MolPharm

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
 QUICK SEARCH:   [advanced]


     


Molecular Pharmacology Fast Forward
First published on October 12, 2005; DOI: 10.1124/mol.105.017111


0026-895X/06/6901-109-118$20.00
Mol Pharmacol 69:109-118, 2006

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
mol.105.017111v1
69/1/109    most recent
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lamian, V.
Right arrow Articles by Dubaquie, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lamian, V.
Right arrow Articles by Dubaquie, Y.

Characterization of Agonist-Induced Motilin Receptor Trafficking and Its Implications for Tachyphylaxis

Vahideh Lamian, Adam Rich, Zhengping Ma, James Li, Ramakrishna Seethala, David Gordon, and Yves Dubaquie

Clinical Discovery Technologies (V.L., Y.D.), Metabolic Disease Research (Z.M., R.S., D.G.), Discovery Chemistry (J.L.), Bristol-Myers Squibb Pharmaceutical Research Institute, Princeton, New Jersey; and Biological Sciences, State University of New York—Brockport, Brockport, New York (A.R.)

Received for publication July 21, 2005.

Accepted for publication October 11, 2005.


    Abstract
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
The motilin receptor (MR) is a member of the seven-transmembrane receptor family and is expressed throughout the gastrointestinal tract of humans and other species. Motilin, the natural MR peptide ligand, has profound stimulatory effects on gastrointestinal contractility, indicating a therapeutic potential for MR modulators. However, long-term clinical use of certain MR agonists is limited by tachyphylaxis, a reduced responsiveness to repeated compound exposure. This study was meant to characterize the ligand-induced endocytosis of MR and to test whether receptor trafficking contributes to tachyphylaxis. A cell-based assay was developed by fusing a green fluorescent protein (GFP) moiety to the motilin receptor, and high-content biology instrumentation was used to quantify time and dose dependence of MR-GFP endocytosis. Maximal internalization of MR-GFP was induced after 45 min of constant exposure to 80 nM motilin. This process was disrupted by nocodazole, suggesting an essential role for microtubules. Internalized MR-GFP vesicles disappeared within 15 to 45 min of motilin withdrawal but did not overlap with the lysosomal compartment, indicating that MR-GFP escaped degradation and was recycled back to the plasma membrane. It is noteworthy that the kinetics of MR-GFP redistribution varied substantially when stimulated with motilin, erythromycin, 6,9-hemiacetal 8,9-anhydro-4''-deoxy-3'-N-desmethyl-3'-N-ethylerythromycin B (ABT-229), or N-[(1S)-1-[[[(1S)-1-(aminocarbonyl)-3-phenylpropyl]amino]carbonyl]-3-phenylpropyl]-2'-(1,3-benzodioxol-5-ylmethyl)tetrahydro-1',3'-dioxo-spiro[piperidine-4,5'(6'H)-[1H][1,2,4]triazolo[1,2-a]pyridazine]-8'-carboxamide (BMS-591348) at equipotent doses for Ca2+-mobilization. Retardation of the intracellular MR-GFP sorting cycle seemed to correlate with the tachyphylaxis-inducing properties of each compound, but not its EC50. These results indicate that MR internalization, desensitization, and resensitization are ligand-dependent and that appropriate screening strategies may enable the development of small molecule agonists with ideal combinations of these distinct properties.


Gastrointestinal (GI) motility disorders are of increasing importance in industrialized countries, as indicated by the rapidly growing number of patients suffering from diabetic gastroparesis, irritable bowel syndrome, gastroesophageal reflux disease, and chronic constipation. Current and future therapies aim to modulate gut smooth muscle contractions to alleviate the symptoms of GI motility disorders (Chovet, 2000Go). Motilin, a highly conserved peptide hormone expressed in the small intestine of humans and other species, is involved in the regulation of gastrointestinal motility. Mature motilin consists of the first 22 N-terminal amino acids of the inactive precursor protein. The stimulatory effects on GI smooth muscle contraction and gastric emptying of this important peptide are well documented and have attracted considerable attention to its therapeutic potential (Vantrappen and Peeters, 1989Go).

The effects of motilin are mediated through the recently identified motilin receptor [MR; originally termed GPR38 (Feighner et al., 1999Go)], which belongs to the superfamily of G protein-coupled or seven-transmembrane receptors (Pierce et al., 2002Go). GPR38 had been cloned based on its homology (53% amino acid identity) to the human growth hormone secretagogue receptor and was classified as an orphan GPCR because its natural ligand remained unknown (McKee et al., 1997Go). Screening of peptide and small molecule libraries against GPR38 using a functional signaling assay led to the identification of motilin as its cognate binding partner (Feighner et al., 1999Go). It is noteworthy that the antibiotic compound erythromycin was also shown to exhibit agonist activity, confirming earlier findings that its prokinetic effects on GI motility are mediated through the motilin receptor (Peeters et al., 1989Go). Although erythromycin can be prescribed in the clinic to stimulate GI motility, its side-effect profile (e.g., vomiting, nausea, diarrhea) and antibiotic activity prevent long-term use. This has initiated a search for compounds with motilin receptor agonist activity that lack antibiotic effects and are better tolerated than erythromycin. Several potent erythromycin derivatives have been developed, including ABT-229 (Lartey et al., 1995Go) and GM-611 (Peeters, 2001Go). Patients treated with ABT-229 in clinical trials, however, experienced a decrease in response after repeated drug exposure (Talley et al., 2000Go; Netzer et al., 2002Go). It was proposed that motilin receptor desensitization, also termed tachyphylaxis, may have contributed to clinical failure (Tack and Peeters, 2001Go), and recent publications seem to support this hypothesis based on agonist-induced Ca2+ measurements in cell culture experiments (Li et al., 2004Go; Thielemans et al., 2005Go).

Most G-protein-coupled receptors (GPCRs) undergo internalization upon agonist treatment (Ferguson, 2001Go; Pierce et al., 2002Go). Once internalized, the receptor may be subject to three different fates; recycled back to the cell surface, targeted to the lysosomes for degradation, or retained within the endosomal compartment (Ferguson, 2001Go). The balance between these three fates along with the rate of de novo synthesis of new receptors determines the kinetics of desensitization and resensitization. Therefore, it is critical to investigate and understand the endocytosis patterns of a GPCR drug target to understand how tachyphylaxis arises. This information can then be used to guide the design of agonists that minimize desensitization.

Little is known about the intracellular fate of the motilin receptor at the molecular level upon agonist stimulation. For instance, we lack information on its endocytosis pattern and whether MR is subsequently degraded or recycled back to the plasma membrane. With respect to design of optimal modulators, it is unknown whether the properties of the ligand can influence any aspect of internalization, recycling, degradation, or retention. Therefore, the aim of this study was to characterize the trafficking pattern of the motilin receptor inside the cell and relate these results to the functional tachyphylaxis-inducing properties of different agonists. To address these questions, a stable cell line expressing a motilin-receptor green fluorescent protein (GFP) fusion protein was generated. The ligand-induced redistribution of MR-GFP was analyzed quantitatively by using fluorescence confocal microscopy in combination with high-content screening algorithms. The results indicate that receptor internalization is dependent on agonist dose and exposure time and provide a critical role for microtubules. Furthermore, internalized MR-GFP molecules did not colocalize with lysosomes, suggesting that they were redistributed back to the cell surface and may be available for repeated signaling and internalization. Finally, the tachyphylaxis-inducing properties of different MR agonists were found to correlate with their propensity to induce receptor internalization but not with their signaling potency (EC50). Not only does this novel quantitative internalization assay provide valuable insight into the mechanisms of motilin receptor trafficking, it also offers an important generally applicable tool to investigate the tachyphylaxis-inducing properties of novel GPCR agonists at an early stage of drug discovery.


    Materials and Methods
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Motilin Receptor Agonist Compounds. Human motilin was purchased from American Peptide Company (Sunnyvale, CA), and erythromycin was supplied by Sigma (St. Louis, MO). Synthesis of BMS-591348 has been described previously (compound 11a in Li et al., 2004Go). A research sample of ABT-229 was kindly provided by Abbott Laboratories (Abbott Park, IL).

Construction of the Expression Vector pMR-EGFP. Human motilin receptor cDNA (MR; GenBank accession NM_001507 [GenBank] ) was amplified by polymerase chain reaction using the following primer set to introduce two restriction sites (EcoRI and BamHI) at the 5' and 3' ends, respectively: CCGGAATTCATGGGCAGCCCCTGGAAC and CGCGGATCCCATCGTCTTCACGTTAGC. The PCR product was cloned into the TA cloning vector pCR2.1 (Invitrogen, Carlsbad, CA), digested with EcoRI and BamHI (Invitrogen), and inserted into the expression vector pEGFP-N3 (BD Biosciences Clontech) previously digested with the same restriction enzymes. The sequence was confirmed by DNA sequencing. Plasmid purification was performed using the Endotoxin free maxi preparation kit (QIAGEN, Valencia, CA).

Cell Culture. Human embryonic kidney (HEK) 293 cells (American Tissue Culture Collection, Manassas, VA) were grown in Dulbecco's modified Eagle medium (Dulbecco's modified Eagle's medium; Mediatech Inc., Herndon, VA) supplemented with 10% fetal bovine serum (Mediatech Inc.), 1x essential amino acids (Mediatech Inc.), and 1.0 mM sodium pyruvate (Mediatech Inc.). Cells were grown at 37°C in a humidified atmosphere with 5% CO2.

Stable Expression of MR-GFP in HEK-293 Cells. Cells (5 x 106) were grown overnight onto poly-D-lysine–coated 100-mm plates (BD Biosciences, San Jose, CA). Cells were transfected with 12.5 µg of purified plasmid DNA and 50 µl of Lipofectamine 2000 in 1000 µl of media as described in the manufacturer's instructions. Forty-eight hours after transfection, cells were split onto three plates; 24 h later, selection was applied via addition of 400 µg/ml G-418 (Geneticin; Invitrogen). Transfected cells were maintained for 2 weeks in selection media containing 400 µg/ml G-418. MR-GFP–expressing cells were identified by epifluorescence microscopy and sorted by flow cytometry. Selected cells were pooled and expanded, yielding a polyclonal population containing less than 1% cells that were not expressing MR-GFP.

Motilin Membrane Binding Assay. Membranes were prepared from HEK-293 cells expressing MR-GFP and HeLa-MR9 cells expressing wild-type MR (Li et al., 2004Go) by homogenization in 50 mM Tris-HCl buffer, pH 7.4, containing 10 mM MgCl2, 1 mM EGTA, 10% glycerol, 1 mM phenylmethylsulfonyl fluoride, and 1 mg/l aprotinin in a Polytron homogenizer (Kinematica, Basel, Switzerland) at 13,000 rpm for 2 min followed by centrifugation at 740g for 15 min and centrifugation of the supernatant at 140,000g for 30 min. The membrane pellet was washed, recentrifuged, and suspended in homogenization buffer. Binding of motilin to these membranes was assayed by homogeneous scintillation proximity assay (SPA). To each well of a 96-well OptiPlate (PerkinElmer Life and Analytical Sciences, Boston, MA), 50 µl of 2x assay buffer (50 mM Tris-HCl, pH 7.6, 5 mM MgCl2, 50 mM NaCl, 1 mM phenylmethylsulfonyl fluoride, 5 mM KCl, 0.1% bovine serum albumin, and 2 mM CHAPS); 20 µl of cell membranes (2.5 µg); 15 µl of 10x 125I-motilin (specificity, 2000 Ci/mmol, increasing concentrations; GE Healthcare, Little Chalfont, Buckinghamshire, UK); 15 µl of buffer or unlabeled motilin (1000x, for nonspecific binding); 0.5 mg of wheat germ agglutinin-coated polyvinyltoluene SPA beads (GE Healthcare) in 50 µl of 1x assay buffer were added. Contents in 150 µl of total volume were incubated at room temperature overnight. Plate was counted in a TopCount liquid scintillation counter (PerkinElmer Life and Analytical Sciences) for 1 min/well to determine the radioactive ligand bound to the receptor.

Internalization Assay. HEK-293 cells expressing MR-GFP were seeded at a density of 4 x 104 cells into black-walled, clear view, glass-bottomed, 96-well plates coated with poly-D-lysine (BD Biosciences) and grown overnight. The cells were incubated at 37°C with synthetic human motilin (American Peptide Company) at the indicated concentrations in assay buffer (HEPES-buffered Dulbecco's modified Eagle's medium; Mediatech Inc.), 1x essential amino acids, 1.0 mM sodium pyruvate, and 0.1% bovine serum albumin). At the time points indicated in the figure legends, cells were washed twice with ice-cold PBS containing calcium and magnesium (Mediatech, Inc.) and then fixed with 4% paraformaldehyde for 15 min at room temperature. Fixation buffer contained 10 µg/ml Hoechst 33342 (Invitrogen) to stain the nuclei. Finally, cells were washed twice with PBS, sealed, and stored at 4°C. Internalization of cell surface receptor was confirmed by confocal laser scanning microscopy (LSM 510; Zeiss GmbH, Jena, Germany) and quantified with a high content screening Array Scan instrument (Cellomics, Inc., Pittsburgh, PA) using a GPCR signaling algorithm (see Quantification of Receptor Internalization). Dose response was assessed by incubating the cells for 45 min at 37°C in 50 µl of assay buffer containing increasing concentrations of motilin. For the internalization time course, cells were incubated at 37°C with 100 nM motilin for 5, 10, 20, 30, and 40 min. To label lysosomes, HEK-293 MR-GFP cells were incubated with 50 nM lysotracker (Invitrogen) for 45 min. To assess the effect of cytoskeletal inhibitors on MR-GFP internalization, HEK-293 MR-GFP cells were primed with 10 µM cytochalasin D or nocodazole (Sigma) for 60 min. The cells were then washed twice with ice-cold PBS and further incubated with 10 or 100 nM motilin for 45 min in the absence of inhibitors.

Redistribution of Internalized MR-GFP to the Plasma Membrane. Cells were incubated 37°C with 10 or 100 nM motilin for 15 min. Internalization of MR-GFP was confirmed by confocal microscopy. Thereafter, cells were washed twice with ice-cold PBS containing calcium and magnesium (Mediatech, Inc.) and placed in assay buffer for 15, 30, 90, or 300 min before fixation.

Confocal Laser Scanning Microscopy. Images were acquired using a Zeiss Axiovert 200 LSM510 confocal microscope workstation equipped with a 63x (numerical aperture, 1.4) objective and argon/krypton laser excitation source. GFP was visualized using standard fluorescein isothiocyanate excitation at 488 nm and a band-pass emission filter at 505 to 550 nm. Texas Red-conjugated lysotracker was visualized using a standard Texas Red excitation filter at 543 nm and a long-path emission filter at 650 nm. Hoechst DNA staining was visualized using a standard UV excitation filter at 364 nm and a band-pass emission filter at 385 to 470 nm. Confocal images (512 x 512 x 8 bits) were acquired by averaging eight scans per line in a series of confocal planes. Three-dimensional images were reconstructed using all of the acquired confocal planes.

Quantification of Receptor Internalization. MR-GFP internalization as a function of ligand exposure was quantified using an HCS Array Scan (Cellomics, Inc.). Images were acquired using a Zeiss Axiovert 200 epifluorescence microscope with a 20x objective embedded in the instrument. A GPCR signaling algorithm package for the Norak Biosciences (Research Triangle Park, NC) beta-arrestin technology was adapted to measure the percentage of cells responding to motilin treatment in each well. The algorithm identifies individual cells (valid objects) based on their Hoechst-labeled nuclei and draws a nuclear mask around each nucleus. Nuclear mask identification is dependent on the nuclear area, length/width ratio, and average of total Hoechst fluorescence intensity. Cellular domains are defined by dilation of each nuclear mask with a user-defined number of pixels, limited by the MR-GFP plasma membrane staining in unstimulated cells. Upon ligand stimulation, internalized MR-GFP vesicles appear as fluorescent spots. Valid MR-GFP Spots are identified by their area, length/width ratio, and fluorescence intensity and must reside within a cellular domain to be counted. To classify cells as responders, nonresponders, or nonidentifiable objects, each valid object is sequentially tested against a set of user-defined thresholds. The total fluorescent spot area per cell has to exceed a minimum value (as defined in unstimulated control cells) to be classified as responder. Cells below that threshold are further analyzed based on their cellular texture. The next threshold is determined by measuring the nonuniformity of MR-GFP distribution in unstimulated cells. Cells that do not qualify as nonresponders are dropped from the selected object count but still count as valid objects (nonidentifiable). The algorithm reports selected object count, valid object count, response phase classification, and percent responders. Percent responders are calculated by the total number of responder cells in a well divided by the selected object count. Ninety-nine percent of valid cells were selected and classified either as responders or nonresponders. Five hundred cells were counted per well, and six replicate wells were measured for each treatment.

Quantification of Ca2+ Signaling (FLIPR-Assay). The stable cell line HeLa-MR9 expressing human motilin receptor was used to measure motilin receptor-induced Ca2+ signaling (Li et al., 2004Go). A detailed description of the fluorescence imaging plate reader (FLIPR) protocol and tachyphylaxis (receptor desensitization) experiments has been reported previously (Li et al., 2004Go).


    Results
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Expression of Motilin Receptor-GFP Chimera in HEK-293 Cells. A GFP-motilin receptor chimera was generated to directly study the agonist-induced cellular trafficking pattern of the human MR. The cDNA for MR was fused N-terminally to an EGFP (MR-GFP) sequence in a mammalian expression vector under the control of the cytomegalovirus promoter. Subsequent transfection of HEK-293 cells, followed by appropriate selection (see Materials and Methods), yielded a stable polyclonal cell population expressing MR-GFP. When analyzed by confocal fluorescence microscopy, HEK-293 MR-GFP cells showed green fluorescence localized to the cell membrane with minimal intracellular accumulation in the absence of ligand (Fig. 1A). Furthermore, stimulation with 100 nM motilin for 45 min resulted in pronounced receptor internalization, manifested by the appearance of intracellular fluorescent spots (Fig. 1B). Control treatments of HEK-293 MR-GFP cells with other peptide ligands such as neurotensin did not induce receptor internalization (data not shown).


Figure 1
View larger version (63K):
[in this window]
[in a new window]
 
Fig. 1. Characterization of MR-GFP chimera stably expressed in HEK-293 cells. Confocal microscopy pictures of stable HEK-293 MR-GFP cells treated with either assay buffer alone (A) or 100 nM motilin (B) for 45 min at 37°C. C, saturation binding of 125I-motilin to HEK-293 MR-GFP membranes (2.5 µg; {circ}) and Hela-MR9 membranes (2.5 µg; {triangledown}) containing wild-type motilin receptor. Binding was determined in a scintillation proximity assay (SPA) by subtracting nonspecific binding in the presence of 1000-fold excess unlabeled motilin from the total binding, and plotted against the radioligand concentration. Values are mean ± S.D. of four experiments in duplicate. The curves were fitted by hyperbola equation in SigmaPlot (Systat Software, Inc., Point Richmond, CA).

 
To determine the affinity of the ligand to MR-GFP and compare it with wild-type MR, a saturation binding experiment with increasing concentrations of 125I-motilin was carried out using an SPA. Membrane fractions were harvested from HEK-293 MR-GFP and HeLa-MR9 cells, a stable cell line expressing wild-type motilin receptor (Li et al., 2004Go). The value determined for the affinity constant (Kd) for wild-type MR and MR-GFP membranes was 4.4 nM, suggesting that motilin binding occurs with similar affinities for both receptors (Fig. 1C). In addition, the value determined for the inhibitory constant (Ki) for motilin in competition binding assays was 11.0 and 9.9 nM for wild-type MR and MR-GFP, respectively (data not shown). Thus, the MR-GFP construct seems to be identical to wild-type MR with respect to motilin binding.

Internalization of the MR-GFP Is Dose-Dependent. Next, the dose dependence of MR-GFP internalization was determined. Cells expressing MR-GFP were treated with assay buffer alone or with buffer containing 2, 5, 10, 50, or 100 nM motilin for 45 min. A dose-dependent increase in intracellular vesicles labeled by MR-GFP was observed, together with a corresponding decrease in fluorescence at the cell surface (Fig. 2A). Maximal receptor internalization was stimulated by 100 nM motilin. Internalization was quantified by assessing the percentage of cells responding to motilin treatment using the Cellomics Array Scan instrument. Incubation with ascending concentrations of motilin (2.5, 5, 50, 80, 160, 320, and 640 nM) resulted in a gradual increase in the number of cells containing intracellular vesicles (responder cells; Fig. 2B). The Cellomics Array Scan data analysis showed that dose-response saturation occurred at 80 nM motilin. The half-maximal effective motilin concentration (EC50) for receptor internalization was 19 nM, which compares well with the Ca2+-signaling EC50 of 9.2 nM reported for a similar MR-GFP chimera (Thielemans et al., 2005Go).


Figure 2
View larger version (36K):
[in this window]
[in a new window]
 
Fig. 2. Internalization of MR-GFP in response to increasing concentrations of motilin. Stable HEK-293 MR-GFP cells were treated in 96-well plates with increasing concentrations of motilin as indicated for 45 min at 37°C. After fixation, cells were visualized by confocal microscopy (A) and subsequently analyzed with the Cellomics Array Scanner to determine the percentage of cells containing internalized MR-GFP molecules (motilin responders; see Materials and Methods). A dose-response curve plotting percentage of responder cells as a function of motilin concentration is shown in B. Each data point represents mean ± S.D. of six replicated wells, counting 500 valid cells per well.

 
Time-Dependent Internalization of MR-GFP. The time course of MR-GFP internalization was determined for a dose that stimulates the maximum response. Cells were incubated in 96-well plates with 100 nM motilin and fixed at 5-min time increments. A time-dependent gradual increase in accumulation of intracellular vesicles was observed within 15 min of ligand exposure (Fig. 3A). Array Scan quantification confirmed that formation of MR-GFP vesicles occurs with motilin application and showed that more cells responded as the exposure time increased (Fig. 3B). After 45 min, 95% of the cells internalized receptor in response to 100 nM motilin.


Figure 3
View larger version (40K):
[in this window]
[in a new window]
 
Fig. 3. Time-dependent internalization of MR-GFP. HEK-293 MR-GFP cells grown overnight in 96-well plates were treated with 100 nM motilin for the indicated periods at 37°C, fixed, and visualized by confocal microscopy (A). Thereafter, cells were subjected to Array Scan analysis and scored for MR-GFP endocytosis (see Materials and Methods). MR-GFP internalization stimulated by 100 nM motilin is plotted as a function of incubation time (B). Each data point represents mean ± S.D. of six replicated wells, counting 500 valid cells per well.

 

Internalized MR-GFP Is Redistributed to the Plasma Membrane. To determine the fate of receptor after internalization, HEK-293 MR-GFP cells were incubated with 10 or 100 nM motilin for 15 min at 37°C. At this time point, internalization of MR-GFP into vesicles is initiated but not maximally stimulated (compare Fig. 3). Thereafter, MR-GFP internalization was stopped by washing out residual ligand. The cells were incubated in assay buffer at 37°C, and the endocytosed MR-GFP population was studied by confocal microscopy at different time points. Initial receptor internalization, stimulated with 10 nM motilin for 15 min, is shown in Fig. 4A (0-min time point). A decrease in fluorescent vesicles occurred within 15 min after ligand withdrawal (Fig. 4A, 15-min time point). These effects were dose-dependent, as shown in Fig. 4B, where treatment with 100 nM motilin resulted in more pronounced receptor internalization. The number of internalized MR-GFP containing vesicles gradually decreased over 30 min after ligand withdrawal, and no vesicles were detectable after 90 min (Fig. 4B).


Figure 4
View larger version (65K):
[in this window]
[in a new window]
 
Fig. 4. Redistribution of internalized MR-GFP upon acute motilin exposure. HEK-293 MR-GFP cells were treated with 10 nM (A) or 100 nM (B) motilin for 15 min at 37°C. Thereafter, cells were washed twice to remove excess ligand and further incubated in assay buffer for the indicated periods before fixation and confocal microscopy analysis. Internalized MR-GFP vesicles disappeared over time and must have either been redistributed to the plasma membrane or degraded in the lysosomal compartment.

 
To determine whether internalized MR-GFP vesicles were targeted for lysosomal degradation, we performed subcellular colocalization experiments upon ligand exposure. HEK-293 MR-GFP cells were coincubated with 100 nM motilin and lysotracker red for 45 min at 37°C before chemical fixing. Thereafter, cross-sections along the z-axis from the bottom to the top of the cells were imaged by confocal microscopy to visualize the appropriate fluorescent signals. Figure 5 shows a cross-section from the top third part of the cell, close to the mid-section (section 31 from a total of 45 slices). The ligand-induced MR-GFP spot pattern (Fig. 5A) was distinct from the lysosomal distribution (Fig. 5B), and the fluorescent signal for lysotracker red did not colocalize with MR-GFP in the respective overlay of both images (Fig. 5C). Furthermore, when the fluorescence intensities for both colors were plotted along a section through the cells (black arrow, Fig. 5C), the respective maximal intensities did not overlap, lending further evidence for a lack of MR-GFP vesicle colocalization with lysosomes. The same result was consistently observed in other cross-sections along the cellular z-axis (data not shown). These results suggests that endocytosed MR-GFP is not targeted for lysosomal degradation under conditions of prolonged exposure to excess ligand. Because internalized MR-GFP vesicles disappear with time after ligand withdrawal (Fig. 4) but fail to colocalize with the lysosomal compartment (Fig. 5), we conclude that MR-GFP molecules are recycled back to the plasma membrane after ligand-induced endocytosis.


Figure 5
View larger version (59K):
[in this window]
[in a new window]
 
Fig. 5. Internalized MR-GFP molecules do not overlap with lysosomal compartments upon motilin exposure. HEK-293 MR-GFP cells were coincubated with 100 nM motilin and 50 mM lysotracker red for 45 min at 37°C before fixation. Shown is a fluorescence microscopy cross-section along the z-axis of the cells (section 30 of 45 sections, each with a thickness of 0.1 µm, from the bottom to the top of the cells). A, MR-GFP staining (green). B, lysotracker red staining (red). C, overlay image of A and B. The maxima of the respective fluorescence intensities are plotted along a cross-section of the cells in C (black arrow), demonstrating minimal overlap of MR-GFP with lysosomal compartments.

 
Microtubules Are Essential for Internalization of MR-GFP. The role of the cytoskeletal network during internalization was investigated using the microtubule-disrupting agent nocodazole and the microfilament inhibitor cytochalasin D. HEK-293 MR-GFP cells were preincubated with nocodazole or cytochalasin D (10 µM) for 60 min before treatment with 10 or 100 nM motilin for 45 min. Preincubation with cytochalasin D had no effect on MR-GFP internalization (data not shown), indicating that microfilaments are not directly involved in MR-GFP endocytosis. However, nocodazole pretreatment for 60 min profoundly disturbed the MR-GFP internalization pattern. After depolymerization of microtubules and stimulation with 10 or 100 nM motilin, MR-GFP-containing vesicles accumulated near the plasma membrane (Fig. 6, B and D, respectively). These MR-GFP-containing vesicles were larger compared with internalization controls without inhibitor (Fig. 6, A and C) and may represent local clusters of ligand-bound MR-GFP molecules that are prevented from budding off the plasma membrane and being internalized. Similar effects of nocodazole on receptor internalization were reported for a parathyroid receptor-GFP chimera (Conway et al., 2001Go).


Figure 6
View larger version (167K):
[in this window]
[in a new window]
 
Fig. 6. Inhibition of MR-GFP internalization by nocodazole. HEK-293 MR-GFP cells were incubated for 60 min at 37°C either with vehicle (A and C) or with 10 µM nocodazole (B and D). Thereafter, cells were treated with 10 nM (A and B) or 100 nM (C and D) motilin for 45 min at 37°C, followed by fixation and confocal microscopy analysis.

 

The Redistribution Time Course of Internalized MR-GFP Varies with Different Agonists. Several compounds have been shown to mediate a pharmacological response through their interaction with the motilin receptor. These include the motilides Erythromycin-A and its derivative ABT-229, as well as a series of novel tetrahydrotriazolopyridazine-based amino acid derivatives (Li et al., 2004Go). An acute ligand exposure experiment was performed to directly visualize how these various agonists affect the redistribution of internalized MR-GFP receptors. Cells were treated for 15 min with an equipotent dose (1000-fold EC50) of each compound to achieve maximal receptor stimulation [150 nM motilin, 400 µM erythromycin A, 4.2 µM ABT-229, and 47 nM BMS-591348 (Li et al., 2004Go)]. Thereafter, excess ligand was removed, and cells were further incubated at 37°C for 0, 15, 30, 90, and 300 min before fixation and confocal microscopy analysis. As shown in Fig. 7, MR-GFP containing vesicles were visible for all compounds after 0 and 15 min of ligand withdrawal. At 30 min, fluorescent vesicles induced by erythromycin-A and motilin had partially disappeared, whereas they persisted in cells treated with ABT-229 and BMS-591348. This effect was even more pronounced 90 min after ligand withdrawal when all MR-GFP-containing vesicles had disappeared in motilin- and erythromycin-treated cells. It is noteworthy that MR-GFP containing vesicles were still apparent in ABT-229–treated cells after a 300-min washout period, in marked contrast to cells treated with the other three compounds (Fig. 7). These results demonstrate that the tested agonists elicit different redistribution rates of internalized MR-GFP molecules when applied at equipotent doses for Ca2+-signaling (EC50), ranking in the following order from slowest to fastest redistribution: ABT-229 > BMS-591348 > motilin > erythromycin.


Figure 7
View larger version (133K):
[in this window]
[in a new window]
 
Fig. 7. Agonist-dependent variability of intracellular MR-GFP trafficking. Maximal internalization of MR-GFP was initiated by incubating HEK-293 MR-GFP cells with excess doses of motilin, erythromycin, ABT-229, or BMS-591348 for 15 min at 37°C (see text for details). After removal of unbound ligand, cells were incubated at 37°C for 0, 15, 30, 90, or 300 min before fixation and confocal microscopy analysis. Note the agonist-dependent differences in receptor redistribution over time.

 

Different Agonists Induce Various Degrees of Motilin Receptor Desensitization (Tachyphylaxis) as a Function of Initial Dose and Recovery-Time. The phenomenon of receptor desensitization, or tachyphylaxis, varies widely among different GPCRs. Significant signaling potency may remain after repeated agonist stimulation; alternatively, reduced ligand potency may result because of receptor uncoupling or internalization (Woolf and Linderman, 2003Go). To further evaluate the effects of MR internalization on its signaling properties, different motilin agonists were tested in a functional assay that measures intracellular Ca2+ concentration using a FLIPR (Li et al., 2004Go). A stable cell line expressing MR was initially treated for 5 min with multiples of the respective EC50 of motilin, erythromycin, ABT-229, or BMS-591348 (Li et al., 2004Go), followed by ligand washout and a variable recovery period. Thereafter, the maximum functional response was measured with a secondary stimulation using a high dose of the respective ligand (100-fold of the EC50). As seen in Fig. 8A, increasing initial doses of motilin resulted in a stepwise reduction of peak Ca2+ responses upon secondary stimulation after a 30-min recovery period. It is noteworthy that maximal MR signaling at secondary stimulation was dependent on the initial dose as well as on the recovery period duration: the highest initial dose of motilin, 100-fold EC50, required the cells to recover for more than 300 min to regain maximal signaling capacity, whereas 1x EC50 required only 30 min. Identical experiments performed with erythromycin, ABT-229, and BMS-591348 showed similar dose dependence for the secondary response to the extent that high initial ligand doses reduced subsequent receptor signaling amplitude (Fig. 8, B, C, and D, respectively). Secondary signaling responses were also time-dependent for all compounds. It is noteworthy that the potent MR agonist ABT-229 showed only ~20% maximal signaling after 24 h when stimulated at 100-fold EC50 (Fig. 8C). These desensitization effects did not correlate with potency because a more potent agonist, BMS-591348, showed ~40% of initial signaling after a 6-h recovery period and achieved maximal initial signaling by 24 h (Fig. 8D). Erythromycin required the shortest recovery period; peak MR signaling was recorded after 30 min, regardless of initial dose (Fig. 8B).


Figure 8
View larger version (39K):
[in this window]
[in a new window]
 
Fig. 8. Agonist-dependent variability of motilin receptor desensitization in FLIPR assays. Primary stimulation (desensitization), HeLa-MR9 cells stably expressing the human motilin receptor were treated for 5 min with multiples of the corresponding EC50 (1x, 2x, 5x, 10x, 50x, and 100x) for either motilin (A), erythromycin (B), ABT-229 (C), or BMS-591348 (D). Secondary stimulation, after subsequent ligand washout and a variable recovery period of 30, 90, 300, or 1440 min, cells were stimulated with a second addition of the respective compound at maximum effective dose (100-fold EC50). The secondary Ca2+ signal was measured in FLIPR experiments and plotted as a percentage of initial response. Bars are ordered according to increasing initial dose from left to right for each recovery interval (blue, 1x EC50; red, 2x EC50; yellow, 5x EC50; green, 10x EC50; dark red, 50x EC50; orange, 100x EC50). Receptor desensitization was dependent on initial ligand dose and recovery time and differed substantially for each agonist.

 

Based on these results, it can be concluded that MR desensitization is dose- and time-dependent. Each agonist showed a distinct receptor desensitization profile, ranking in the following order from strong to weak tachyphylaxis-inducing properties: ABT-229 > BMS-591348 > motilin > erythromycin.


    Discussion
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Regulation of seven-transmembrane receptor signaling and endocytosis has been studied extensively, revealing multiple mechanisms that contribute to the remarkable diversity of physiological responses mediated by small molecule or peptide ligands (von Zastrow, 2003Go). Although a classic model of GPCR internalization has emerged, several receptor-specific variations thereof have been described previously (Pierce et al., 2002Go). Most GPCRs undergo four discernible major phases upon ligand-activation: acute signaling, rapid desensitization, endocytosis, and postendocytic sorting (reviewed in Marchese et al., 2003Go; von Zastrow, 2003Go). First, binding of agonist promotes the release of heterotrimeric G-proteins from the receptor, initiating signaling through the activation of second-messenger pathways (e.g., ion channels, adenylyl cyclase, kinase cascades). Thereafter, receptors are phosphorylated by specific G-protein-coupled receptor kinases leading to the recruitment of beta-arrestins, a family of GPCR signaling regulators (Pierce and Lefkowitz, 2001Go; Luttrell and Lefkowitz, 2002Go). This interaction prevents rebinding of G-proteins and attenuates receptor signaling. Arrestin-bound receptors associate with clathrin-coated pits in specific areas of the plasma membrane and are endocytosed. Finally, receptor vesicles undergo endocytic sorting and may be targeted to a recycling pathway mediating resensitization of receptors or to a lysosomal degradative pathway mediating receptor down-regulation.

Postendocytic sorting information for GPCRs is contained within the cytoplasmic C-terminal tail. For example, the protease-activated receptor-1 (PAR1), normally sorted to lysosomes, was routed to the plasma membrane when fused to the cytoplasmic tail of the recycling substance P receptor (Trejo and Coughlin, 1999Go). Furthermore, it seems that the interaction of beta-arrestin with the receptor determines in part the kinetics of GPCR recycling (Marchese et al., 2003Go). GPCRs can be classified based on whether arrestins travel into endocytic vesicles along with receptors (class B GPCRs), or whether arrestins are confined to the periphery of the cells and do not colocalize with internalized receptors (class A GPCRs). Classic examples of class A receptors are the beta2-adrenergic, dopamine D1a, endothelin, and µ-opioid receptors (Zhang et al., 1999Go; Oakley et al., 2000Go). In contrast, the angiotensin, substance P, neurotensin, thyrotropin-releasing hormone, and vasopressin V2 receptors belong to class B and contain stretches of serine and threonine residues that are proposed to mediate high-affinity arrestin binding upon phosphorylation (Oakley et al., 2001Go). Prolonged association of arrestin with receptors might delay GPCR dephosphorylation and thereby influence the kinetics of receptor resensitization and recycling. Both the angiotensin and vasopressin-V2 receptors recycle very slowly (hours) compared with class A receptors (minutes) (Oakley et al., 1999Go; Anborgh et al., 2000Go). The amino acid sequence of the motilin receptor C-terminal tail does not seem to contain distinct S/T clusters, as described by Oakley et al. (2001Go). Furthermore, coimmunoprecipitation experiments using anti-GFP antibodies failed to detect beta-arrestin in MR-GFP cells that were stimulated with ligand (data not shown). The combination of these observations suggests that MR belongs to the class A recycling receptor family or may internalize via a beta-arrestin-independent mechanism (Pierce et al., 2002Go).

When MR-GFP endocytosis was induced by motilin administration, the internalized fluorescent vesicles disappeared rapidly upon ligand withdrawal (see Fig. 4). Colocalization experiments failed to detect redistribution of MR-GFP vesicles to lysosomes under conditions of long-term motilin exposure (see Fig. 5). Because internalized MR-GFP vesicles disappear over time but are not targeted for degradation via the lysosomal pathway, we conclude that MR-GFP is recycled back to the plasma membrane. Although this is an indirect conclusion, it is consistent with all our observations, including MR-GFP labeling of the plasma membrane after the disappearance of intracellular fluorescent vesicles (Fig. 4, time points 90 and 300 min). However, it is important to consider the large overexpression of MR-GFP in this context. This is exemplified by residual fluorescence staining of the plasma membrane even under conditions of prolonged exposure to excess ligand (see Figs. 1, 2, 3 at 100 nM motilin). This implies the existence of a separate MR-GFP pool that is incapable of being internalized, probably because accessory molecules involved in GPCR endocytosis become limiting under conditions of excess ligand and maximal rate of MR-GFP internalization (e.g., beta-arrestin, G-protein-coupled receptor kinases, or others). Hence, receptor recycling cannot be inferred purely from the occurrence of MR-GFP in the plasma membrane after ligand withdrawal, because this could be explained by a residual receptor population that never entered the cytoplasm. Attempts to label MR-GFP with biotin derivatives at the cell surface failed (data not shown), which may be explained by the complete lack of lysine residues in the extracellular domains of MR. In the absence of further methods to directly corroborate receptor recycling, our experiments provide good evidence that internalized MR-GFP molecules are routed back to the plasma membrane.

A variety of GPCR assays has been developed to screen compound libraries against known and orphan receptors, and most common cell-based assay formats use the GPCR signal transduction pathways to generate a readout of receptor signaling (reviewed in Chalmers and Behan, 2002Go; Cacace et al., 2003Go; Kenakin, 2003Go; Robas et al., 2003Go). These assays are robust and allow the identification of potent and selective ligands but do not offer critical information on receptor trafficking. More recently, the advent of high-content biology has opened possibilities for the development of GPCR assays based on single-cell imaging (Milligan, 2003Go). Generating chimeras between a polypeptide of interest and GFP enables automated image analysis. The increased throughput of these machines, compared with traditional confocal microscopy, allows the quantitative analysis of specific biological processes. Furthermore, assays can be multiplexed by using fluorescent dyes or proteins with distinct emission properties (Abraham et al., 2004Go). In this study, an internalization assay was developed by tagging motilin receptor with a C-terminal GFP moiety. This strategy did not seem to substantially alter MR sensitivity to ligand (Fig. 1C) or internalization after stimulation (Thielemans et al., 2005Go), similar to reports for other GPCRs (Kallal et al., 1998Go; Milligan, 1999Go; Kallal and Benovic, 2000Go). Its primary advantage is that it enables automated analysis of receptor endocytosis directly as opposed to indirect methods that follow GPCR trafficking via the redistribution of beta-arrestin-GFP chimeras (Oakley et al., 2002Go). Furthermore, it is relevant that the assay performed reproducibly on different cell populations, as illustrated by the small variation within six replicates of 500 cells counted per well (Figs. 2B and 3B). Finally, the assay is amenable to 96- or 384-well format, achieving respectable throughput sufficient for a secondary screen for use during the lead optimization phase of the drug discovery process.

Motilin receptor represents an attractive drug target for the treatment of functional gastrointestinal disorders (Chovet, 2000Go; Camilleri, 2002Go; Sanger and Hicks, 2002Go; Maganti et al., 2003Go). However, the clinical utility of long-term MR agonist administration has been limited by the lack of efficacy after prolonged exposure, as demonstrated by ABT-229 (Talley et al., 2000Go). It is possible that MR tachyphylaxis was the primary cause for lack of efficacy, although gastroparesis clinical trials have been criticized for their small sample sizes, uncontrolled designs, short duration, and inadequate symptom assessment (Tack and Peeters, 2001Go; Camilleri, 2002Go; Maganti et al., 2003Go). Clinical data show that a single dose of ABT-229 strongly increased gastric emptying after the first meal in healthy volunteers, but no effect was observed after the second meal despite the presence of considerable residual drug concentrations in the serum (Verhagen et al., 1997Go). Such clinical evidence of functional motilin receptor desensitization has been reproduced in cell cultures using ABT-229 and other agonists (Li et al., 2004Go). More recently, by conducting a series of elegant structure-activity relationship experiments, Thielemans et al. (2005Go) were able to identify a specific hydroxyl group within the ABT-229 molecule that seems to mediate the majority of its MR-desensitizing properties. Furthermore, the authors demonstrated that agonist potency alone is not the sole determinant for its ability to desensitize, internalize, and resensitize the motilin receptor (Thielemans et al., 2005Go). The results presented herein are consistent with these findings, demonstrating that ligand potency and tachyphylaxis properties are not necessarily linked; instead, we find a correlation between prolonged receptor internalization, delayed redistribution to the plasma membrane and tachyphylaxis. Since EC50 values are a composite of ligand affinity and efficacy, it may be important to deconvolute these properties by measuring true receptor affinity and occupancy. MR internalization and intracellular trafficking are influenced by ligand on- and off-rates, both at the cell surface as well as in endocytic vesicles. Radiolabeling of compounds may generate tools to further investigate this complex relationship.

In conclusion, our in vitro results provide evidence that intracellular trafficking of identical motilin receptor molecules varies substantially with different ligands according to their distinct agonist properties. It is noteworthy that considering the clinical importance of tachyphylaxis for this specific drug target, our findings support accumulating evidence that it is possible to discover potent motilin receptor agonist leads with reduced receptor desensitization properties in vitro compared with ABT-229. Finally, the results emphasize the utility of a high content internalization assay as an appropriate secondary screen to facilitate the development of MR agonists with sustained efficacy, which will hopefully minimize clinical trial failure in the near future.


    Acknowledgements
 
We thank Abbott Laboratories for a research sample of ABT-229.


    Footnotes
 
Article, publication date, and citation information can be found at http://molpharm.aspetjournals.org.

doi:10.1124/mol.105.017111.

ABBREVIATIONS: GI, gastrointestinal; ABT-229, 6,9-hemiacetal 8,9-anhydro-4''-deoxy-3'-N-desmethyl-3'-N-ethylerythromycin B; GM-611, mitemcinal fumarate; MR, motilin receptor; BMS-591348, N-[(1S)-1-[[[(1S)-1-(aminocarbonyl)-3-phenylpropyl]amino]carbonyl]-3-phenylpropyl]-2'-(1,3-benzodioxol-5-ylmethyl)tetrahydro-1',3'-dioxo-spiro[piperidine-4,5'(6'H)-[1H][1,2,4]triazolo[1,2-a]pyridazine]-8'-carboxamide; HEK, human embryonic kidney; GFP, green fluorescent protein; SPA, scintillation proximity assay; CHAPS, 3-[(3-cholamidopropyl)dimethylammonio]propanesulfonate; PBS, phosphate-buffered saline; GPCR, G-protein-coupled receptor; FLIPR, fluorescence imaging plate reader.

Address correspondence to: Dr. Yves Dubaquie, Bristol-Myers Squibb Medical Imaging, 331 Treble Cove Rd, North Billerica, MA 01862. E-mail: yves.dubaquie{at}bms.com


    References
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Abraham VC, Taylor DL, and Haskins JR (2004) High content screening applied to large-scale cell biology. Trends Biotechnol 22: 15–22.[CrossRef][Medline]

Anborgh PH, Seachrist JL, Dale LB, and Ferguson SS (2000) Receptor/beta-arrestin complex formation and the differential trafficking and resensitization of beta2-adrenergic and angiotensin II type 1A receptors. Mol Endocrinol 14: 2040–2053.[Abstract/Free Full Text]

Cacace A, Banks M, Spicer T, Civoli F, and Watson J (2003) An ultra-HTS process for the identification of small molecule modulators of orphan G-protein-coupled receptors. Drug Discov Today 8: 785–792.[CrossRef][Medline]

Camilleri M (2002) Drugs targeting functional bowel disorders: lessons from drug trials. Curr Opin Pharmacol 2: 684–690.[CrossRef][Medline]

Chalmers DT and Behan DP (2002) The use of constitutively active GPCRs in drug discovery and functional genomics. Nat Rev Drug Discov 1: 599–608.[CrossRef][Medline]

Chovet M (2000) Gastrointestinal functional bowel disorders: new therapies. Curr Opin Chem Biol 4: 428–432.[CrossRef][Medline]

Conway BR, Minor LK, Xu JZ, D'Andrea MR, Ghosh RN, and Demarest KT (2001) Quantitative analysis of agonist-dependent parathyroid hormone receptor trafficking in whole cells using a functional green fluorescent protein conjugate. J Cell Physiol 189: 341–355.[CrossRef][Medline]

Feighner SD, Tan CP, McKee KK, Palyha OC, Hreniuk DL, Pong SS, Austin CP, Figueroa D, MacNeil D, Cascieri MA, et al. (1999) Receptor for motilin identified in the human gastrointestinal system. Science (Wash DC) 284: 2184–2188.[Abstract/Free Full Text]

Ferguson SS (2001) Evolving concepts in G protein-coupled receptor endocytosis: the role in receptor desensitization and signaling. Pharmacol Rev 53: 1–24.[Abstract/Free Full Text]

Kallal L and Benovic JL (2000) Using green fluorescent proteins to study G-protein-coupled receptor localization and trafficking. Trends Pharmacol Sci 21: 175–180.[CrossRef][Medline]

Kallal L, Gagnon AW, Penn RB, and Benovic JL (1998) Visualization of agonist-induced sequestration and down-regulation of a green fluorescent protein-tagged beta2-adrenergic receptor. J Biol Chem 273: 322–328.[Abstract/Free Full Text]

Kenakin T (2003) Predicting therapeutic value in the lead optimization phase of drug discovery. Nat Rev Drug Discov 2: 429–438.[CrossRef][Medline]

Lartey PA, Nellans HN, Faghih R, Petersen A, Edwards CM, Freiberg L, Quigley S, Marsh K, Klein LL, and Plattner JJ (1995) Synthesis of 4''-deoxy motilides: identification of a potent and orally active prokinetic drug candidate. J Med Chem 38: 1793–1798.[CrossRef][Medline]

Li JJ, Chao HG, Wang H, Tino JA, Lawrence RM, Ewing WR, Ma Z, Yan M, Slusarchyk D, Seethala R, et al. (2004) Discovery of a potent and novel motilin agonist. J Med Chem 47: 1704–1708.[CrossRef][Medline]

Luttrell LM and Lefkowitz RJ (2002) The role of beta-arrestins in the termination and transduction of G-protein-coupled receptor signals. J Cell Sci 115: 455–465.[Abstract/Free Full Text]

Maganti K, Onyemere K, and Jones MP (2003) Oral erythromycin and symptomatic relief of gastroparesis: a systematic review. Am J Gastroenterol 98: 259–263.[Medline]

Marchese A, Chen C, Kim YM, and Benovic JL (2003) The ins and outs of G protein-coupled receptor trafficking. Trends Biochem Sci 28: 369–376.[CrossRef][Medline]

McKee KK, Tan CP, Palyha OC, Liu J, Feighner SD, Hreniuk DL, Smith RG, Howard AD, and Van der Ploeg LH (1997) Cloning and characterization of two human G protein-coupled receptor genes (GPR38 and GPR39) related to the growth hormone secretagogue and neurotensin receptors. Genomics 46: 426–434.[CrossRef][Medline]

Milligan G (1999) Exploring the dynamics of regulation of G protein-coupled receptors using green fluorescent protein. Br J Pharmacol 128: 501–510.[CrossRef][Medline]

Milligan G (2003) High-content assays for ligand regulation of G-protein-coupled receptors. Drug Discov Today 8: 579–585.[CrossRef][Medline]

Netzer P, Schmitt B, and Inauen W (2002) Effects of ABT-229, a motilin agonist, on acid reflux, oesophageal motility and gastric emptying in patients with gastrooesophageal reflux disease. Aliment Pharmacol Ther 16: 1481–1490.[CrossRef][Medline]

Oakley RH, Hudson CC, Cruickshank RD, Meyers DM, Payne RE Jr, Rhem SM, and Loomis CR (2002) The cellular distribution of fluorescently labeled arrestins provides a robust, sensitive and universal assay for screening G protein-coupled receptors. Assay Drug Dev Technol 1: 21–30.[CrossRef][Medline]

Oakley RH, Laporte SA, Holt JA, Barak LS, and Caron MG (1999) Association of beta-arrestin with G protein-coupled receptors during clathrin-mediated endocytosis dictates the profile of receptor resensitization. J Biol Chem 274: 32248–32257.[Abstract/Free Full Text]

Oakley RH, Laporte SA, Holt JA, Barak LS, and Caron MG (2001) Molecular determinants underlying the formation of stable intracellular G protein-coupled receptor-beta-arrestin complexes after receptor endocytosis. J Biol Chem 276: 19452–19460.[Abstract/Free Full Text]

Oakley RH, Laporte SA, Holt JA, Caron MG, and Barak LS (2000) Differential affinities of visual arrestin, beta arrestin1 and beta arrestin2 for G protein-coupled receptors delineate two major classes of receptors. J Biol Chem 275: 17201–17210.[Abstract/Free Full Text]

Peeters TL (2001) GM-611 (Chugai Pharmaceutical). Curr Opin Investig Drugs 4: 555–557.

Peeters T, Matthijs G, Depoortere I, Cachet T, Hoogmartens J, and Vantrappen G (1989) Erythromycin is a motilin receptor agonist. Am J Physiol 257: G470–G474.[Medline]

Pierce KL and Lefkowitz RJ (2001) Classical and new roles of beta-arrestins in the regulation of G-protein-coupled receptors. Nat Rev Neurosci 2: 727–733.[CrossRef][Medline]

Pierce KL, Premont RT, and Lefkowitz RJ (2002) Seven-transmembrane receptors. Nat Rev Mol Cell Biol 3: 639–650.[CrossRef][Medline]

Robas N, O'Reilly M, Katugampola S, and Fidock M (2003) Maximizing serendipity: strategies for identifying ligands for orphan G-protein-coupled receptors. Curr Opin Pharmacol 3: 121–126.[CrossRef][Medline]

Sanger GJ and Hicks GA (2002) Drugs targeting functional bowel disorders: insights from animal studies. Curr Opin Pharmacol 2: 678–683.[CrossRef][Medline]

Tack J and Peeters T (2001) What comes after macrolides and other motilin stimulants? Gut 49: 317–318.[Free Full Text]

Talley NJ, Verlinden M, Snape W, Beker JA, Ducrotte P, Dettmer A, Brinkhoff H, Eaker E, Ohning G, Miner PB, et al. (2000) Failure of a motilin receptor agonist (ABT-229) to relieve the symptoms of functional dyspepsia in patients with and without delayed gastric emptying: a randomized double-blind placebo-controlled trial. Aliment Pharmacol Ther 14: 1653–1661.[CrossRef][Medline]

Thielemans L, Depoortere I, Perret J, Robberecht P, Liu Y, Thijs T, Carreras C, Burgeon E, and Peeters TL (2005) Desensitization of the human motilin receptor by motilides. J Pharmacol Exp Ther 313: 1397–1405.[Abstract/Free Full Text]

Trejo J and Coughlin SR (1999) The cytoplasmic tails of protease-activated receptor-1 and substance P receptor specify sorting to lysosomes versus recycling. J Biol Chem 274: 2216–2224.[Abstract/Free Full Text]

Vantrappen G and Peeters TL (1989) Motility and circulation, in Handbook of Physiology (Schultz SG, Wood JD, and Rauner BB eds) pp 545–558, sect. 6, 2nd ed., vol.1: The Gastrointestinal System. American Physiological Society, Bethesda, MD.

Verhagen MA, Samsom M, Maes B, Geypens BJ, Ghoos YF, and Smout AJ (1997) Effects of a new motilide, ABT-229, on gastric emptying and postprandial antroduodenal motility in healthy volunteers. Aliment Pharmacol Ther 11: 1077–1086.[CrossRef][Medline]

von Zastrow M (2003) Mechanisms regulating membrane trafficking of G protein-coupled receptors in the endocytic pathway. Life Sci 74: 217–224.[CrossRef][Medline]

Woolf PJ and Linderman JJ (2003) Untangling ligand induced activation and desensitization of G-protein-coupled receptors. Biophys J 84: 3–13.[Medline]

Zhang J, Barak LS, Anborgh PH, Laporte SA, Caron MG, and Ferguson SS (1999) Cellular trafficking of G protein-coupled receptor/beta-arrestin endocytic complexes. J Biol Chem 274: 10999–11006.[Abstract/Free Full Text]





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
mol.105.017111v1
69/1/109    most recent
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lamian, V.
Right arrow Articles by Dubaquie, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lamian, V.
Right arrow Articles by Dubaquie, Y.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
All ASPET Journals Molecular Pharmacology Pharmacological Reviews
 Molecular Interventions Drug Metabolism and Disposition

Copyright © 2006 by the American Society for Pharmacology and Experimental Therapeutics