|
|
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Institute of Cell Biology, University of Bern, Switzerland
Received December 17, 2004; accepted June 1, 2005
| Abstract |
|---|
|
|
|---|
2. In this study, we show stronger phenotypes of the tbat1 null mutant with respect to its sensitivity toward toxic adenosine analogs. Compared with parental TbAT1+/+ trypanosomes, the tbat1-/- mutant is 77-fold less sensitive to tubercidin and 14-fold less sensitive to cordycepin. Resistance is further increased by the addition of inosine but is reverted by adenine. It is surprising that the tbat1-/- mutant grows faster than TbAT1+/+ trypanosomes and that it overexpresses genes of the TbNT cluster encoding P1-type transporters. These unexpected phenotypes show that there are conditions other than drug pressure under which loss of P2 may confer a selective advantage to bloodstream-form trypanosomes. Overexpression of P1 by trypanosomes after loss of P2 indicates that combinatorial chemotherapy with trypanocidal P1 and P2 substrates may be a promising strategy to prevent drug resistance in sleeping sickness.
Molecular mechanisms of drug resistance in T. brucei have mainly been studied in laboratory strains selected at suboptimal drug concentrations. Adenosine permeases turned out to play an important role in the uptake of, and resistance to, trypanocides. Carter and Fairlamb differentiated two types of adenosine transport systems, P1 and P2 (Carter and Fairlamb, 1993
). P1 was shown to be a broad-specificity purine transporter, whereas P2 transports only adenine and adenosine (Table 1). It is interesting, however, that P2 transports also melarsen-based drugs and diamidines (Carter et al., 1995
). P2-type adenosine transport was found to be absent or impaired in drug-resistant trypanosomes (Carter and Fairlamb, 1993
; Barrett et al., 1995
).
|
P1 is encoded by multiple genes of the TbNT family (Table 1). The genes TbNT2 to TbNT7 cluster on a single locus. TbNT2, TbNT5, TbNT6, and TbNT7 exhibited P1-type substrate specificities when expressed in Xenopus laevis oocytes, whereas no substrate has yet been identified for TbNT3 and TbNT4 (Sanchez et al., 2002
). P2 is apparently encoded by a single gene, TbAT1 (Mäser et al., 1999
; Matovu et al., 2003
). Trypanosomes selected for melarsoprol resistance harbored point mutations in TbAT1 that abolished function (Mäser et al., 1999
). It is surprising that identical point mutations were found in T. b. gambiense field isolates (Mäser et al., 1999
; Matovu et al., 2001a
), and the occurrence of such mutations correlated to some degree with melarsoprol treatment failure (Matovu et al., 2001b
).
A T. b. brucei tbat1 null mutant was recently generated by homozygous replacement of the gene (Matovu et al., 2003
). tbat1-/- trypanosomes had no detectable P2 activity. They exhibited reduced sensitivity toward melarsen-based arsenicals as well as diamidines, albeit with resistance factors of only 2 to 3 (Matovu et al., 2003
). However, the tbat1 null mutant was 20-fold resistant to the veterinary drug diminazene (Matovu et al., 2003
; de Koning et al., 2004
). Melamine-based nitrofurans designed to be P2 substrates were not toxic or were only marginally more toxic to TbAT1+/+ than to tbat1-/- trypanosomes (Stewart et al., 2004
). Herein, we characterize tbat1 null trypanosomes with respect to their sensitivity toward adenosine antimetabolites, reevaluating the P1/P2 model and its implications for anti-trypanosomal chemotherapy. Surprising phenotypes regarding cell growth and drug resistance reveal relationships between transport, salvage, and toxicity of adenosine analogs, and they indicate a possible interplay between P1 and P2 purine uptake systems.
| Materials and Methods |
|---|
|
|
|---|
In Vitro Drug Sensitivity Assays. Trypanosomal drug sensitivity was determined with the redox-activated fluorescent dye Alamar-Blue as described previously (Räz et al., 1997
). In brief, trypanosomes (103/well) were cultivated in 96-well plates for 70 h in the presence of serial dilutions of compounds. After this growth period, 10 µl of Alamar-Blue reagent (Bio-Source, Camarillo CA) was added to each well, and after a further 2 h of incubation, fluorescence was measured (excitation at 536 nm, emission at 588 nm; Spectramax Gemini fluorimeter, Molecular Devices, Sunnyvale, CA). All assays were performed at least three times, each in triplicate. IC50 values were determined by nonlinear regression to sigmoid dose-response parameters using Prism 4 software (GraphPad Software, San Diego, CA). All chemicals were purchased from Fluka Chemie GmbH (Buchs, Switzerland).
Adenosine Transport Assays. Adenosine transport measurements were carried out as described previously (de Koning and Jarvis, 1997
). In brief, 107 bloodstream-form trypanosomes in 100 µl were mixed with an equal volume of uptake buffer containing 100 nM [3H]adenosine (65.8 Ci/mmol; PerkinElmer Life and Analytical Sciences, Boston, MA) and incubated for 10 s at 37°C. Uptake was stopped by addition of 4 mM ice-cold, unlabeled adenosine, and the cells were pelleted by centrifugation through dibutylphthalate/mineral oil (7:1). After flash-freezing in liquid N2, the bottom of each centrifuge tube was cut-off and transferred into liquid scintillation cocktail. All assays were performed three times, each in triplicate.
Gene Expression Analyses. Total RNA was isolated from cultured trypanosomes by extraction with hot phenol (95°C, pH 4.5) and chloroform, followed by ethanol precipitation. After DNase treatment (DNA-away; Ambion Biotech, Austin, TX), cDNA was synthesized from 1 µg of RNA with avian myeloblastosis virus reverse transcriptase (Roche, Mannheim, Germany) and T16 primer in a volume of 15 µl. PCR was performed with Taq polymerase (QIAGEN, Hilden, Germany) on 3 µl of cDNA. Negative controls lacking reverse transcriptase were always included. For amplification of TbNT subgroup genes (Fig. 5), a forward primer specific to the 5' spliced leader sequence (cgctattattagaacagtttctgtac), which all T. brucei mRNAs have in common, was combined with the primer Actin_rev (ctgcgtcattttctcacggt) and one of the following: NT2-7_rev (gcrgcaagagagcgttgac), NTII_rev (agggcagaacaaaaatgaagc), NTIII_rev (gcaatccgctttcaaatcg), or NTIV_rev (tgtaatggtctcttgaacaggt); annealing temperature was 61°C, and elongation time was 80 s. Because of the relatively weak expression of TbNT genes, actin primers were added only after five performed cycles. Gene-specific primers for Fig. 7 were NT4_rev (tttacatcaaagtcacacactgtt), and NT6_rev (tagtatcgcctgtcttcgc); annealing at 55°C, with 60-s elongation for both. For Fig. 6, genes of the TbNT2-TbNT7 cluster were amplified with the primers NT2-7_fw (ggatgtcggtgatgaatgtgacg) and NT2-7_rev (annealing at 55°C and 80-s elongation). PCR products (200 ng) were purified (QIAquick PCR purification kit; QIAGEN) and sequenced directly in either direction using the same primers as for amplification. Sequencing was performed at the CMPG facility, Zoological Institute Bern.
|
|
|
| Results |
|---|
|
|
|---|
|
Genetic Disruption of TbAT1 Causes Resistance to Purine Analogs. The same set of sensitivity tests were carried out with tbat1 knock-out trypanosomes to investigate the role of P2 in cellular uptake of these purine analogs. Again, dideoxyadenosine (Fig. 1) and dideoxyinosine (data not shown) were hardly active, and there was no difference in toxicity between TbAT1+/+ and tbat1-/- trypanosomes. However, the tbat1-/- mutant was 77-fold more resistant to tubercidin and 14-fold more resistant to cordycepin (Fig. 1). This demonstrates that both tubercidin and cordycepin are taken up to a substantial part via TbAT1 in wild-type trypanosomes. To test whether residual uptake in the tbat1-/- mutant occurs via P1-type adenosine transporters, the sensitivity tests were repeated in the presence of excess amounts of known P1 and P2 substrates.
Effects of Physiological Purines on Sensitivity to Adenosine Antimetabolites. Adenosine is a substrate of both transport activities P1 and P2, whereas inosine is imported exclusively by P1 and adenine only by P2 (Table 1). In wild-type TbAT1+/+ trypanosomes, supplementation of the medium with 1 mM adenosine or inosine caused a 4- to 5-fold reduction of tubercidin susceptibility (Fig. 2a). Addition of 1 mM adenine had a much stronger effect, rendering trypanosomes 220-fold less susceptible to tubercidin (Fig. 2a). Effects of excess purines on cordycepin toxicity were less dramatic. Addition of adenosine hardly had an effect and inosine, if anything, sensitized trypanosomes toward cordycepin (Fig. 2b). Again, excess adenine exerted the most pronounced reduction of sensitivity, increasing the IC50 of cordycepin by a factor of 6 (Fig. 2b).
|
The same set of experiments was carried out with the tbat1-/- null mutant. Again, resistance to tubercidin was further increased upon addition of adenosine or inosine (Fig. 2a), presumably by blocking P1-mediated uptake. Excess adenine, as expected, did not further increase the resistance of tbat1-/- trypanosomes, because adenine is not a P1 substrate (Table 1). It is surprising, however, that adenine even resensitized the resistant tbat1-/- strain toward adenosine antimetabolites (Fig. 2a). A similar pattern was observed for cordycepin. Addition of excess inosine further increased the resistance of tbat1-/- trypanosomes, adenosine had only little effect, and adenine rendered the null mutant hypersensitive to cordycepin (Fig. 2b).
The data are summarized in Fig. 2c. Addition of excess adenosine reduced the sensitivity to adenosine analogs of the tbat1-/- mutant and parental TbAT1+/+ trypanosomes to a similar extent, leaving the resistance factor R unchanged (R equals IC50 of tbat1-/- divided by IC50 of TbAT1+/+). The same effect was observed for inosine regarding tubercidin toxicity. With cordycepin, however, excess inosine reduced the susceptibility more strongly in tbat1-/- than in wild-type trypanosomes. Thus, the resistance factor to cordycepin increased to 130-fold in the presence of inosine, reaching the level of R for tubercidin. This finding is in agreement with the P1/P2 model, and it indicates that P1 also contributes to cordycepin uptake. A puzzling effect was exerted by the P2 substrate adenine, which reverted the tbat1-/- phenotype, re-sensitizing null mutant trypanosomes toward both tubercidin and cordycepin (Fig. 2c). This effect was not observed with TbAT1+/+ trypanosomes, where addition of excess adenineas expected (Table 1)reduced the sensitivity toward adenosine analogs. As a consequence, tbat1-/- mutants were more sensitive to tubercidin and cordycepin than wild-type trypanosomes in the presence of 1 mM adenine. In addition, excess adenine slowed-down the growth of T. brucei bloodstream forms already in the absence of drugs (data not shown). This phenomenon was observed for parental as well as for tbat1-/- mutant trypanosomes.
|
tbat1-/- Trypanosomes Grow Faster Than Their Parental Strain. The tbat1-/- mutant had not shown any growth defect (Matovu et al., 2003
), as might be expected given 1) the large number of purine transporters encoded in the genome of T. brucei (Mäser et al., 2003
; de Koning et al., 2005
) and 2) the fact that the purine source in standard culture medium is hypoxanthine and not adenosine (Baltz et al., 1985
). We were surprised to observe here, however, that tbat1-/- trypanosomes grew even faster than their TbAT1+/+ parents. To quantify growth, tbat1-/- and its parental strain were propagated in vitro, and the population doubling times were calculated from linear regression of the log-transformed growth curves. Under all conditions tested, tbat1 null trypanosomes grew slightly but reproducibly faster than their parental strain (Fig. 4). The difference was more pronounced at limiting serum concentrations; at 5%, the population doubling times were 13.3 ± 3.6 h for wild-type and 10.8 ± 2.3 h for tbat1-/- trypanosomes (p = 0.012 for significant difference in a two-tailed t test). This means that, starting from a mixed population consisting of equal parts tbat1-/- and TbAT1+/+ trypanosomes, the null mutants would outgrow wild-type cells by a factor of 10 within 8 days. However, it must be noted that such in vitro analysis does not necessarily extrapolate to the situation in a natural host.
|
Expression Analysis of Trypanosomal ENT Genes. To investigate eventual secondary effects of TbAT1 disruption, we measured expression levels of other trypanosomal nucleoside transporter genes in parental TbAT1+/+ and in tbat1-/- bloodstream form trypanosomes. Figure 5a shows members of the equilibrative nucleoside transporter family from T. brucei (the ENT family; Pfam PF01733, TC 2.A.57). More trypanosomal ENT genes are emerging as the genome sequencing initiative approaches completion. As apparent from the similarity dendrogram of a multiple alignment, the majority of trypanosomal nucleoside transporters cluster into different subgroups (Fig. 5a; see also Table 1). Expression levels of each subgroup were measured in a semiquantitative way, by performing reverse transcriptase (RT) PCR in the presence of a forward primer of the T. brucei spliced mRNA leader sequence (Walder et al., 1986
) and two different reverse primers, one specific for actin and one for the ENT group of interest. These primers were chosen from conserved regions within the respective genes to amplify all members of a particular group. For one singleton gene, Tb09.160.5480, expression was not detectable. For two subgroups, III and IV, expression was confirmed but did not vary between parental and tbat1-/- trypanosomes (Fig. 5b). The large subgroup I, however, was expressed more strongly in tbat1-/- trypanosomes than in their parents, as determined by comparison with the internal actin control (Fig. 5b). This finding was confirmed by three independent RT-PCR experiments and also by Northern blot analysis (data not shown). The six genes in this group, TbNT2 to TbNT7, are all located within 9 kb on chromosome 2 of T. brucei (Sanchez et al., 2002
). TbNT2, TbNT5, TbNT6, and TbNT7 are P1-type transporters of slightly varying substrate specificities; the substrates of TbNT3 and TbNT4 are unknown (Sanchez et al., 2002
).
Expression Analysis within the TbNT Gene Cluster. Expression of individual genes within the TbNT cluster on chromosome 2 was again investigated by RT-PCR. mRNA isolated from T. brucei bloodstream forms was reverse-transcribed and amplified by PCR as described above. The resulting products were then sequenced directly, to avoid eventual bias introduced by cloning. Single nucleotide polymorphisms became apparent in the electropherogram of the sequencing products terminated with fluorescent dideoxynucleotides. This method was highly reproducible and allowed distinction between individual TbNT genes (Fig. 6). Of the five genes in the TbNT cluster, TbNT2 seemed to be predominantly expressed as apparent from positions where it differs from the rest. Expression of TbNT3, TbNT4, TbNT5, and TbNT7, on the other hand, was not detectable in wild-type TbAT1+/+ trypanosomes (Fig. 6). TbNT3, TbNT5, and TbNT7 were not expressed in tbat1-/- cells either. However, judging from the polymorphic positions outlined in Fig. 6, a weak TbNT4 signal was detectable in the null mutant. The signal of TbNT6 relative to the other genes in the cluster seemed to be stronger in the mutant as well. We therefore investigated expression of TbNT4 and TbNT6 by semiquantitative RT-PCR using gene-specific primers. As shown in Fig. 7, the two genes were indeed overexpressed in the tbat1-/- mutant.
| Discussion |
|---|
|
|
|---|
The fact that the alleviating effect of excess inosine on toxicity of tubercidin and cordycepin was stronger for tbat1-/- than for TbAT1+/+ trypanosomes indicated that P1-mediated import of the adenosine analogs only became relevant in the absence of TbAT1 (Fig. 2, a and b). In the presence of 1 mM inosine, tbat1-null cells were 130-fold resistant to tubercidin and 112-fold resistant to cordycepin (Fig. 2c). Thus the surprising drug resistance phenotype of tbat1-/- trypanosomes is explainable, at least in part, by different affinities of P1- and P2-type transporters toward adenosine analogs. One caveat of the drug sensitivity experiments is that it cannot be distinguished whether excess purines reduce the toxicity of adenosine analogs by competing with cellular uptake or by competing at their intracellular target. RNAi experiments have indicated that tubercidin targets glycolysis in T. brucei rather than purine salvage (Drew et al., 2003
). Competition with import is in agreement with measurements of transport kinetics of [3H]adenosine, where Ki values for adenosine analogs differed substantially between experiments performed in the presence of excess adenine to block P2 or excess inosine to block P1 (de Koning and Jarvis, 1999
). This study, carried out before the cloning of trypanosomal adenosine transporters, already indicated that tubercidin (Ki of 78 µM) and cordycepin (Ki of 210 µM) are not high-affinity P1 substrates (de Koning and Jarvis, 1999
).
A second reason for the stronger effect of inosine in the tbat1-/- mutant compared with wild-type in decreasing the susceptibility to adenosine analogs, could be the fact that tbat1-/- trypanosomes overexpressed genes of the TbNT cluster (Fig. 5). TbNT4 and particularly TbNT6 showed higher mRNA levels in tbat1-/- than in TbAT1+/+ trypanosomes (Fig. 7). Whereas TbNT6 is a P1-type adenosine permease, as determined by functional expression in Xenopus laevis oocytes, no substrate was identified for TbNT4 (Sanchez et al., 2002
). The subcellular localizations of TbNT4 and TbNT6 are unknown. The finding that deletion of one trypanosomal ENT may lead to overexpression of other members of the same family complicates the assessment of individual transporters' contributions to drug susceptibility by molecular genetics. Whether overexpression of TbNT genes also occurs in P2 loss-of-function T. brucei field isolates remains to be investigated. If so, this might be exploited for drug targeting toward melarsoprol-resistant trypanosomes. However, Carter and Fairlamb observed 3-fold lower P1-type adenosine uptake rates in P2-deficient, melarsoprol-resistant trypanosomes than in their parental, drug-sensitive strain (Carter and Fairlamb, 1993
). Changes in adenosine transport have also been described from procyclic, tsetse fly midgutform T. brucei, where adenosine uptake rates strongly increased upon purine starvation (de Koning et al., 2000
). It is unknown whether such effects are caused by changes in expression levels of adenosine transporter genes.
A further unexpected finding was that tbat1-/- trypanosomes grew faster than parental TbAT1+/+ cells at limiting serum concentrations (Fig. 4). At present, we can only speculate about whether this was a consequence of overexpression of TbNT genes. The finding that tbat1-/- trypanosomes grew faster than their TbAT1+/+ parents indicates that there are conditions other than chemotherapy in which loss of P2 confers a selective advantage to bloodstream-form trypanosomes. This may have implications for the stability of drug resistance in the absence of drug pressure, which is remarkably high for African trypanosomes. In summary, the P1/P2 model is still valid but received some new twists. In particular, P1 and P2 may be functionally linked such that overexpression of the former compensates for lack of the latter. If this also happens in field isolates, combination of trypanocidal P1 and P2 substrates will be a good strategy toward drug cocktails of minimal propensity for resistance by loss of import.
| Acknowledgements |
|---|
| Footnotes |
|---|
F.G. and A.L. contributed equally to this work.
ABBREVIATIONS: PCR, polymerase chain reaction; RT, reverse transcriptase.
1 Current address: Institute of Biomedical and Life Sciences, University of Glasgow, Glasgow, UK. ![]()
Address correspondence to: Pascal Mäser, Institute of Cell Biology, Baltzerstrasse 4, CH-3012 Bern, Switzerland. E-mail pascal.maeser{at}izb.unibe.ch
| References |
|---|
|
|
|---|
Barrett MP, Zhang ZQ, Denise H, Giroud C, and Baltz T (1995) A diamidine-resistant Trypanosoma equiperdum clone contains a P2 purine transporter with reduced substrate affinity. Mol Biochem Parasitol 73: 223-229.[CrossRef][Medline]
Carter NS, Berger BJ, and Fairlamb AH (1995) Uptake of diamidine drugs by the P2 nucleoside transporter in melarsen-sensitive and -resistant Trypanosoma brucei brucei. J Biol Chem 270: 28153-28157.
Carter NS and Fairlamb AH (1993) Arsenical-resistant trypanosomes lack an unusual adenosine transporter. Nature (Lond) 361: 173-175.[CrossRef][Medline]
de Koning HP, Anderson LF, Stewart M, Burchmore RJ, Wallace LJ, and Barrett MP (2004) The trypanocide diminazene aceturate is accumulated predominantly through the TbAT1 purine transporter: additional insights on diamidine resistance in African trypanosomes. Antimicrob Agents Chemother 48: 1515-1519.
de Koning HP, Bridges DJ, and Burchmore RJS (2005) Purine and pyrimidine transport in pathogenic protozoa: from biology to therapy. FEMS Microbiol Rev, in press.
de Koning HP and Jarvis SM (1997) Purine nucleobase transport in bloodstream forms of Trypanosoma brucei brucei is mediated by two novel transporters. Mol Biochem Parasitol 89: 245-258.[CrossRef][Medline]
de Koning HP and Jarvis SM (1999) Adenosine transporters in bloodstream forms of Trypanosoma brucei brucei: substrate recognition motifs and affinity for trypanocidal drugs. Mol Pharmacol 56: 1162-1170.
de Koning HP, Watson CJ, Sutcliffe L, and Jarvis SM (2000) Differential regulation of nucleoside and nucleobase transporters in Crithidia fasciculata and Trypanosoma brucei. Mol Biochem Parastiol 106: 93-107.
Drabikowska AK, Halec L, and Shugar D (1985) Purification and properties of adenosine kinase from rat liver: separation from deoxyadenosine kinase activity. Z Naturforsch 40: 34-41.
Drew ME, Morris JC, Wang Z, Wells L, Sanchez M, Landfear SM, and Englund PT (2003) The adenosine analog tubercidin inhibits glycolysis in Trypanosoma brucei as revealed by an RNA interference library. J Biol Chem 278: 46596-46600.
Hirumi H and Hirumi K (1989) Continuous cultivation of Trypanosoma brucei blood stream forms in a medium containing a low concentration of serum protein without feeder cell layers. J Parasitol 75: 985-989.[CrossRef][Medline]
Kioy D, Jannin J, and Mattock N (2004) Focus: human African trypanosomiasis. Nat Rev Microbiol 2: 186-187.[Medline]
Legros D, Evans S, Maiso F, Enyaru JC, and Mbulamberi D (1999) Risk factors for treatment failure after melarsoprol for Trypanosoma brucei gambiense trypanosomiasis in Uganda. Trans R Soc Trop Med Hyg 93: 439-442.[CrossRef][Medline]
Mäser P, Lüscher A, and Kaminsky R (2003) Drug transport and drug resistance in African trypanosomes. Drug Resist Updat 6: 281-290.[CrossRef][Medline]
Mäser P, Sütterlin C, Kralli A, and Kaminsky R (1999) A nucleoside transporter from Trypanosoma brucei involved in drug resistance. Science (Wash DC) 285: 242-244.
Mäser P, Vogel D, Schmid C, Räz B, and Kaminsky R (2001) Identification and characterization of trypanocides by functional expression of an adenosine transporter from Trypanosoma brucei in yeast. J Mol Med 97: 121-127.[CrossRef]
Matovu E, Enyaru JC, Legros D, Schmid C, Seebeck T, and Kaminsky R (2001a) Melarsoprol refractory T. b. gambiense from Omugo, north-western Uganda. Trop Med Int Health 6: 407-411.[CrossRef][Medline]
Matovu E, Geiser F, Schneider V, Mäser P, Enyaru JCK, Kaminsky R, Gallati S, and Seebeck T (2001b) Genetic variants of the TbAT1 adenosine transporter from African trypanosomes in relapse infections following melarsoprol therapy. Mol Biochem Parasitol 117: 73-81.[CrossRef][Medline]
Matovu E, Stewart ML, Geiser F, Brun R, Mäser P, Wallace LJ, Burchmore RJ, Enyaru JC, Barrett MP, Kaminsky R, et al. (2003) The mechanisms of arsenical and diamidine uptake and resistance in Trypanosoma brucei. Eukaryot Cell 2: 1003-1008.
Nakajima-Shimada J, Hirota Y, and Aoki T (1996) Inhibition of Trypanosoma cruzi growth in mammalian cells by purine and pyrimidine analogs. Antimicrob Agents Chemother 40: 2455-2458.[Abstract]
Page RD (1996) TreeView: an application to display phylogenetic trees on personal computers. Comput Appl Biosci 12: 357-358.
Räz B, Iten M, Grether-Bühler Y, Kaminsky R, and Brun R (1997) The Alamar Blue assay to determine drug sensitivity of African trypanosomes in vitro. Acta Trop 68: 139-147.[CrossRef][Medline]
Sanchez M, Drutman S, van Ampting M, Matthews KR, and Landfear SM (2004) A novel purine nucleoside transporter whose expression is up-regulated in the short stumpy form of the Trypanosoma brucei life cycle. Mol Biochem Parasitol 136: 265-272.[CrossRef][Medline]
Sanchez M, Tryon R, Green J, Boor I, and Landfear S (2002) Six related nucleoside/nucleobase transporters from Trypanosoma brucei exhibit distinct biochemical functions. J Biol Chem 277: 21499-21504.
Sanchez MA, Ullman B, Landfear SM, and Carter NS (1999) Cloning and functional expression of a gene encoding a P1 type nucleoside transporter from Trypanosoma brucei. J Biol Chem 274: 30244-30249.
Stanghellini A and Josenando T (2001) The situation of sleeping sickness in Angola: a calamity. Trop Med Int Health 6: 330-334.[CrossRef][Medline]
Stewart ML, Bueno GJ, Baliani A, Klenke B, Brun R, Brock JM, Gilbert IH, and Barrett MP (2004) Trypanocidal activity of melamine-based nitroheterocycles. Antimicrob Agents Chemother 48: 1733-1738.
Thompson JD, Higgins DG, and Gibson TJ (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22: 4673-4680.
Walder JA, Eder PS, Engman DM, Brentano ST, Walder RY, Knutzon DS, Dorfman DM, and Donelson JE (1986) The 35-nucleotide spliced leader sequence is common to all trypanosome messenger RNA's. Science (Wash DC) 233: 569-571.
Williamson J (1972) Further experiments with the nucleoside trypanocide, cordycepin. Trans R Soc Trop Med Hyg 66: 354-355.
This article has been cited by other articles:
![]() |
A. Luscher, P. Onal, A.-M. Schweingruber, and P. Maser Adenosine Kinase of Trypanosoma brucei and Its Role in Susceptibility to Adenosine Antimetabolites Antimicrob. Agents Chemother., November 1, 2007; 51(11): 3895 - 3901. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Mathis, A. S. Bridges, M. A. Ismail, A. Kumar, I. Francesconi, M. Anbazhagan, Q. Hu, F. A. Tanious, T. Wenzler, J. Saulter, et al. Diphenyl Furans and Aza Analogs: Effects of Structural Modification on In Vitro Activity, DNA Binding, and Accumulation and Distribution in Trypanosomes Antimicrob. Agents Chemother., August 1, 2007; 51(8): 2801 - 2810. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. I. Al-Salabi, L. J. M. Wallace, A. Luscher, P. Maser, D. Candlish, B. Rodenko, M. K. Gould, I. Jabeen, S. N. Ajith, and H. P. de Koning Molecular Interactions Underlying the Unusually High Adenosine Affinity of a Novel Trypanosoma brucei Nucleoside Transporter Mol. Pharmacol., March 1, 2007; 71(3): 921 - 929. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Laxman, A. Riechers, M. Sadilek, F. Schwede, and J. A. Beavo Hydrolysis products of cAMP analogs cause transformation of Trypanosoma brucei from slender to stumpy-like forms PNAS, December 12, 2006; 103(50): 19194 - 19199. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Lanteri, M. L. Stewart, J. M. Brock, V. P. Alibu, S. R. Meshnick, R. R. Tidwell, and M. P. Barrett Roles for the Trypanosoma brucei P2 Transporter in DB75 Uptake and Resistance Mol. Pharmacol., November 1, 2006; 70(5): 1585 - 1592. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||