![]() |
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Department of Environmental and Molecular Toxicology, Marine and Freshwater Biomedical Sciences Center, Environmental Health Sciences Center, Oregon State University, Corvallis, Oregon
Received August 15, 2005; accepted October 7, 2005
| Abstract |
|---|
|
|
|---|
Although AHR-driven transcriptional regulation has been extensively studied, the mechanism by which TCDD causes toxicity is not fully understood. The development of in vivo models to explore the complexity of AHR signal transduction is essential. Adult zebrafish have the remarkable capacity to regenerate their caudal fins completely within 14 days after amputation (Geraudie et al., 1995
), and it was previously demonstrated that TCDD inhibits this complex process (Zodrow and Tanguay, 2003
). Recently, it was reported that the caudal fin primordia of zebrafish larvae are also capable of tissue regeneration in a process remarkably similar to that observed in adults (Kawakami et al., 2004
). In the larval fin, within 10 min of amputation, epithelial cells surrounding the amputation plane begin to migrate over the wound site. These epithelial cells accumulate to form a compact wound epithelium by 24 h postamputation (hpa). Actively proliferating mesenchymal cells denoted as blastema cells are evident in the area adjacent to the amputation plane by 24 to 48 hpa. After blastema formation, both the adult and larval regenerating fins exhibit a common cell proliferation profile, with the proliferation starting at the distal area (posterior to the amputation plane). The distal-most cells do not proliferate during the late phase of repair; instead, drastic cell proliferation occurs in the proximal (anterior to the amputation plane) region. In addition to the similar regenerative events between adults and larvae, fibroblast growth factor (FGF) signaling is necessary during fin regeneration, suggesting a common regenerative molecular mechanism (Poss et al., 2000b
; Kawakami et al., 2004
).
Studies in adult fin regeneration were limited by barriers in molecular and genetic techniques, which motivated us to develop a larval model to evaluate the consequence of AHR activation on early life stage regeneration. The objectives of this study were to first determine whether TCDD impairs larval fin regeneration and then to determine which AHR pathway members mediate the response. Our observations demonstrate that TCDD specifically impedes larval fin regeneration. Activation of the AHR pathway was confirmed by immunohistochemical localization of induced cytochrome P4501A (zfCYP1A), a well-studied AHR-responsive gene. Antisense knockdown and mutant zebrafish lines demonstrate that zfAHR2 and zARNT1 are both required for the TCDD-dependent block in regenerative growth. We also demonstrate that the inhibitory effects of TCDD exposure and FGF receptor antagonism on regeneration are distinct. In addition to the inherent advantages of zebrafish (i.e., rapid development and fecundity), the larval zebrafish model allows the use of many additional molecular and genetic techniques, such as transient and stable transgenics, mutant screens, and antisense gene repression. Thus, the larval zebrafish is an outstanding model to unravel tissue regeneration mechanisms.
| Materials and Methods |
|---|
|
|
|---|
Amputation of Zebrafish Larval Fin Primordia and Chemical Exposure. Embryos were dechorionated and anesthetized with 0.008% 3-amino benzoic acid ethylester (tricaine) in fish water. At 48-h postfertilization (hpf), larvae were placed on an agar plate, and the caudal fin primordia was amputated with a surgical razor blade just posterior to the notochord and transferred to a 24-well plate containing chemical-free fish water. TCDD (>99% pure) was purchased from Chemsyn (Lenexa, KS);
-naphthoflavone (BNF, >99% pure) was obtained from Acros Organics (Morris Plains, NJ) and
-naphthoflavone (ANF) from Sigma-Aldrich (St. Louis, MO). The amputated larvae (48 hpf) were exposed to vehicle (0.3% DMSO) or TCDD in vehicle (0.5 ng/ml of fish water) in a 24-well plate for 1 h. After incubation, the embryos were rinsed multiple times and allowed to develop for 3 days in vehicle/TCDD-free water at 27°C. Because BNF and ANF (both 0.3 µg/ml) were not soluble in DMSO, these ligands were dissolved in dimethyl formamide. ANF and BNF exposures were conducted in 24-well plates for 24 h, followed by multiple rinses in water. After exposure to ANF and BNF, the larvae were reared for 3 days at 27°C in ANF- and BNF-free water. The FGFR1 inhibitor (SU5402) was purchased from Calbiohem (San Diego, CA). The amputated larvae were exposed to SU5402 at a final concentration of 5 µM for 1 day, followed by multiple rinses with fish water.
Reverse Transcription Polymerase Chain Reaction. The caudal fin primordia of 48-hpf larvae were amputated, and the animals were exposed to vehicle or TCDD in vehicle (0.5 ng/ml of fish water) for 1 h. After multiple rinses in TCDD-free water, the embryos were reared at 27°C. Regenerating fins were surgically amputated again at 3 dpa just posterior to the notochord. The amputated regenerating fins were directly immersed into TRI reagent (Molecular Research Center, Cincinnati, OH), and RNA was isolated as described previously (Tanguay et al., 1999
). Reverse transcription reactions were carried out using 100 ng of total RNA, 500 ng of Oligo dT12-18 primer, and 1 mM dNTPs. The mixture was heated to 65°C for 5 min and quick-chilled on ice. The 20-µl reaction contained 1x first-strand buffer (50 mM Tris-HCl, pH 8.3, 75 mM KCl, and 3 mM MgCl2), 0.01 M dithiothreitol, 40 units of RNaseOUT, and 200 units of SuperScript II Reverse Transcriptase (Invitrogen, Carlsbad, CA). This reaction was incubated at 42°C for 50 min followed by inactivation at 70°C for 15 min. Each 50-µl PCR reaction contained a 2-µl aliquot of cDNA as the template; 0.2 mM each of dNTPs; 10x PCR buffer; 1 mM MgSO4; 0.2 µM forward and reverse primers for either AHR1, AHR2, ARNT1, ARNT2b/c, CYP1A, or
-actin (Table 1); and 1.0 unit of KOD Hot Start DNA polymerase (Novagen, San Diego, CA). The reactions were run in a PTC-100 Peltier thermal cycler (MJ Research, South San Francisco, CA) at the following conditions: 94°C for 20 s, 58°C for 30 s, and 72°C for 80 s, for a total of 35 cycles. The PCR products were resolved by electrophoresis through a 2% agarose gel and visualized by ethidium bromide staining.
|
Morpholinos. Zebrafish aryl hydrocarbon receptor 2 morpholino (zfahr2-MO) (Gene Tools, Corvallis, OR) targeted the translation start site beginning 4 bp upstream of the AUG codon to 18 bp downstream of the sequence. The sequence of the zfahr2-MO was 5'TGTACCGATACCCGCCGACATGGTT3' and the 3'-end was fluorescein tagged to assess microinjection success. Morpholinos were diluted to 2.8 mM in 1x Danieau's solution [58 mM NaCl, 0.7 mM KCl, 0.4 mM MgSO4, 0.6 mM Ca(NO3)2, and 5 mM HEPES, pH 7.6], as described previously (Nasevicius and Ekker, 2000
). Zebrafish aryl hydrocarbon receptor nuclear translocator 1 morpholino (zfarnt1-MO) (5'-GGATTAGCTGATGTCATGTCCGACA-3') overlapped the translation start site of zfARNT1 mRNA, starting 8 bp upstream of the AUG start codon to 14 bp downstream of the sequence. The morpholinos were diluted to 1.5 mM in 1x Danieau's solution before microinjection. A standard control morpholino (Gene Tools) (5'-CTCTTACCTCAGTTACAATTTATA-3') was used as a control morpholino (Control-MO). The embryos were injected at the one- to two-cell stage with approximately 1 to 3 nl of the appropriate morpholino solution. Embryos were screened for fluorescence at 24 hpf to reveal successful injection. The caudal fin of selected embryos were amputated and exposed to TCDD or vehicle for 1 h at 48 hpf. The morpholino injected embryos (morphants) were raised for 3 days after amputation, and the regeneration of fin tissue was observed.
Genotyping of zfarnt2 Mutants. Embryonic DNA was extracted from individual embryos in extraction buffer (0.01 M Tris, 2 mM EDTA, 0.2% Triton-X, and 0.2 mg/ml proteinase-K) incubated at 55°C for 2.5 h. The extract was heated at 100°C for 10 min before centrifugation, and the supernatant was used as the DNA template for PCR. The primers used were zfARNT2F1, zfARNT2R1, and TranspoR. zfARNT2F1 and zfARNT2R1 flank the knockout viral insertion, and TranspoR lies within the transposon insert. zfARNT2F1 and zfARNT2R1 were designed to distinguish zfarnt2-/- mutants from wild-type (WT) and from heterozygous (HET) larvae, whereas zfARNT2F1 and TranspoR were used to distinguish WT from HET larvae. PCR was performed to amplify the appropriate sequence using KOD Hot Start DNA polymerase, and the PCR products were examined by gel electrophoresis and ethidium bromide staining.
Whole-Mount Immunolocalization of zfCYP1A and
-Acetylated Tubulin. The distribution of zfCYP1A protein in zebrafish larval fin tissue was assessed using the monoclonal antibody C107 (mouse anti-CYP1A, 1:500; Biosense Laboratories, Bergen, Norway). Monoclonal antibodies generated against acetylated tubulin (mouse anti-AT, 1:1000; Sigma) label most axons and major peripheral processes in the developing embryo. On 3 dpa, TCDD exposed and control larvae were fixed overnight in 4% paraformaldehyde in phosphate-buffered saline (PBS) and washed in PBS + 0.1% Tween 20 (PBST). The larvae were permeablized with 0.005% trypsin (4°C) in PBS on ice for 5 min, rinsed in PBST, and postfixed in 4% paraformaldehyde. Permeablized larvae were blocked in 10% normal goat serum in PBS + 0.5% Triton X-100 for an hour at 22°C and incubated with the primary antibody overnight at 4°C in 1% normal goat serum-PBS + 0.5% Triton X-100. After 4 x 30-min washes in PBST, the larvae were incubated with a secondary antibody (1:1000) (Alexa-546 conjugated goat anti-mouse; Invitrogen) for 5 h at 22°C. The larvae were then washed 4x for 30 min in PBST and visualized by epifluorescence microscopy.
Statistical Analysis. Each experiment was composed of 12 larvae per group. The larvae were exposed to vehicle or chemical with two larvae in each well. Significant difference in the area and length between the control and TCDD-exposed animals was assessed by Student's t test (p < 0.05) using SigmaStat 2.03 software (SPSS Inc., Chicago, IL).
| Results |
|---|
|
|
|---|
|
|
To quantify the growth response, the length of maximum outgrowth, the area of regenerated fin tissue (%), and the area of nonamputated fin tissue (%) were measured as depicted in the schematic diagram (Fig. 3A). The length of maximum outgrowth is defined as the distance from the plane of amputation to the tip of the regenerating fin. The area of regenerated fin tissue represents the newly grown ventral fin tissue after partial amputation. The area of the intact dorsal half of the fin was used to determine whether TCDD impacts nonregenerative fin development. The length of maximum outgrowth and the area of regenerated fin tissue (%) in TCDD-exposed larvae were significantly lower compared with the control larvae (Fig. 3, B and C). Surprisingly, the increase in the area of nonamputated fin tissue (%) from 0 to 3 dpa in TCDD-exposed larvae was significantly greater than the control larvae (Fig. 3D). Together, these results establish that TCDD specifically inhibits the growth of regenerating tissue. It is also important to emphasize that normal fin development and growth are not impeded by TCDD unless the fin is amputated.
|
Detection of AHR Pathway Members in the Regenerating Fin Tissue. To determine the expression profile of AHR members and regulated genes in the larval regenerating fin tissue, RNA was isolated from the regenerating fin tissue of DMSO- or TCDD-exposed larvae at 3 dpa. Reverse transcriptase-polymerase chain reaction was performed using gene-specific primers for zfAHR1, zfAHR2, zfARNT1, zfARNT2b/c, zfCYP1A, and
-actin as a control. The transcripts of zfahr1, zfahr2, zfarnt1, and zfcyp1a were expressed in both DMSO- and TCDD-exposed larval regenerating fin tissue, but the expression of zfarnt2b/c was faint (Fig. 4). Even though this method is nonquantitative, zfcyp1a transcript level observed in the TCDD-exposed fin tissue was apparently increased over DMSO levels, suggesting that AHR pathway is active in regenerating fin tissue.
|
|
|
AHR2 Is Necessary for TCDD to Impede Fin Regeneration. With the availability of the nearly complete zebrafish genomic sequence and the ability to use antisense modified oligonucleotides (morpholinos), the role of any protein in a biological process can be rapidly evaluated in vivo using zebrafish embryos or larvae (Nasevicius and Ekker, 2000
). Morpholinos have been shown to be most effective between 0 and 96 hpf. Higher concentrations of morpholino (2.8 mM) can be used to prolong the repression of target genes up to 120 hpf (data not shown). The zfAHR2 and control morphants were amputated and exposed to vehicle or TCDD at 48 hpf and were grown for 3 days. The control and zfAHR2 morphants exposed to vehicle regenerated completely, indicating that the endogenous functions of zfAHR2 are not required for regeneration. As expected, the control morphants exposed to TCDD failed to regenerate (Fig. 7A). The caudal fins in zfAHR2 morphant animals exposed to TCDD were capable of complete regeneration, indicating that inhibition of fin regeneration by TCDD is mediated through zfAHR2 (Fig. 7A). In other words, in the absence of zfAHR2, TCDD has no effect on tissue regeneration. It is noteworthy that the zfAHR2 morphants also failed to develop other signs of TCDD toxicity, including pericardia edema, yolk sac edema, and reduced blood flow, as previously detailed (Prasch et al., 2003
). Immunohistochemical analysis was performed on the control and zfAHR2 morphants exposed to vehicle and TCDD to monitor in situ zfCYP1A protein expression. zfCYP1A was not detected in either control or zfAHR2 morphants exposed to vehicle (data not shown). Control morphants had significant vascular and extravascular zfCYP1A expression, and in zfAHR2 morphants, zfCYP1A protein was not detected, indicating complete and persistent knockdown of AHR2 (Fig. 7B). These results confirm that AHR pathway cannot be activated by TCDD in the absence of AHR2.
|
ARNT1, Not ARNT2, Is Required for Inhibition of Fin Regeneration by TCDD. Because there are at least two ARNT genes expressed in the early embryo, zfARNT1 and zfARNT2, it was important to determine which ARNT is the in vivo partner for zfAHR2 that is necessary to block tissue regeneration. A genetic approach was used to specifically evaluate the role of zfARNT2. Insertional mutagenesis screens had identified previously zebrafish mutants that lacked ARNT2 expression (Amsterdam et al., 1999
). These mutants were generously provided by Dr. Nancy Hopkins (Massachusetts Institute of Technology, Cambridge, MA). Embryos collected from zfarnt2+/- (HET) parents were raised to 48 hpf, and 40 larvae were amputated and exposed to TCDD. In this pool of larvae, 25% should be zfarnt2+/+ (WT), 50% should be zfarnt2+/- (HET), and 25% should be zfarnt2-/- mutants. TCDD completely inhibited the fin regeneration in all of the larvae, irrespective of the ARNT2 genetic status (Fig. 8A). Genotyping of individual larvae were conducted with PCR to determine the larval genetic makeup (Fig. 8A).
|
To determine the role of zfARNT1 in fin regeneration, morpholinos were used to knockdown early life stage zfARNT1 protein expression. Control and zfARNT1 morphants were amputated at 48 hpf, followed by a waterborne exposure to vehicle or TCDD. The amputated larvae were allowed to regenerate their fins for 3 days. The control morphants exposed to TCDD displayed impaired fin regeneration, whereas the zfARNT1 morphants were able to completely regenerate their fins in the presence of TCDD (Fig. 8C). In situ immunolocalization of zfCYP1A protein confirms that zfCYP1A is highly induced in control morphants exposed to TCDD, whereas the zfARNT1 morphants had a significant decrease in the CYP1A expression (Fig. 8D). Together, these results indicate that ARNT1 is a necessary in vivo dimerization partner for AHR2, which together initiate a process that inhibits tissue regeneration.
Morphometrically, TCDD- and FGFR1-Mediated Inhibition of Fin Regeneration Are Different. It is clear that AHR activation impairs or interferes with signaling pathways required for tissue regeneration, but these downstream targets remain unknown. To begin to understand the underlying cellular responses, the effects of TCDD were compared with the effects of another chemical known to impact regeneration. Inhibition of fibroblast growth factor receptor 1 (FGFR1) by a lipophilic drug (SU5402) has been shown to inhibit both adult and larval fin regeneration (Poss et al., 2000b
; Kawakami et al., 2004
). At the gross level, SU5402 inhibited fin regeneration but to a lesser extent than TCDD (Fig. 9, A and B). It is noteworthy that over the course of the regeneration period (3 days), SU5402 had a significant reduction in the overall embryonic and larval growth, whereas TCDD had no measurable effect on overall growth during this developmental window (data not shown). During regeneration, neuronal axons and their peripheral processes grow and extend into the newly formed tissue (R. L. Tanguay, unpublished observation). The growth and pathfinding of these structures can be used to assess tissue reorganization. In situ immunolocalization using an
-acetylated tubulin antibody is a convenient way to label the axons and their peripheral processes. In the control larvae, the peripheral processes branch off the axonal trunks and fan out into the regenerate. After 3 days, a complex but ordered network of branches is formed in the new tissue (Fig. 9C). In the TCDD-exposed animals, the peripheral processes consistently extended toward the amputation plane and then made lateral turns, nearly perpendicular to the plane of amputation. It is noteworthy that the branches continued to extend in the presence of TCDD, but the pathfinding is altered. These observations are consistent with the concept that that TCDD impairs the ability of the neuronal processes to migrate directly into the tissue (Fig. 9, C and D). Further illustration of this point is revealed when only the ventral half of the fin is amputated (Fig. 9E). TCDD consistently leads to an altered neuronal growth pattern in which the new processes in the partially amputated fin continued to grow, but they made lateral turns in the absence of sufficient new tissue to accommodate their length. These results suggest that in TCDD exposed larvae, the peripheral processes in the regenerating fin maybe incapable of growing straight because of a physical barrier or improper growth factor signaling. The neuronal response in SU5402-exposed larvae was noticeably different. The pathfinding of the neuronal branches was not affected. The processes reached the end of the new tissue and had a branching pattern indistinguishable from that in control animals (Fig. 9E). Taken together, these results suggest that the inhibition of regeneration mediated by TCDD and FGFR1 inhibitor is different.
|
| Discussion |
|---|
|
|
|---|
, and msx homeobox genes illustrates the complexity of signaling pathways during the regeneration process (White et al., 1994
In mammals, studies have demonstrated that Ahr null mice develop hepatic defects and have reduced liver size, implicating a role of AHR in normal liver growth and development (Schmidt and Bradfield, 1996
; Lahvis et al., 2000
). The underlying deficit seems to be a congenital vascular defect, failure of ductus venosus closure (Walisser et al., 2004
). In addition to this endogenous developmental role, functional AHR is required to mediate TCDD toxicity (Gonzalez and Fernandez-Salguero, 1998
; Mimura et al., 1999
). Both zfAHR1 and zfAHR2 were present in the regenerating fin of vehicle- and TCDD-exposed larvae (Fig. 4). Previous studies have reported that zfAHR1 does not mediate TCDD toxicity because it does not bind to AHR ligands and has a very limited tissue distribution (Andreasen et al., 2002a
). Knockdown of zfAHR2 by antisense morpholinos revealed that zfAHR2 mediates the endpoints of TCDD-dependent developmental toxicity (Prasch et al., 2003
). zfAHR2 morphants regenerated the fin tissue completely in the presence of TCDD, confirming that AHR2 is necessary for TCDD to block fin regeneration. Recently, a third AHR gene was identified in zebrafish, which is located adjacent to the AHR2 gene in the zebrafish genome. This duplicated gene was designated AHR1b. In vitro studies indicate that AHR1b has AHR-like properties (Karchner et al., 2005
). The AHR2 morpholino studies demonstrate that AHR1b cannot play a role in mediating the well-studied in vivo responses to TCDD. The endogenous role for AHR1b remains to be identified.
In mammals, ARNT1 is the functional dimerization partner for AHR, mediating many endpoints of TCDD toxicity (Schmidt and Bradfield, 1996
). arnt2 knockout mice die within 24 h of birth and have impaired hypothalamic development, confirming its function during normal development (Hosoya et al., 2001
). In zebrafish, four splice variants of zfARNT2 have been characterized, and zfARNT2b has been demonstrated to be transcriptionally active with zfAHR2 in vitro (Tanguay et al., 2000
). Unexpectedly, antisense repression of ARNT2 did not impact embryonic responses to TCDD. Similar results were obtained in zebrafish arnt2 mutants. Collectively, these results confirm that zfARNT2 is not the in vivo partner of zfAHR2, mediating the developmental toxicity by TCDD (Prasch et al., 2004
). zfARNT1 was recently characterized in zebrafish (Prasch et al., 2006
). In regenerating larval fin, zfARNT1 was highly abundant in both vehicle- and TCDD-exposed larvae, whereas the expression of zfARNT2 was low. Fin regeneration in zfARNT2-/- was impaired when exposed to TCDD, whereas the zfARNT1 morphants completely regenerated, confirming that zfANRT1 is the heterodimer of zfAHR2.
Because TCDD inhibits adult zebrafish fin regeneration when dosed on either 0, 1, 2, 3, or 4 dpa, this suggests that TCDD interferes with multiple stages of regeneration (Zodrow and Tanguay, 2003
). Similar results were found in larvae. When larvae were exposed to TCDD at 1 dpa, fin regeneration was also impaired (data not shown). It is noteworthy that because wound healing and blastema formation occur in the first day, regenerative outgrowth may be the TCDD target.
Pharmacological inhibition of FGFR1 inhibits blastema formation and outgrowth, indicating that FGF signaling is required during fin regeneration (Poss et al., 2000b
; Kawakami et al., 2004
). Although FGFR1 inhibitor effectively reduced regenerative outgrowth, overall embryonic growth was also affected. Both FGFR1 inhibitor and TCDD impaired fin regeneration, but the tissue response to these chemicals was different. Using neuronal outgrowth as a marker, TCDD led to a significant disorganization of peripheral processes. Because matrix degradation and turnover are important in wound healing, tissue remodeling, tissue repair, and inflammation, one possibility is that the extracellular matrix (ECM) metabolism is affected by TCDD. Matrix metalloproteinases (MMPs) are considered to be primarily responsible for the turnover of ECM. These proteolytic enzymes play a major role during development and morphogenesis. Improper regulation of these proteinases may result in pathologies such as arthritis, cancer, atherosclerosis, aneurysms, tissue ulcers, and fibrosis (Visse and Nagase, 2003
). It has also been reported that after central nervous system injury, the optic nerve astrocytes are stimulated by regenerating axons by secreting active MMP and down-regulating tissue inhibitors of metalloproteinases (TIMPs), resulting in the degradation of scar tissue, creating a permissive growth environment (Ahmed et al., 2005
). Tenascin-R, a glycoprotein deposited into the ECM, acts as a repellant guidance molecule in boundaries during normal growth and regeneration of optical axons (Becker et al., 2004
), clearly demonstrating that ECM components play critical roles in axonal guidance. We therefore propose that if matrix remodeling is impaired by TCDD, the neuronal growth cone may be unable to traverse through the matrix, resulting in abnormal pathfinding.
ECM is a dynamic environment that plays a crucial role in regulating cellular functions during normal and pathological remodeling processes such as embryonic development, tissue repair, inflammation, tumor invasion, and metastasis. ECM macromolecules are critical for creating a conducive cellular milieu for proper proliferation and migration of different cell types. The MMPs are specifically controlled at the transcriptional level, activation of precursor zymogens, cell-ECM interactions, and inhibition by endogenous TIMPs (Nagase and Woessner, 1999
). The expression and functional role of MMPs has been studied in adult zebrafish regenerating fin and have demonstrated that membrane-type mmp, mmp-2, and timp-2 mRNA transcripts were expressed in the regenerating fin tissue. Fin outgrowth was significantly reduced by GM6001, an MMP inhibitor, emphasizing the magnitude of these proteinases during fin regeneration (Bai et al., 2005
). Likewise, MMP inhibitor studies demonstrate that these enzymes are required for normal newt limb regeneration, and mmp3/10a, mmp3/10b, and mmp-9 are up-regulated within hours of limb amputation. The temporal expression of MMPs in the regenerating newt limb suggests that these enzymes are involved in blastema formation, maintenance, and growth (Vinarsky et al., 2005
). Aryl hydrocarbons such as TCDD and benzo(a)pyrene induced the expression of MMP-9 in PC-3 and DU145 human prostrate cancer cells (Haque et al., 2005
). TCDD increased the expression and activity of MMP-1, MMP-2, and MMP-9 in transformed melanoma cell (A2058) and increased invasion (Villano et al., 2006
). Gene expression in the fetal murine heart after TCDD exposure in utero suggests possible alterations in cell-cycle control and ECM production and remodeling (Thackaberry et al., 2005
). Furthermore, TCCD-enhanced expression of MMP-1, -9, and TIMP-3 in lung airway epithelial cells by microarray analysis, implying that MMP expression maybe a common endpoint for AHR pathway activation (Martinez et al., 2002
). In normal human keratinocytes, TCDD induces MMP-1 expression, and cotreatment with all trans-retinoic acid enhanced the MMP-1 expression additively (Murphy et al., 2004
), suggesting the cross-talk of AHR pathway with other signaling pathways. These studies correlate with the finding that ECM remodeling is impaired in the regenerating fins of TCDD exposed adult zebrafish (E. Andreasen, personal communication).
In summary, our data provide evidence that activation of AHR pathway inhibits larval zebrafish fin regeneration. The inhibition of fin regeneration is mediated by TCDD activation of zfAHR2 and its in vivo dimerization with zfARNT1. Preliminary data and the supporting literature point to an association between AHR pathway activation and impaired extracellular tissue remodeling. The interactions between cells and ECM are tightly controlled by membrane proteins, proteolytic enzymes, cytokines, and growth factors during numerous physiological processes and during regeneration. Inappropriate expression or activity of any of the factors can mediate a variety of pathologies such as tumor metastasis, cardiovascular disease, or toxicity. The larval fin regeneration model presented herein can be exploited to unravel the cross-talk between AHR-activated and other critical signaling pathways.
| Acknowledgements |
|---|
| Footnotes |
|---|
Article, publication date, and citation information can be found at http://molpharm.aspetjournals.org.
ABBREVIATIONS: TCDD, 2,3,7,8-tetrachlorodibenzo-p-dioxin; AHR, aryl hydrocarbon receptor; FGF, fibroblast growth factor; hpa, hours postamputation; hpf, hours postfertilization; BNF,
-naphthoflavone; ANF,
-naphthoflavone; DMSO, dimethyl sulfoxide; PCR, polymerase chain reaction; bp, base pair; WT, wild type; HET, heterozygous; PBS, phosphate-buffered saline; PBST, phosphate-buffered saline and Tween 20; SE, intersegmental vessel; FGFR1, fibroblast growth factor receptor 1; ECM, extracellular matrix; MMP, matrix metalloproteinase; TIMP, tissue inhibitors of metalloproteinase; SU5402, 3-[3-(2-carboxyethyl)-4-methylpyrrol-2-methylidenyl]-2-indolinone; GM6001, butanediamide.
Address correspondence to: Dr. Robert L. Tanguay, Oregon State University, Department of Environmental and Molecular Toxicology, 1007 ALS, Corvallis, OR 97331-7301. E-mail: robert.tanguay{at}oregonstate.edu
| References |
|---|
|
|
|---|
Akimenko MA, Johnson SL, Westerfield M, and Ekker M (1995) Differential induction of four msx homeobox genes during fin development and regeneration in zebrafish. Development 121: 347-357.[Abstract]
Amsterdam A, Burgess S, Golling G, Chen W, Sun Z, Townsend K, Farrington S, Haldi M, and Hopkins N (1999) A large-scale insertional mutagenesis screen in zebrafish. Genes Dev 13: 2713-2724.
Andreasen EA, Hahn ME, Heideman W, Peterson RE, and Tanguay RL (2002a) The zebrafish (Danio rerio) aryl hydrocarbon receptor type 1 (zfAHR1) is a novel vertebrate receptor. Mol Pharmacol 62: 234-249.
Andreasen EA, Spitsbergen JM, Tanguay RL, Stegeman JJ, Heideman W, and Peterson RE (2002b) Tissue-specific expression of AHR2, ARNT2 and CYP1A in zebrafish embryos and larvae: effects of developmental stage and 2,3,7,8-tetrachlorodibenzo-p-dioxin exposure. Toxicol Sci 68: 403-419.
Bai S, Thummel R, Godwin AR, Nagase H, Itoh Y, Li L, Evans R, McDermott J, Seiki M, and Sarras MP Jr (2005) Matrix metalloproteinase expression and function during fin regeneration in zebrafish: analysis of MT1-MMP, MMP2 and TIMP2. Matrix Biol 24: 247-260.[CrossRef][Medline]
Becker CG, Schweitzer J, Feldner J, Schachner M, and Becker T (2004) Tenascin-R as a repellent guidance molecule for newly growing and regenerating optic axons in adult zebrafish. Mol Cell Neurosci 26: 376-389.[CrossRef][Medline]
Geraudie J, Monnot MJ, Brulfert A, and Ferretti P (1995) Caudal fin regeneration in wild type and long-fin mutant zebrafish is affected by retinoic acid. Int J Dev Biol 39: 373-381.[Medline]
Gonzalez FJ and Fernandez-Salguero P (1998) The aryl hydrocarbon receptor: studies using the AHR-null mice. Drug Metab Dispos 26: 1194-1198.
Hahn ME, Karchner SI, Shapiro MA, and Perera SA (1997) Molecular evolution of two vertebrate aryl hydrocarbon (dioxin) receptors (AHR1 and AHR2) and the PAS family. Proc Natl Acad Sci USA 94: 13743-13748.
Haque M, Francis J, and Sehgal I (2005) Aryl hydrocarbon exposure induces expression of MMP-9 in human prostate cancer cell lines. Cancer Lett 225: 159-166.[CrossRef][Medline]
Henry EC, Kent TA, and Gasiewicz TA (1997) DNA binding and transcriptional enhancement by purified TCDD. Ah receptor complex. Arch Biochem Biophys 339: 305-314.[Medline]
Hosoya T, Oda Y, Takahashi S, Morita M, Kawauchi S, Ema M, Yamamoto M, and Fujii-Kuriyama Y (2001) Defective development of secretory neurones in the hypothalamus of Arnt2-knockout mice. Genes Cells 6: 361-374.[Abstract]
Karchner SI, Franks DG, and Hahn ME (2005) AHR1B, a new functional aryl hydrocarbon receptor in zebrafish: tandem arrangement of ahr1b and ahr2 genes. Biochem 392: 153-161.[CrossRef][Medline]
Kawakami A, Fukazawa T, and Takeda H (2004) Early fin primordia of zebrafish larvae regenerate by a similar growth control mechanism with adult regeneration. Dev Dyn 231: 693-699.[CrossRef][Medline]
Lahvis GP, Lindell SL, Thomas RS, McCuskey RS, Murphy C, Glover E, Bentz M, Southard J, and Bradfield CA (2000) Portosystemic shunting and persistent fetal vascular structures in aryl hydrocarbon receptor-deficient mice. Proc Natl Acad Sci USA 97: 10442-10447.
Martinez JM, Afshari CA, Bushel PR, Masuda A, Takahashi T, and Walker NJ (2002) Differential toxicogenomic responses to 2,3,7,8-tetrachlorodibenzo-p-dioxin in malignant and nonmalignant human airway epithelial cells. Toxicol Sci 69: 409-423.
Mimura J, Ema M, Sogawa K, and Fujii-Kuriyama Y (1999) Identification of a novel mechanism of regulation of Ah (dioxin) receptor function. Genes Dev 13: 20-25.
Murphy KA, Villano CM, Dorn R, and White LA (2004) Interaction between the aryl hydrocarbon receptor and retinoic acid pathways increases matrix metalloproteinase-1 expression in keratinocytes. J Biol Chem 279: 25284-25293.
Nagase H and Woessner JF Jr (1999) Matrix metalloproteinases. J Biol Chem 274: 21491-21494.
Nasevicius A and Ekker SC (2000) Effective targeted gene `knockdown' in zebrafish. Nat Genet 26: 216-220.[CrossRef][Medline]
Nechiporuk A and Keating MT (2002) A proliferation gradient between proximal and msxb-expressing distal blastema directs zebrafish fin regeneration. Development 129: 2607-2617.
Poss KD, Shen J, and Keating MT (2000a) Induction of lef1 during zebrafish fin regeneration. Dev Dyn 219: 282-286.[CrossRef][Medline]
Poss KD, Shen J, Nechiporuk A, McMahon G, Thisse B, Thisse C, and Keating MT (2000b) Roles for Fgf signaling during zebrafish fin regeneration. Dev Biol 222: 347-358.[CrossRef][Medline]
Prasch AL, Heideman W, and Peterson RE (2004) ARNT2 is not required for TCDD developmental toxicity in zebrafish. Toxicol Sci 82: 250-258.
Prasch AL, Tanguay RL, Mehta V, Heideman W, and Peterson RE (2006) Identification of zebrafish ARNT1 homologs: 2,3,7,8-tetrachlorodibenzo-p-dioxin toxicity in the developing zebrafish requires ARNT1. Mol Pharmacol, in press.
Prasch AL, Teraoka H, Carney SA, Dong W, Hiraga T, Stegeman JJ, Heideman W, and Peterson RE (2003) Aryl hydrocarbon receptor 2 mediates 2,3,7,8-tetrachlorodibenzo-p-dioxin developmental toxicity in zebrafish. Toxicol Sci 76: 138-150.
Santamaria JA, Mari-Beffa M, Santos-Ruiz L, and Becerra J (1996) Incorporation of bromodeoxyuridine in regenerating fin tissue of the goldfish Carassius auratus. J Exp Zool 275: 300-307.[CrossRef][Medline]
Schmidt JV and Bradfield CA (1996) Ah receptor signaling pathways. Ann Rev Cell Dev Biol 12: 55-89.[CrossRef][Medline]
Tanguay RL, Abnet CC, Heideman W, and Peterson RE (1999) Cloning and characterization of the zebrafish (Danio rerio) aryl hydrocarbon receptor. Biochimica Biophys Acta 1444: 35-48.[Medline]
Tanguay RL, Andreasen EA, Heideman W, and Peterson RE (2000) Identification and expression of alternatively spliced aryl hydrocarbon nuclear translocator2 (ARNT2) cDNAs from zebrafish with distinct functions. Biochim Biophys Acta 1494: 117-128.[Medline]
Thackaberry EA, Jiang Z, Johnson CD, Ramos KS, and Walker MK (2005) Toxicogenomic profile of 2,3,7,8-tetrachlorodibenzo-p-dioxin in the murine fetal heart: modulation of cell cycle and extracellular matrix genes. Toxicol Sci 88: 231-241.
Villano CM, Murphy KA, Akintobi A, and White LA (2006) 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) induces matrix metalloproteinase (MMP) expression and invasion in A2058 melanoma cells. Toxicol Appl Pharmacol, in press.
Vinarsky V, Atkinson DL, Stevenson TJ, Keating MT, and Odelberg SJ (2005) Normal newt limb regeneration requires matrix metalloproteinase function. Dev Biol 279: 86-98.[CrossRef][Medline]
Visse R and Nagase H (2003) Matrix metalloproteinases and tissue inhibitors of metalloproteinases: structure, function and biochemistry. Circ Res 92: 827-839.
Walisser JA, Bunger MK, Glover E, and Bradfield CA (2004) Gestational exposure of Ahr and Arnt hypomorphs to dioxin rescues vascular development. Proc Natl Acad Sci USA 101: 16677-16682.
Wang WWJ, Hsu H, Kong Z, and Hu C (2000) Overexpression of a zebrafish ARNT2-like factor represses CYP1A transcription in ZLE cells. Marine Biotechnol 2: 376-386.
Wentworth JN, Buzzeo R, and Pollenz RS (2004) Functional characterization of aryl hydrocarbon receptor (zfAHR2) localization and degradation in zebrafish (Danio rerio). Biochem Pharmacol 67: 1363-1372.[CrossRef][Medline]
White JA, Boffa MB, Jones B, and Petkovich M (1994) A zebrafish retinoic acid receptor expressed in the regenerating caudal fin. Development 120: 1861-1872.[Abstract]
Zodrow JM and Tanguay RL (2003) 2,3,7,8-Tetrachlorodibenzo-p-dioxin inhibits fin regeneration in zebrafish. Toxicol Sci 76: 151-161.
This article has been cited by other articles:
![]() |
L. K. Mathew, S. S. Sengupta, J. LaDu, E. A. Andreasen, and R. L. Tanguay Crosstalk between AHR and Wnt signaling through R-Spondin1 impairs tissue regeneration in zebrafish FASEB J, August 1, 2008; 22(8): 3087 - 3096. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. K. Mathew, S. Sengupta, A. Kawakami, E. A. Andreasen, C. V. Lohr, C. A. Loynes, S. A. Renshaw, R. T. Peterson, and R. L. Tanguay Unraveling Tissue Regeneration Pathways Using Chemical Genetics J. Biol. Chem., November 30, 2007; 282(48): 35202 - 35210. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. A. Andreasen, L. K. Mathew, C. V. Lohr, R. Hasson, and R. L. Tanguay Aryl Hydrocarbon Receptor Activation Impairs Extracellular Matrix Remodeling during Zebra Fish fin Regeneration Toxicol. Sci., January 1, 2007; 95(1): 215 - 226. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. S. Antkiewicz, R. E. Peterson, and W. Heideman Blocking Expression of AHR2 and ARNT1 in Zebrafish Larvae Protects Against Cardiac Toxicity of 2,3,7,8-Tetrachlorodibenzo-p-dioxin Toxicol. Sci., November 1, 2006; 94(1): 175 - 182. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. Villano and L. A. White The Aryl Hydrocarbon Receptor-Signaling Pathway and Tissue Remodeling: Insights from the Zebrafish (Danio rerio) Model System Toxicol. Sci., July 1, 2006; 92(1): 1 - 4. [Full Text] [PDF] |
||||
![]() |
A. L. Prasch, R. L. Tanguay, V. Mehta, W. Heideman, and R. E. Peterson Identification of Zebrafish ARNT1 Homologs: 2,3,7,8-Tetrachlorodibenzo-p-dioxin Toxicity in the Developing Zebrafish Requires ARNT1 Mol. Pharmacol., March 1, 2006; 69(3): 776 - 787. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||