCTCGAGATG-GCCTGTCCTTG-3') or N2-cds3-P1 (5'-CCGCGGCCGCTCAGAGCGCTGACATCTCCA-3'), and hum-fos-AUFL-5P1 (5'-CATGCATTGTTGAGGTGGTC-3') and hum-fos-AUFL-3P1 (5'-CTTGGAACAATAAGCAAACAATG-3'), respectively. The PCR fragments were restricted with HindIII or XhoI and NotI, or treated with T4 polynucleotide kinase, and cloned in pCR-Script to generate pCR-iNOS-5'-UTR, pCR-iNOS-cds, and pCR-hum-fos-AUFL. To generate radiolabeled iNOS 5'-UTR, cds or 3'-UTR, or human c-fos AUFL sense probes for RNA binding experiments, 0.5 to 1 µg of DNA (linearized plasmids or PCR fragments) were in vitro-transcribed as described above. Radiolabeled transcripts were analyzed by urea-denaturing electrophoresis to estimate the yield and the specific activity. Incorporated radioactivity in transcripts was usually higher than 80%, and the specific activity ranged from 0.2 to 0.5 µCi/pmol.
For UV cross-linking experiments, radiolabeled iNOS-5'-UTR-, -cds-, or -3'-UTR RNA and human c-fos3'-UTR RNA were incubated with 0.6 µg of purified GST fusion protein in a volume of 25 µl in binding buffer (10 mM HEPES, pH 7.6, 3 mM MgCl2, 5 mM EDTA, 2 mM dithiothreitol, 5% glycerol, 0.5% Nonidet P-40, 3 mg/ml heparin, and 0.5 mg/ml yeast tRNA) supplemented with 40 mM KCl and RNasin (0.3 U/ml, final) for 20 min at 37°C. Then the probes were irradiated with UV-C light (125 mJ) for 30 min on ice. RNA not protected by protein binding was digested by addition of RNases T1 (20 U/assay) and RNase A (20 µg/assay) for 30 min at 30°C. The reaction was stopped by addition of 6 µl of 5x Laemmli loading buffer (312.5 mM Tris-HCl, pH 6.8, 5 mM EDTA, 15% SDS, 50% glycerin, 0.015% bromphenol blue, and 40 mM dithiothreitol). After denaturation at 80°C for 10 min the samples were separated in 12% SDS polyacrylamide gels, the gels were dried and exposed to X-ray films.
Establishment of Cell Lines Expressing a Sense or Antisense Tristetraprolin mRNA, a Dominant-Negative P38 MAPK
, or a Vector-Derived Small Interfering RNA for Down-Regulation of Tristetraprolin Expression. The plasmid pZeo-hTTP-HA-sense or -antisense was generated by cloning a 1000-base pair HindIII fragment from pCMV-hTTP-flag (Lai et al., 1999
) containing the cDNA sequence of a HA-tagged tristetraprolin protein in both orientations into pZeoSV2() (Invitrogen). DNA sequences of the clones were determined using the dideoxy chain termination method with a sequencing kit from Pfizer. To generate DLD-1 cells overexpressing a sense or antisense HA-tagged tristetraprolin mRNA, cells were transfected with 5 µg of pZeo-hTTP-HA-sense or -antisense by lipofection with FuGene according to the manufacturer's recommendations. Stable transfectants were selected with Zeocin (200 µg/ml). As a control, DLD-1 cells stably transfected with the pZeoSV2() vector were generated as well. Pooled population of cells and single clones were characterized for the expression of sense tristetraprolin-HA mRNA by Western blotting using a monoclonal anti-HA-antibody and by PCR analyses. To test for antisense tristetraprolin-HA RNA expression, RNase protection experiments using a radiolabeled sense tristetraprolin-HA probe were performed.
To generate DLD-1 cells overexpressing a dominant-negative murine FLAG-tagged p38 MAPK
, cells were transfected with 4.5 µgof pCDNA3 (Invitrogen) and 0.5 µg of pCS3-FLAG-p38AGF (Winzen et al., 1999
) by lipofection with FuGene according to the manufacturer's recommendations. Stable transfectants were selected with G418 (1 mg/ml). As a control, DLD-1 cells stably transfected with the pCDNA3 vector were generated as well (pCDNA3). Pooled populations of cells were characterized for p38AGF-FLAG expression by Western blots using a monoclonal anti-FLAG-antibody and by RT-PCR analyses.
The plasmid psiRNA-hH1-GFPzeo-TTP was generated by cloning a double-stranded oligonucleotide (5'-ACCTCACAAGACTGAGCTATGTCGGATCAAGAGTCCGACATAGC-TCAGTCTTGTTTTTTG-3'; sequence of the small interfering RNA (siRNA) repeats directed against the human tristetraprolin mRNA are underlined) into the Bbs I sites of psiRNA-hH1-GFPzeo (Invivogen). The DNA sequence of the construct was determined using the dideoxy chain termination method with a sequencing kit from Pfizer. To generate A549/8 cells stably expressing shRNAs directed against the human tristetraprolin mRNA, cells were transfected with 5 µg of psiRNA-hH1-GFPzeo-TTP by lipofection with FuGene according to the manufacturer's recommendations. Stable transfectants were selected with Zeocin (200 µg/ml). Because the psiRNA-hH1-GFPzeo vector codes for a GFP-Zeocin resistance fusion protein, the Zeocin-resistant cell pools were also selected for GFP expression by fluorescence-activated cell sorting. As a control, A549/8 cells stably transfected with the empty psiRNA-hH1-GFPzeo vector were generated as well.
Statistics. Data represent means ± S.E.M. Statistical differences were determined by factorial analysis of variance followed by Fisher's protected least-significant-difference test for comparison of multiple means.
| Results |
|---|
|
|
|---|
Markedly Reduces iNOS mRNA and Protein Expression but Has No Effect on Human iNOS Promoter Activity. To test the effect of SB203580-mediated inhibition of p38 MAPK on human iNOS promoter activity and iNOS mRNA expression, we used DLD-1 cells stably transfected with pNOS2(16)Luc, a construct containing a 16-kb human iNOS promoter fragment (GenBank accession no. AC00569; Kleinert et al., 2004
, 10 ng/ml TNF-
, and 50 U/ml IL-1
). After 2 to 48 h, cells were lysed and RNA was purified. To analyze the iNOS and luciferase mRNA expression, quantitative RNase protection experiments were performed using antisense probes for human iNOS and luciferase mRNA. For normalization, expression of
-actin mRNA was determined in the same reaction. qRT-PCR experiments were performed as well using the primer/probes described under Materials and Methods. For normalization in qRT-PCR experiments, the expression of GAPDH mRNA was determined in a parallel reaction using the same RNA sample. As shown in Fig. 1, no iNOS mRNA (A and C) or protein (D) expression was detected in unstimulated DLD-1 cells. However, in accordance with previous results (Rodriguez-Pascual et al., 2000
5 fold (Fig. 1, B and C). CM-incubation also resulted in nearly 5-fold enhancement of luciferase activity in extracts of these cells (data not shown). Inhibition of p38 MAPK by SB203580 resulted in marked reduction of the human iNOS mRNA (Fig. 1, A and C), protein expression (Fig. 1D), and iNOS-mediated NO production (Fig. 1E). In contrast, SB203580 influenced neither basal nor cytokine-induced luciferase mRNA expression (Fig. 1, B and C).
|
There are four different isoforms of p38 MAPK (see Introduction), but only two (p38 MAPK
and -
) are inhibited by SB203580. Because SB203580 inhibited CM-induced iNOS expression in DLD-1 cells and Lui et al. (2004
) described opposite effects of p38 MAPK
(stabilizing) and -
(destabilizing) on iNOS expression in rat mesangial cells, we also tested the effect of inhibition of p38 MAPK
by overexpression of a dominant-negative p38 MAPK
isoform. We stably transfected DLD-1 cells with pCS3-FLAG-p38AGF (Winzen et al., 1999
), leading to overexpression of a dominant-negative murine p38 MAPK
protein in these cells. As shown in Fig. 1F, stable overexpression of this dominant-negative p38 MAPK
protein resulted in marked inhibition of cytokine-induced iNOS expression in human DLD-1 cells.
Therefore, these data indicate that human iNOS expression depends both on transcriptional and post-transcriptional mechanisms. Furthermore, activation of the p38 MAPK pathway seems to be critically involved in the post-transcriptional regulation of human iNOS expression.
Cytokines Enhance Expression of Tristetraprolin and iNOS in Human DLD-1 Cells. Tristetraprolin has been described as a destabilizing protein for ARE-containing mRNAs (Blackshear, 2002
). Recent evidence also suggests that tristetraprolin is involved in the regulation of mRNA stability of ARE containing mRNAs in response to p38 MAPK (Mahtani et al., 2001
; Stoecklin et al., 2004
). Therefore, we analyzed the role of tristetraprolin in human iNOS expression. First, we tested the effect of cytokine incubation on tristetraprolin expression in DLD-1 cells. As shown in Fig. 2, cytokine-incubation of DLD-1 cells resulted in enhanced tristetraprolin mRNA (Fig. 2, A and B) and protein expression (Fig. 2C). It is interesting that the time curve of the enhancement of tristetraprolin expression paralleled the time curve of iNOS induction (Rodriguez-Pascual et al., 2000
).
|
|
|
To support this unexpected result of tristetraprolin-mediated enhancement of iNOS expression, we aimed to down-regulate tristetraprolin expression in a different cell line using siRNAs. Therefore, we generated A549/8 cells stably transfected with psiRNA-hH1-GFPzeo-TTP. In these cells siRNAs containing a hairpin structure (shRNAs) were generated, which were directed against the human tristetraprolin mRNA. As shown in Fig. 5, A and B, tristetraprolin expression was reduced in A549/8-psiRNA-hH1-GFPzeo-TTP cells (siTTP) on RNA and protein level compared with A549/8 cell stably transfected with the empty vector psiRNA-hH1-GFPzeo (GFP). As shown above for the DLD-1-pZeo-hTTPas cells, siRNA-mediated down-regulation of tristetraprolin expression resulted in a marked reduction of cytokine-induced iNOS mRNA expression also in A549/8 cells (Fig. 5C). Therefore, tristetraprolin seems to be positively involved in the regulation of cytokine-induced iNOS expression.
|
|
Several RNA-binding proteins have been described to bind to DNA and regulate promoter activity, too (He et al., 2000
; Fiset and Chabot, 2001
; Katahira et al., 2001
; Donev et al., 2002
). Therefore, we analyzed whether enhancement or reduction of tristetraprolin expression changes human iNOS promoter activity. We transiently transfected pNOS2(16)Luc and pRL-SV40 (a construct containing R. reniformis luciferase, for normalization of transfection efficiency) into DLD-1-pZeo, DLD-1-pZeo-hTTPs, and DLD-1-pZeo-hTTPas cells. After transfection, the cells were incubated in the presence or absence of the cytokine mixture/ and firefly and R. reniformis luciferase activity were analyzed in extracts of these cells. As shown in Fig. 6B, cytokine incubation resulted in similar enhancement (approximately 3-fold) of iNOS promoter activity in all three cell lines. Therefore, the effect of tristetraprolin on iNOS expression is unlikely to involve regulation of human iNOS promoter activity. In summary, the enhancing effect of tristetraprolin overexpression on human iNOS mRNA expression results from enhanced mRNA stability.
Tristetraprolin Does Not Interact with the Human iNOS mRNA. To analyze the interaction of tristetraprolin with the human iNOS mRNA 3'-UTR, we purified recombinant GST-TTP protein for UV cross-linking experiments. Purified GST-TTP and GST protein (as negative control) was incubated with labeled transcripts comprising the human iNOS 3'-UTR sequence, and tristetraprolin/RNA complex formation was assayed by UV cross-linking. As shown in Fig. 7A, we detected no complex formation between recombinant GST-TTP-protein and the whole 3'-UTR transcript. In contrast, as shown before by RNA gel shift experiments (Rodriguez-Pascual et al., 2000
), GST-HuR specifically binds to the human iNOS 3'-UTR sequence. Then, we analyzed the interaction of GST-TTP with the human iNOS 5'-UTR and the human iNOS coding sequence. GST-TTP did not interact with one of these iNOS mRNA fragments (Fig. 7B). However, using a human c-fos 3'-UTR RNA, a known target for tristetraprolin binding, instead of human iNOS mRNA fragments, resulted in a specific tristetraprolin/RNA complex formation (Fig. 7C). These experiments demonstrated that tristetraprolin does not bind to any region of the human iNOS mRNA.
|
|
| Discussion |
|---|
|
|
|---|
The best-characterized cis-acting sequences responsible for mRNA decay in mammalian cells are the AU-rich elements (AREs) present within the 3'-untranslated regions (3'-UTRs) of short-lived mRNAs from cytokine, proto-oncogene and growth-factor genes, whose expression has to be regulated exactly (Bakheet et al., 2001
). These AREs are involved in deadenylation and subsequent degradation of mRNAs (Shyu et al., 1991
) and have also been described to stimulate 5'-decapping (Gao et al., 2001
). More than 15 proteins are known to bind to AREs (Hollams et al., 2002
). Only few of them have been shown clearly to regulate mRNA stability. These include the AU-rich element RNA-binding protein 1 (AUF1) (Zhang et al., 1993
), the embryonic lethal abnormal vision (ELAV) proteins (also named Hu proteins), especially HuR (Brennan and Steitz, 2001
), KSRP (Chen et al., 2001
), and the tristetraprolin family of zinc-finger RNA binding proteins (Lai et al., 1999
).
One important signal transduction pathway involved in the regulation of ARE-mRNA degradation is the p38 MAPK pathway (Kracht and Saklatvala, 2002
). Inhibition of p38 MAPK by either pharmacological inhibitors or overexpression of dominant-negative p38 MAPK isoforms results in enhanced degradation of different ARE-containing mRNAs, such as the cyclooxygenase-2 mRNA (Ridley et al., 1998
), the IL-1
mRNA (Kracht and Saklatvala, 2002
), the TNF-
mRNA (Mahtani et al., 2001
), and the iNOS mRNA (Lui et al., 2004
).
To analyze the effect of inhibition of p38 MAPK on the human iNOS promoter activity and iNOS mRNA and protein expression in parallel, we used DLD-1 cells stably transfected with pNOS2(16)Luc [containing a 16-kb fragment of the human iNOS promoter (GenBank accession no. AC005697
[GenBank]
)]. RNase protection experiments and quantitative real time RT-PCR (Fig. 1, AC and E), Western blots (Fig. 1D), nitrite measurements (Fig. 1E), and luciferase activity determination (data not shown) revealed that inhibition of p38 MAPK by SB203580 or a dominant-negative p38 MAPK
isoform reduced iNOS mRNA and protein expression but not luciferase mRNA or protein expression. This effect of p38 MAPK inhibition on iNOS expression has been shown in human osteoarthritic chondrocytes (Poljakovic et al., 2003
) and human kidney epithelial cells (Martel-Pelletier et al., 1999
). In transient transfection experiments using fragments of the human or rat iNOS promoter, reduction of lipopolysaccharide and/or cytokine-induced promoter activity by SB203580-mediated inhibition of the p38 MAPK pathway has been described previously (Kristof et al., 2001
; Bhat et al., 2002
). However, in our experiments, the activity of the stably transfected human 16 kb iNOS promoter was not effected by p38 MAPK inhibition. Therefore, in DLD-1 cells, p38 MAPK seems to regulate human iNOS expression at the post-transcriptional level.
The exact mechanism of p38 MAPK-mediated stabilization of ARE-containing mRNAs is not known. p38 MAPK was found to control the expression and post-translational modification of tristetraprolin either directly (Carballo et al., 2001
) or via its substrate MAPKAPK-2/MK2 (Tchen et al., 2004
), suggesting that the p38 MAPK-mediated stabilization of ARE-mRNAs may work, at least in part, by modulating tristetraprolin expression/activity.
In an attempt to further characterize the involvement of tristetraprolin in human iNOS expression, we analyzed the effect of cytokine-incubation on expression of tristetraprolin in DLD-1 cells. As shown in Fig. 2, CM incubation enhanced tristetraprolin mRNA (Fig. 2, A and B) and protein (Fig. 2C) expression. The time curve of tristetraprolin induction was similar to the time curve of human iNOS induction in these cells (Rodriguez-Pascual et al., 2000
). Because cytokine-induced expression of iNOS is reduced by SB203580-treatment, we then analyzed whether this treatment also influences tristetraprolin expression. As shown in Fig. 3, preincubation with 10 µM SB203580 decreased tristetraprolin expression. A similar effect of p38 MAPK inhibition had been described in murine RAW macrophages (Tchen et al., 2004
).
Because tristetraprolin seemed to be a good candidate for an ARE-binding protein modulating human iNOS expression, we stably transfected human DLD-1 cells with an eukaryotic expression vector coding for a HA-tagged tristetraprolin protein. To down-regulate endogenous tristetraprolin expression, cells containing the tristetraprolin-HA cDNA in an opposite orientation were generated as well. Pools of clones were analyzed for cytokine-induced iNOS expression. As shown in Fig. 4, overexpression of HA-tagged tristetraprolin protein (pZeo-hTTPs) unexpectedly resulted in enhanced cytokine-induced iNOS mRNA expression (Fig. 4, B and C) and NO production (Fig. 4F) compared with control cells stably transfected with the expression vector (pZeo). Therefore, transfection of the antisense construct (pZeo-hTTPas) resulted in reduced iNOS mRNA (Fig. 4, D and E) and NO production (Fig. 4F).
Because the stabilizing effect of tristetraprolin on iNOS expression in DLD-1 cells was highly unexpected, we decided to expand this analysis using another cell line and a different method to modulate tristetraprolin expression. We generated A549/8 cells (siTTP) stably transfected with a vector (psiRNA-hH1-GFPzeo-TTP) coding for siRNAs directed against the human tristetraprolin mRNA. As control, A549/8 cell pools transfected with the empty vector (GFP) were generated. By using the siRNA technique, we were able to down-regulate tristetraprolin mRNA and protein expression (Fig. 5, A and B) in A549/8 cells. As shown in DLD-1 cells and A549/8 cells, down-regulation of tristetraprolin expression resulted in reduction of cytokine-induced iNOS mRNA expression (see Fig. 5C). Therefore, in contrast to its described destabilizing activity (Blackshear, 2002
), tristetraprolin seems to be positively involved in cytokine-induced iNOS expression in human epithelial cells.
To analyze the effect of the modulation of tristetraprolin expression on human iNOS mRNA stability, actinomycin D experiments were performed with the three different stably transfected DLD-1 cell pools (pZeo, pZeo-hTTPs, and pZeo-hTTPas). These experiments (Fig. 6A) showed that tristetraprolin overexpression (pZeo-hTTPs cells) enhanced whereas tristetraprolin down-regulation (pZeo-hTTPas cells) decreased iNOS mRNA stability compared with cells transfected with the expression vector (pZeo cells). Therefore, tristetraprolin-mediated modulation of human iNOS expression is likely to result from post-transcriptional effects of tristetraprolin.
Some RNA-binding proteins, such as AUF1 or heteronuclear ribonucleoprotein A1, have been described to also display DNA-binding activity and to regulate the promoter activity of different genes (Fuentes-Panana et al., 2000
; Shen and Masters, 2001
). To exclude the possibility that the tristetraprolin-mediated effects on human iNOS expression also resulted from regulation of human iNOS promoter activity by tristetraprolin, we transiently transfected the plasmid pNOS2(16)Luc into the three different cell pools (pZeo, pZeo-hTTPs, and pZeo-hTTPas) and determined luciferase activity after cytokine-induction. As shown in Fig. 6B, modulation of tristetraprolin expression in DLD-1 cells did not result in changes of cytokine-induced human iNOS promoter activity.
The 3'-UTR of the human iNOS contains five AREs, two of which had been shown to interact with the mRNA stabilizing factor HuR (Rodriguez-Pascual et al., 2000
). Therefore, we analyzed the exact binding site of tristetraprolin in the human iNOS 3'-UTR sequences. We were surprised to find that, as shown in Fig. 7, A and B, UV cross-linking experiments indicated that recombinant GST-TTP protein did not interact with any region of the human iNOS mRNA (3'-UTR, 5'-UTR, cds). However, the same GST-TTP protein was able to bind to the c-fos-3'-UTR, a known target of tristetraprolin (Fig. 7C), and to the human TNF-
3'-UTR (data not shown). Therefore, tristetraprolin does not seem to interact with the human iNOS mRNA.
The results shown above indicate an indirect stimulatory effect of tristetraprolin on human iNOS expression. Lai et al. (2002
) also reported that tristetraprolin mutants without RNA binding activity enhanced the stability of ARE-containing mRNAs such as the TNF-
transcript. This unexpected effect of mutant tristetraprolin seems to be based on an interaction of these proteins with enzymes stimulating the degradation of ARE-containing mRNAs (Lai et al., 2002
). Supporting this hypothesis, Chen et al. (2001
) showed tristetraprolin- and KSRP-dependent ARE-mRNA degradation activity of the human exosome. The purified exosome, a complex of exonucleases catalyzing the 3'
5' decay pathway of mRNAs, was unable to bind to and degrade ARE-containing mRNAs. However, ARE-binding proteins such as KSRP and tristetraprolin recruited the exosome to these mRNAs and enabled degradation (Chen et al., 2001
; Gherzi et al., 2004
). Therefore, we analyzed the interaction of tristetraprolin with KSRP in human DLD-1 cells. As shown in Fig. 8, A and B, tristetraprolin displayed a protein-protein interaction with KSRP, which was enhanced by cytokine treatment. As shown in Fig. 8B, the cytokine enhancement of the tristetraprolin-KSRP interaction was reduced by SB203580-treatment.
KSRP markedly destabilized human iNOS mRNA and overexpression of KSRP down-regulated human iNOS expression (K. Linker, A. Pautz, M. Fechir, and H. Kleinert, submitted). Therefore, without binding of tristetraprolin to the human iNOS mRNA, the enhanced expression of tristetraprolin after cytokine treatment and the cytokine-enhanced interaction of tristetraprolin with KSRP seems to result in a dislodgement of the KSRP-exosome complex from the human iNOS mRNA. Thereby, enhanced tristetraprolin expression in cytokine-treated cells seems to stabilize iNOS mRNA and thus enhances iNOS expression. SB203580-mediated inhibition of the p38 MAPK pathway reduced the enhancement of tristetraprolin expression by cytokines and thereby destabilized iNOS mRNA.
In conclusion, our data support the following mechanism. Cytokines required for iNOS induction also enhance tristetraprolin expression, most likely by p38 MAPK activation. The elevated tristetraprolin protein in turn reduces the recruitment of exosomes to the human iNOS mRNA by enhanced interaction with KSRP. The reduced ability of the exosome to bind to and to degrade the human iNOS mRNA results in an enhanced iNOS mRNA stability. This leads to a higher iNOS protein expression and an increase of iNOS-dependent NO production.
| Acknowledgements |
|---|
| Footnotes |
|---|
M.F. and K.L. contributed equally to this work.
Article, publication date, and citation information can be found at http://molpharm.aspetjournals.org.
ABBREVIATIONS: iNOS, inducible nitric-oxide synthase; ARE, AU-rich element; UTR, untranslated region; KSRP, KH-type splicing regulatory protein; IL, interleukin; IFN, interferon; TNF, tumor necrosis factor; MAPK, mitogen-activated protein kinase; MAPKAPK-2/MK2, MAPK-activated protein kinase 2; SB203580, 4-(4-fluorophenyl)-2-(4-methylsulfinylphenyl)-5-(4-pyridyl)1H-imidazole; HA, hemagglutinin; RT, reverse transcription; PCR, polymerase chain reaction; qRT, quantitative real-time; FCS, fetal calf serum; DMEM, Dulbecco's modified Eagle's medium; CM, cytokine mixture; cds, coding sequence; C(T), cycle threshold; kb, kilobase(s); FCS, fetal calf serum; RIPA, radioimmunoprecipitation assay; TTP, tristetraprolin; GST, glutathione S-transferase; siRNA, small interfering RNA; shRNA, short hairpin RNA; SV40, simian virus 40; AUF1, AU-rich element RNA-binding protein 1.
Address correspondence to: Dr. Hartmut Kleinert, Department of Pharmacology, Johannes Gutenberg University, Obere Zahlbacher Str. 67, 55101 Mainz, Germany. E-mail: kleinert{at}mail.uni-mainz.de
| References |
|---|
|
|
|---|
Bevilacqua A, Ceriani MC, Capaccioli S, and Nicolin A (2003) Post-transcriptional regulation of gene expression by degradation of messenger RNAs. J Cell Physiol 195: 356372.[CrossRef][Medline]
Bhat NR, Feinstein DL, Shen Q, and Bhat AN (2002) p38 MAPK-mediated transcriptional activation of inducible nitric-oxide synthase in glial cells. J Biol Chem 277: 2958429592.
Blackshear PJ (2002) Tristetraprolin and other CCCH tandem zinc-finger proteins in the regulation of mRNA turnover. Biochem Soc Trans 30: 945952.[CrossRef][Medline]
Brennan CM and Steitz JA (2001) HuR and mRNA stability. Cell Mol Life Sci 58: 266277.[CrossRef][Medline]
Brooks SA, Connolly JE, Diegel RJ, Fava RA, and Rigby WF (2002) Analysis of the function, expression and subcellular distribution of human tristetraprolin. Arthritis Rheum 46: 13621370.[CrossRef][Medline]
Carballo E, Cao H, Lai WS, Kennington EA, Campbell D, and Blackshear PJ (2001) Decreased sensitivity of tristetraprolin-deficient cells to p38 inhibitors suggests the involvement of tristetraprolin in the p38 signaling pathway. J Biol Chem 276: 4258042587.
Carballo E, Lai WS, and Blackshear PJ (1998) Feedback inhibition of macrophage tumor necrosis factor-alpha production by tristetraprolin. Science (Wash DC) 281: 10011005.
Chen CY, Gherzi R, Ong SE, Chan EL, Raijmakers R, Pruijn GJ, Stoecklin G, Moroni C, Mann M, and Karin M (2001) AU binding proteins recruit the exosome to degrade ARE-containing mRNAs. Cell 107: 451464.[CrossRef][Medline]
Donev RM, Doneva TA, Bowen WR, and Sheer D (2002) HnRNP-A1 binds directly to double-stranded DNA in vitro within a 36 bp sequence. Mol Cell Biochem 233: 181185.[CrossRef][Medline]
Fiset S and Chabot B (2001) hnRNP A1 may interact simultaneously with telomeric DNA and the human telomerase RNA in vitro. Nucleic Acids Res 29: 22682275.
Fuentes-Panana EM, Peng R, Brewer G, Tan J, and Ling PD (2000) Regulation of the Epstein-Barr virus C promoter by AUF1 and the cyclic AMP/protein kinase A signaling pathway. J Virol 74: 81668175.
Gao M, Wilusz CJ, Peltz SW, and Wilusz J (2001) A novel mRNA-decapping activity in HeLa cytoplasmic extracts is regulated by AU-rich elements. EMBO (Eur Mol Biol Organ) J 20: 11341143.[CrossRef][Medline]
Gherzi R, Lee KY, Briata P, Wegmuller D, Moroni C, Karin M, and Chen CY (2004) A KH domain RNA binding protein, KSRP, promotes ARE-directed mRNA turnover by recruiting the degradation machinery. Mol Cell 14: 571583.[CrossRef][Medline]
Gouble A, Grazide S, Meggetto F, Mercier P, Delsol G, and Morello D (2002) A new player in oncogenesis: AUF1/hnRNPD overexpression leads to tumorigenesis in transgenic mice. Cancer Res 62: 14891495.
Greenberg ME and Ziff EB (1984) Stimulation of 3T3 cells induces transcription of the c-fos proto-oncogene. Nature (Lond) 311: 433438.[CrossRef][Medline]
Hall MP, Huang S, and Black DL (2004) Differentiation-induced colocalization of the KH-type splicing regulatory protein with polypyrimidine tract binding protein and the c-src pre-mRNA. Mol Biol Cell 15: 774786.
He L, Weber A, and Levens D (2000) Nuclear targeting determinants of the far upstream element binding protein, a c-myc transcription factor. Nucleic Acids Res 28: 45584565.
Hollams EM, Giles KM, Thomson AM, and Leedman PJ (2002) mRNA stability and the control of gene expression: implications for human disease. Neurochem Res 27: 957980.[CrossRef][Medline]
Katahira M, Miyanoiri Y, Enokizono Y, Matsuda G, Nagata T, Ishikawa F, and Uesugi S (2001) Structure of the C-terminal RNA-binding domain of hnRNP D0 (AUF1), its interactions with RNA and DNA and change in backbone dynamics upon complex formation with DNA. J Mol Biol 311: 973988.[CrossRef][Medline]
Kleinert H, Pautz A, Linker A, and Schwarz PM (2004) Regulation of the expression of inducible nitric oxide synthase. Eur J Pharmacol 500: 255266.[CrossRef][Medline]
Kontoyiannis D, Pasparakis M, Pizarro TT, Cominelli F, and Kollias G (1999) Impaired on/off regulation of TNF biosynthesis in mice lacking TNF AU-rich elements: implications for joint and gut-associated immunopathologies. Immunity 10: 387398.[CrossRef][Medline]
Kracht M and Saklatvala J (2002) Transcriptional and post-transcriptional control of gene expression in inflammation. Cytokine 20: 91106.[CrossRef][Medline]
Kristof AS, Marks-Konczalik J, and Moss J (2001) Mitogen-activated protein kinases mediate activator protein-1-dependent human inducible nitric-oxide synthase promoter activation. J Biol Chem 276: 84458452.
Lai WS, Carballo E, Strum JR, Kennington EA, Phillips RS, and Blackshear PJ (1999) Evidence that tristetraprolin binds to AU-rich elements and promotes the deadenylation and destabilization of tumor necrosis factor alpha mRNA. Mol Cell Biol 19: 43114323.
Lai WS, Kennington EA, and Blackshear PJ (2002) Interactions of CCCH zinc finger proteins with mRNA: non-binding tristetraprolin mutants exert an inhibitory effect on degradation of AU-rich element-containing mRNAs. J Biol Chem 277: 96069613.
Livak KJ and Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25: 402408.[CrossRef][Medline]
Lui P, Zeng C, Acton S, Cok S, Sexton A, and Morrison AR (2004) Effects of p38MAPK isoforms on renal mesangial cell inducible nitric oxide synthase expression. Am J Physiol 286: C145C152.
Mahtani KR, Brook M, Dean JL, Sully G, Saklatvala J, and Clark AR (2001) Mitogen-activated protein kinase p38 controls the expression and posttranslational modification of tristetraprolin, a regulator of tumor necrosis factor alpha mRNA stability. Mol Cell Biol 21: 64616469.
Martel-Pelletier J, Mineau F, Jovanovic D, Di Battista JA, and Pelletier JP (1999) Mitogen-activated protein kinase and nuclear factor kappaB together regulate interleukin-17-induced nitric oxide production in human osteoarthritic chondrocytes: possible role of transactivating factor mitogen-activated protein kinase-activated proten kinase (MAPKAPK). Arthritis Rheum 42: 23992409.[CrossRef][Medline]
Poljakovic M, Nygren JM, and Persson K (2003) Signalling pathways regulating inducible nitric oxide synthase expression in human kidney epithelial cells. Eur J Pharmacol 469: 2128.[CrossRef][Medline]
Ridley SH, Dean JL, Sarsfield SJ, Brook M, Clark AR, and Saklatvala J (1998) A p38 MAP kinase inhibitor regulates stability of interleukin-1-induced cyclooxygenase-2 mRNA. FEBS Lett 439: 7580.[CrossRef][Medline]
Rodriguez-Pascual F, Hausding M, Ihrig-Biedert I, Furneaux H, Levy AP, Förstermann U, and Kleinert H (2000) Complex contribution of the 3'-untranslated region to the expressional regulation of the human inducible nitric-oxide synthase gene. Involvement of the RNA-binding protein HuR. J Biol Chem 275: 2604026049.
Shen X and Masters PS (2001) Evaluation of the role of heterogeneous nuclear ribonucleoprotein A1 as a host factor in murine coronavirus discontinuous transcription and genome replication. Proc Natl Acad Sci USA 98: 27172722.
Shyu AB, Belasco JG, and Greenberg ME (1991) Two distinct destabilizing elements in the c-fos message trigger deadenylation as a first step in rapid mRNA decay. Genes Dev 5: 221231.
Stoecklin G, Stubbs T, Kedersha N, Wax S, Rigby WF, Blackwell TK, and Anderson P (2004) MK2-induced tristetraprolin:14-13-3 complexes prevent stress granule association and ARE-mRNA decay. EMBO (Eur Mol Biol Organ) J 23: 13131324.[CrossRef][Medline]
Tchen CR, Brook M, Saklatvala J, and Clark AR (2004) The stability of tristetraprolin mRNA is regulated by mitogen-activated protein kinase p38 and by tristetraprolin itself. J Biol Chem 279: 3239332400.
Wilusz CJ, Wormington M, and Peltz SW (2001) The cap-to-tail guide to mRNA turnover. Nat Rev Mol Cell Biol 2: 237246.[CrossRef][Medline]
Winzen R, Kracht M, Ritter B, Wilhelm A, Chen CY, Shyu AB, Muller M, Gaestel M, Resch K, and Holtmann H (1999) The p38 MAP kinase pathway signals for cytokine-induced mRNA stabilization via MAP kinase-activated protein kinase 2 and an AU-rich region-targeted mechanism. EMBO (Eur Mol Biol Organ) J 18: 49694980.[CrossRef][Medline]
Witteck A, Yao Y, Fechir M, Förstermann U, and Kleinert H (2003) Human iNOS gene expression is regulated by Rho protein-mediated changes in the structure of the actin cytoskeleton. Exp Cell Res 287: 106115.[CrossRef][Medline]
Zhang W, Wagner BJ, Ehrenman K, Schaefer AW, DeMaria CT, Crater D, DeHaven K, Long L, and Brewer G (1993) Purification, characterization and cDNA cloning of an AU-rich element RNA-binding protein, AUF1. Mol Cell Biol 13: 76527665.
This article has been cited by other articles:
![]() |
A. Pautz, K. Linker, S. Altenhofer, S. Heil, N. Schmidt, J. Art, S. Knauer, R. Stauber, N. Sadri, A. Pont, et al. Similar Regulation of Human Inducible Nitric-oxide Synthase Expression by Different Isoforms of the RNA-binding Protein AUF1 J. Biol. Chem., January 30, 2009; 284(5): 2755 - 2766. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. E. Bell, M. D. Calder, and A. J. Watson Genomic RNA profiling and the programme controlling preimplantation mammalian development Mol. Hum. Reprod., December 1, 2008; 14(12): 691 - 701. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. T. Ishmael, X. Fang, M. R. Galdiero, U. Atasoy, W. F. C. Rigby, M. Gorospe, C. Cheadle, and C. Stellato Role of the RNA-Binding Protein Tristetraprolin in Glucocorticoid-Mediated Gene Regulation J. Immunol., June 15, 2008; 180(12): 8342 - 8353. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Stoecklin, S. A. Tenenbaum, T. Mayo, S. V. Chittur, A. D. George, T. E. Baroni, P. J. Blackshear, and P. Anderson Genome-wide Analysis Identifies Interleukin-10 mRNA as Target of Tristetraprolin J. Biol. Chem., April 25, 2008; 283(17): 11689 - 11699. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Winzen, B. K. Thakur, O. Dittrich-Breiholz, M. Shah, N. Redich, S. Dhamija, M. Kracht, and H. Holtmann Functional Analysis of KSRP Interaction with the AU-Rich Element of Interleukin-8 and Identification of Inflammatory mRNA Targets Mol. Cell. Biol., December 1, 2007; 27(23): 8388 - 8400. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Essafi-Benkhadir, C. Onesto, E. Stebe, C. Moroni, and G. Pages Tristetraprolin Inhibits Ras-dependent Tumor Vascularization by Inducing Vascular Endothelial Growth Factor mRNA Degradation Mol. Biol. Cell, November 1, 2007; 18(11): 4648 - 4658. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.S. Patil and K.L. Kirkwood p38 MAPK Signaling in Oral-related Diseases Journal of Dental Research, September 1, 2007; 86(9): 812 - 825. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Ziesche, M. Bachmann, H. Kleinert, J. Pfeilschifter, and H. Muhl The Interleukin-22/STAT3 Pathway Potentiates Expression of Inducible Nitric-oxide Synthase in Human Colon Carcinoma Cells J. Biol. Chem., June 1, 2007; 282(22): 16006 - 16015. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Korhonen, K. Linker, A. Pautz, U. Forstermann, E. Moilanen, and H. Kleinert Post-Transcriptional Regulation of Human Inducible Nitric-Oxide Synthase Expression by the Jun N-terminal Kinase Mol. Pharmacol., May 1, 2007; 71(5): 1427 - 1434. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Pautz, K. Linker, T. Hubrich, R. Korhonen, S. Altenhofer, and H. Kleinert The Polypyrimidine Tract-binding Protein (PTB) Is Involved in the Post-transcriptional Regulation of Human Inducible Nitric Oxide Synthase Expression J. Biol. Chem., October 27, 2006; 281(43): 32294 - 32302. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Hitti, T. Iakovleva, M. Brook, S. Deppenmeier, A. D. Gruber, D. Radzioch, A. R. Clark, P. J. Blackshear, A. Kotlyarov, and M. Gaestel Mitogen-activated protein kinase-activated protein kinase 2 regulates tumor necrosis factor mRNA stability and translation mainly by altering tristetraprolin expression, stability, and binding to adenine/uridine-rich element. Mol. Cell. Biol., March 1, 2006; 26(6): 2399 - 2407. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Brook, C. R. Tchen, T. Santalucia, J. McIlrath, J. S. C. Arthur, J. Saklatvala, and A. R. Clark Posttranslational Regulation of Tristetraprolin Subcellular Localization and Protein Stability by p38 Mitogen-Activated Protein Kinase and Extracellular Signal-Regulated Kinase Pathways. Mol. Cell. Biol., March 1, 2006; 26(6): 2408 - 2418. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Barreau, L. Paillard, and H. B. Osborne AU-rich elements and associated factors: are there unifying principles? Nucleic Acids Res., January 3, 2006; 33(22): 7138 - 7150. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. Hoyt, J. Ballering, H. Numanami, J. M. Hayden, and R. A. Robbins Doxycycline Modulates Nitric Oxide Production in Murine Lung Epithelial Cells J. Immunol., January 1, 2006; 176(1): 567 - 572. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Linker, A. Pautz, M. Fechir, T. Hubrich, J. Greeve, and H. Kleinert Involvement of KSRP in the post-transcriptional regulation of human iNOS expression-complex interplay of KSRP with TTP and HuR Nucleic Acids Res., August 26, 2005; 33(15): 4813 - 4827. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||