|
|
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
School of Surgical and Reproductive Sciences, The Medical School, University of Newcastle upon Tyne, Newcastle upon Tyne, United Kingdom
Received November 2, 2005; accepted December 13, 2005
| Abstract |
|---|
|
|
|---|
With respect to human pregnancy, considerable effort has been expended in unraveling the molecular events that regulate the activity of the uterus during gestation and parturition, and several key genes have so far been identified whose inappropriate expression may underlie the initiation of preterm delivery. In this context, there is now growing evidence to indicate that both normal healthy term and preterm labor may involve an inflammatory mechanism by which increased production of cytokines such as tumor necrosis factor
, IL-1
, IL-1
, IL-6, and IL-8 and up-regulation of COX-2 occurs within the uterus (Challis et al., 2000
). This increase in COX-2 expression is initially observed in the fetal membranes (Slater et al., 1995
), resulting in increased prostaglandin production, which is also augmented by the concurrent down-regulation of prostaglandin dehydrogenase, which inactivates prostaglandins. In normal pregnancies, both cytokines and prostaglandins promote cervical ripening and coordinate uterine contractions to expel the neonate at term (Challis et al., 2000
). However, bacterial infection leading to stimulation of Toll-like receptors (Elovitz et al., 2003
) may trigger their early increased synthesis in uterine tissues resulting in premature labor as well as the associated effects of cytokines on normal fetal cerebral development. Evidence has also accrued to indicate the differential expression of specific prostaglandin receptors as the activity of the myometrium switches from a quiescent state (expressing predominantly EP2 and EP4 receptors) to an active contractile state (expressing prostaglandin F2
receptors) at term (Myatt et al., 2004).
Various nonsteroidal anti-inflammatory drugs have been used to selectively and nonselectively inhibit COX-2 at sites of inflammation. However, evidence proposes that some of these COX-2 inhibitory drugs, such as rofecoxib (Vioxx) and celecoxib (Celebrex) may, in the long term, increase the risk of cardiovascular events (Psaty and Furberg, 2005
; Warner and Mitchell, 2005
). Nonselective COX-2 inhibitors, such as indomethacin and sulindac, have been used clinically in an attempt to delay preterm birth (Loudon et al., 2003
; Olson, 2005
); however, clinical evidence indicates that these tocolytics have potentially adverse fetal side effects, including closure of the ductus arteriosus, high blood pressure in the lungs, bleeding in the brain or heart, and impaired renal function (reviewed in Loudon et al., 2003
; Groom et al., 2005
). Rofecoxib has been tested in a double-blind randomized controlled trial to assess its safety and efficacy in delaying preterm delivery in women at high risk (Groom et al., 2005
). However, the outcome from this study indicated that the use of rofecoxib also results in adverse fetal side effects, which although reversible with discontinuation of treatment, does not reduce the incidence of preterm delivery at early gestation ages (<30 weeks), and moreover, its usage is also associated with an increased risk of premature delivery in women at high risk. These studies highlight that there are no effective therapeutic strategies for preventing early gestational deliveries or even later preterm labor not associated with infection. Therefore, the development of novel, specific, and nontoxic approaches to inhibit proinflammatory genes, such as COX-2, needs to be considered.
Antisense oligonucleotides to specific cellular RNAs have shown great promise in both research and clinical studies as sequence-specific agents able to modulate the expression of targeted genes. In principle, the most important feature of antisense oligonucleotides is their ability to base-pair with the target RNA to either block its translation or, primarily, to mediate its destruction by RNase H, an enzyme that destroys RNA in a DNA/RNA duplex (Sazani and Kole, 2003
). However, many studies have also indicated that these oligonucleotides can have toxic side effects and may exert their effects nonspecifically by binding directly to a number of proteins in vivo in a sequence-dependent rather than a sequence-specific manner (Sazani and Kole, 2003
). This nonantisense mechanism of binding was shown to occur particularly with the most commonly used 2'-oligodeoxynucleoside phosphorothioate species, which also seem to be sensitive to degradation by RNase H. Moreover, in vivo cellular RNAs are nearly always complexed with proteins that may block the sites and/or change the secondary/tertiary structure of the targeted RNA such that oligonucleotide targeting is frequently a trial-and-error process (Sazani and Kole, 2003
). A new application of antisense oligonucleotides has been developed whereby these agents have been used to modify the splicing pattern of pre-mRNA in contrast to down-regulation of gene expression by targeting mRNA (Schmajuk et al., 1999
; Sierakowska et al., 1999
). Morpholino oligonucleotides have been designed to bind to specific cis elements within target precursor mRNA to correct aberrant splicing brought about by disease mutations, an example of which is the
-globin gene in thalassemic patients (Sierakowska et al., 1996
). In contrast, the potential also exists to use this method to selectively delete individual exons of specific pre-mRNA species and thus increase production of variant mRNAs, which are translated into proteins devoid of functional domains. In light of this, a similar strategy could be adopted to knock out specific exons within pre-mRNA of uterine pro-labor genes, such as COX-2 (which we report here), resulting in decreased expression of functionally active protein species.
| Materials and Methods |
|---|
|
|
|---|
|
RT-PCR Analysis. Confirmation of a COX-2 mRNA spliced variant, with exon 4 skipped because of targeting with antisense morpholino oligonucleotides, was achieved by RT-PCR using COX-2-specific sense and antisense primers spanning exon 4. This procedure provides a quick and simple assay to both confirm and quantify the level of inhibition. RT-PCR was performed using total RNA extracted from individual experiments using the SV total RNA isolation kits as recommended by the manufacturer (Promega, Madison, WI) and first-strand cDNA synthesized from 1 µg of RNA using 20 units of Superscript III reverse transcriptase (Invitrogen) with 100 ng of oligo(dT)16 as primer. PCR amplification was carried out with 2 µl of cDNA using COX-2-specific sense and antisense oligonucleotide primers, which amplify COX-2 mRNA-spliced variants with and without the exon 4 sequence. DNA sequences for the PCR primers were CTACATACTTACCCACTTCAAGG (sense exon 3) and GTAGATCATCTCTGCCTGAGTATC (antisense exon 6). PCR was performed under standard conditions with an initial hot start cycle at 94°C (4 min), 55°C (30 s), and 72°C (1 min) followed by 25 to 28 cycles at 94°C (1 min), 55°C (30 s), and 72°C (1 min). PCR products representing the spliced COX-2 mRNA variants (472 bp with exon 4 and 328 bp without exon 4) were then analyzed by gel electrophoresis followed by densitometric scanning using a UMAX scanner coupled to the intelligent quantifier software from BioImage (Soeborg, Denmark). GAPDH primers were also included as control primers for use in RT-PCR with each cDNA sample. DNA sequences for the GAPDH primers were CTGCCGTCTAGAAAAACC (sense) and CCACCTTCGTTGTCATACC (antisense).
Western Immunoblotting. The effectiveness of the morpholino oligonucleotides in repressing functional protein expression was determined by immunoblotting. Protein lysates from morpholino oligonucleotide and LPS-treated WISH and myometrial cells were prepared and resolved by 10% SDS-polyacrylamide gel electrophoresis as described previously (Pollard et al., 2000
). Recombinant COX-2 protein was also included as a positive control. Immunoblotting was then performed using a monoclonal COX-2 antibody (Upstate Biotechnology, Lake Placid, NY) at 1:1000 dilution overnight at 4°C. All membranes were reprobed with a G
control antibody to confirm equal loading. Immunoreactive bands were detected by enhanced chemiluminescence (Amersham Biosciences, Piscataway, NJ) followed by densitometric scanning using a UMAX scanner coupled to the intelligent quantifier software from BioImage.
COX-2 Enzyme Activity Assay. Loss of enzymic activity of COX-2 because of morpholino inhibition was measured using a COX enzyme activity assay (Cayman Chemical, Ann Arbor, MI). This procedure measures COX-2 activity by oxidation of the peroxidase cosubstrate TMPD (N,N,N1,N1-tetra-methyl-p-phenylenediamine) in 96-well plates and has been shown to accurately reflect the rate of conversion of arachidonic acid to PGH2. In brief, WISH and myometrial cells were cultured to 90% confluence in T75cm flasks and treated with LPS/morpholino oligonucleotides as described in the figure legends. Cells were then rinsed twice in phosphate-buffered saline to remove all traces of DMEM, sonicated in 400 µl of ice-cold 0.1 M Tris, pH 7.8, containing 1 mM EDTA, and freeze-dried to 200 µl. The assay mixture containing 140 µl of assay buffer,10 µl of heme, 10 µl of sample (or protein standard or inactivated protein prepared by boiling lysates for 5 min), and 10 µl of the COX-1 inhibitor SC-560 to eliminate COX-1 activity (or as a control reaction the COX-2 inhibitor DuP-697 to eliminate COX-2 activity) was incubated for 5 min at 25°C, and 20 µl of TMPD was added. The reactions were then initiated by adding 20 µl of arachidonic acid to all wells, and plates gently were shaken and incubated for 5 min at 25°C. The absorbance was then read at 590 nM using a Spectra MAX 190 plate reader (Molecular Devices, Sunnyvale, CA). COX-2 activity was then calculated using the following formula whereby 1 unit is defined as the amount of enzyme to oxidize 1 nmol of TMPD per min at 25°C: COX-2 activity = [(
590/5 min/0.00826 µM-1) x (0.21 ml/0.01 ml)]/2 (it takes two molecules of TMPD to reduce PGG2 to PGH2) = nanomoles per minute per milliliter (units per milliliter). Inhibition of COX-2 activity, because of morpholino inhibition, was then measured and normalized to transfection efficiency.
Statistical Analysis. Data were compared using an unpaired, two-tailed t test; P < 0.05 was considered statistically significant. All experiments were performed three times in triplicate, and results are expressed as the mean ± S.E.M.
| Results |
|---|
|
|
|---|
|
|
Twenty-Four-Hour Effect of Morpholino Oligonucleotides on LPS-Induced COX-2 Protein Expression. The ability of morpholino oligonucleotides to inhibit the production of full-length COX-2 protein was then assessed by Western immunoblotting using protein lysates prepared from WISH and myometrial cells treated with the two morpholino oligonucleotides for 24 h. Quantification demonstrated that levels of 72-kDa COX-2 were significantly lower (p < 0.01) in samples treated with the inhibitory COX-2 morpholino oligonucleotides compared with the intensity of the 72-kDa protein bands generated from the cells treated with LPS and the control morpholino oligonucleotides (Fig. 4). The appearance of a novel band of smaller size (less than 65 kDa) was observed only in samples treated with the morpholino oligonucleotides, indicating translation of a truncated COX-2 protein. The predicted molecular mass of a COX-2 protein with the 144-bp exon 4 spliced out, based on its amino acid content, was calculated to be 63 kDa (http://www.bioinformatics.org/sms/prot_mw.html). Note that the reduction in 72-kDa COX-2 protein levels, as a consequence of morpholino oligonucleotide inhibition, correlated with the preceding decrease in full-length COX-2 mRNA (Fig. 3). The residual 72-kDa band observed in antisense morpholino oligonucleotide-treated cells represents those cells that have not been transfected.
|
|
|
| Discussion |
|---|
|
|
|---|
Evidence from previous studies show that antisense oligonucleotides targeted to pre-mRNA splice sites redirect the splicing machinery to adjacent consensus splice sites or cryptic splice sites and alter the splicing pattern of the pre-mRNA (Schmajik et al., 1999; Sierakowska et al., 1999
; Sazani et al., 2002
). Oligonucleotides used to modify splicing result in products that are readily detectable with null or very low background contamination, whereas the effects of oligonucleotides directed to mRNA may easily be overlooked because of high background of the pre-existing mRNA. Moreover, because splicing takes place in the nucleus, the shift in the pattern of splicing of the target gene can only be due to the intranuclear activity of the oligonucleotides (Schmajik et al., 1999; Sierakowska et al., 1999
). The requirements for oligonucleotides that shift splicing are different to those required for down-regulation of mRNA. In essence, they must not activate RNase H, which would destroy the pre-mRNA target before splicing, and must be able to effectively compete with splicing factors for access to target pre-mRNA (Sierakowska et al., 1999
). Synthetic morpholino oligonucleotides having phosphordiamidate internucleotide linkages fit these requirements because they are RNase H-inactive with a high affinity for target pre-mRNA and are nuclease-resistant, and they have the ability to cross cell membranes relatively easily (Schmajik et al., 1999; Heasman, 2002
; Sazani et al., 2002
). In several in vitro test systems, antisense oligonucleotides have proven to be highly successful in correcting aberrant splicing brought about by
-globin gene in thalassemia and the cystic fibrosis transmembrane conductance regulator gene (Friedman et al., 1999
). Until now only two published studies have used this antisense approach to target pre-mRNA and selectively splice out specific exons (Karras et al., 2000
; Ittig et al., 2004
). The Karras et al. (2000
) study reported that constitutive/alternative splicing of murine interleukin-5 receptor-
(IL-5R
) chain pre-mRNA can be modulated in cells using specific antisense morpholino oligonucleotides directed to specific 3'/5' splice sites such that individual exons may be selectively deleted from mature transcripts. This study used a range of different morpholino oligonucleotides designed to target either 3' acceptor or 5' donor sites of the IL-5R
chain pre-mRNA. It is noteworthy that in some cases, specific oligonucleotides redirected splicing events to nearby cryptic splice site, resulting in novel IL-5R
chain mRNA transcripts. The use of two morpholino oligonucleotides targeted to both the 3' acceptor and 5' donor sites of the pre-mRNA sequence of COX-2 seemed to be effective in our in vitro test system.
The results from this present study provide the first evidence to indicate that antisense morpholino oligonucleotides can be used, in vitro, in amnion-WISH and myometrial cell cultures to produce a functionally inactive protein and that this approach may therefore have therapeutic potential in the better management of preterm labor if it can be reproduced in vivo. In this respect, a recent study by Luu et al. (2004
) using the mouse model provides direct evidence to show the efficacy of morpholino oligonucleotides in vivo. This study reported that morpholino oligonucleotides were successful in down-regulating calbindins in the mouse uterus and that the effect of the morpholinos remained localized within the uterus of the mouse. Moreover, the study highlighted that administration of morpholino oligonucleotides by intrauterine injection using the less potent EPEI delivery system (Gene Tools, LLC) provided a highly effective technique in specifically targeting uterine genes in vivo.
Antisense morpholino oligonucleotides have major advantages over other antisense gene silencing systems in that: 1) they are DNA analogs that are not susceptible to enzymatic degradation and thus have increased biological stability (Hudziak et al., 1996
); 2) whereas targeted mRNA with conventional oligonucleotides is continually being replaced by new transcription requiring continued treatment, morpholino oligonucleotide targeting of pre-mRNA requires a single dose; 3) they have been shown to have greater specificity than siRNA and other phosphorothioate-based oligonucleotides (Summerton, 1999
) and hence have no off-target toxic antisense effects; and 4) they have a high "loss-of-function" effect, which has been shown to last up to 4 days (Braat et al., 2001
; Dutton et al., 2001
). Because antisense morpholino oligonucleotides provide greater stability, nuclease resistance, long-term activity, low toxicity, and excellent specificity compared with alternative gene-silencing reagents, they therefore may represent potential therapeutic tools within many fields of medicine, including obstetrics. In this context, there is extensive evidence to indicate increased expression of COX-2 at sites of inflammation and disease (Williams et al., 1999
; Warner and Mitchell, 2005
). For example, expression of COX-2 is greatly increased in rheumatoid arthritic joints (Warner and Mitchell, 2005
), plus clinical and experimental evidence suggests that COX-2 contributes to lesion formation in atherosclerosis (Paramo et al., 2005
). COX-2 overexpression seems to be particularly prevalent in different cancers, including gastric cancers (Saukkonen et al., 2001
), esophageal cancer (Kaur and Triadafilopoulos, 2002
), pancreatic cancer (Tucker et al.,1999
), lung adenocarcinoma (Wolff et al., 1998
), and colon carcinomas (Gupta et al., 2001
). In this light, suppression of COX-2 activity by antisense morpholino oligonucleotides may also have potential in the better treatment inflammatory diseases and cancer.
In conclusion, this study has shown that antisense morpholino oligonucleotides designed to target both the 3' acceptor and 5' donor sites of exon 4 of the pre-mRNA sequence of COX-2 results in a substantial suppression of COX-2 activity in cultured human amnion-derived WISH and myometrial cells. Therefore, the possibility exists that a similar approach can be mimicked in vivo to produce a highly specific and nontoxic strategy to inhibit COX-2 activity.
| Acknowledgements |
|---|
| Footnotes |
|---|
Article, publication date, and citation information can be found at http://molpharm.aspetjournals.org.
ABBREVIATIONS: COX, cyclooxygenase; LPS, lipopolysaccharide; IL, interleukin; DMEM, Dulbecco's modified Eagle's medium; EPEI, ethoxylated polyethylenimine; RT-PCR, reverse transcription-polymerase chain reaction; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; bp, base pair(s); TMPD, N,N,N1,N1-tetra-methyl-p-phenylenediamine; PG, prostaglandin; SC-560, 5-(4-chlorophenyl)-1-(4-methoxyphenyl)-3-(trifluoromethyl)-1H-pyrazole; DuP-697, 5-bromo-2-(4-fluorophenyl)-3-(4-methylsulfonyl)phenyl)-thiophene; IL-5R
, interleukin-5 receptor-
.
Address correspondence to: Dr. Alison J. Tyson-Capper, School of Surgical and Reproductive Sciences, 3rd Floor, William Leech Building, The Medical School, University of Newcastle upon Tyne, NE2 4HH, UK. E-mail: a.j.tysoncapper{at}ncl.ac.uk
| References |
|---|
|
|
|---|
Chakraborty I, Das SK, Wang J, and Dey SK (1996) Developmental expression of the cyclo-oxygenase-1 and cyclo-oxygenase-2 genes in the peri-implantation mouse uterus and their differential regulation by the blastocyst and ovarian steroids. J Mol Endocrinol 16: 107-122.
Challis JRG, Matthews SG, Gibb W, and Lye SJ (2000) Endocrine and paracrine regulation of birth at term and preterm. Endocrine Rev 21: 514-550.
Coyne DW, Nickols M, Bertrand W, and Morrison AR (1992) Regulation of mesangial cell cyclooxygenase synthesis by cytokines and glucocorticoids. Am J Physiol 263: F97-F102.
Dubois RN, Abramson SB, Crofford L, Gupta RA, Simon LS, Van De Putte LB, and Lipsky PE (1998) Cyclooxygenase in biology and disease. FASEB J 12: 1063-1073.
Dutton K, Dutton JR, Pauliny A, and Kelsh RN (2001) A morpholino phenocopy of the colourless mutant. Genesis 30: 188-189.[CrossRef][Medline]
Elovitz MA, Wang Z, Chien EK, Rychlik M, and Phillippe M (2003) A new model for inflammation induced preterm birth: the role of platelet-activating factor and Toll-like receptor-4. Am J Pathol 163: 2103-2111.
Friedman KJ, Kole J, Cohn JA, Knowles MR, Silverman LM, and Kole R (1999) Correction of aberrant splicing of the cystic fibrosis transmembrane conductance regulator (CFTR) gene by antisense oligonucleotides. J Biol Chem 274: 36193-36199.
Fu JY, Masferrer, Seibert K, Raz A, and Needleman P (1990) The induction and suppression of prostaglandin H2 synthase (cyclooxygenase) in human monocytes. J Biol Chem 265: 16737-16740.
Groom KM, Shennan AH, Jones BA, Seed P, and Bennett PR (2005) TOCOX-a randomised, double-blind, placebo-controlled trial of rofecoxib (a COX-2-specific prostaglandin inhibitor) for the prevention of preterm delivery in women at high risk. Br J Obstet Gynaecol 112: 725-730.
Gupta DC and Dubois RN (2001) Colorectal cancer prevention and treatment by inhibition of cyclooxygenase-2. Nat Rev Cancer 1: 11-21.[CrossRef][Medline]
Heasman J (2002) Morpholino oligos: making sense of antisense. Dev Biol 243: 209-214.[CrossRef][Medline]
Hudziak R, Barofsky E, Barofsky D, Weller DL, Huang S, and Weller DD (1996) Resistance of morpholino phosphorodiamidate oligomers to enzymatic degradation. Antisense Nucleic Acid Drug Dev 6: 267-272.[Medline]
Ittig D, Songkai L, Renneberg D, Schümperli D, and Leumann CJ (2004) Nuclear antisense effects in cyclophilin A pre-mRNA splicing by oligonucleotides: a comparison of tricyclo-DNA with LNA. Nucleic Acids Res 32: 346-353.
Karras JG, McKay RA, Dean NM, and Monia BP (2000) Deletion of individual exons and induction of soluble interleukin-5 receptor-a chain expression through antisense oligonucleotide-mediated redirection of pre-mRNA splicing. Mol Pharmacol 58: 380-387.
Kaur BS and Triadafilopoulos G (2002) Acid- and bile-induced PGE(2) release and hyperproliferation in Barrett's esophagus are COX-2 and PKC-
dependent. Am J Physiol 283: G327-G334.
Lim H, Paria BC, Das SK, Dinchuk JE, Langenbach R, Trzaskos JM, and Dey SK (1997) Multiple female reproductive failures in cyclooxygenase 2-deficient mice. Cell 91: 197-208.[CrossRef][Medline]
Loudon JA, Groom KM, and Bennett PR (2003) Prostaglandin inhibitors in preterm labour. Best Pract Res Clin Obstet Gynaecol 17: 731-744.[Medline]
Luu K, Nie GY, and Salamonsen LA (2004) Endometrial calbindins are critical for embryo implantation: evidence from in vivo use of morpholino antisense oligonucleotides Proc Natl Acad Sci USA 101: 8028-8033.
Myatt L and Lye SJ (2004) Expression, localization and function of prostaglandin receptors in myometrium. Prostaglandins Leukot Essent Fatty Acids 70: 137-148.[CrossRef][Medline]
Olson DM (2005) The promise of prostaglandins: have they fulfilled their potential as therapeutic targets for the delay of preterm birth? J Soc Gynecol Investig 12: 466-478.[Medline]
Paramo JA, Rodriguez JA, Beloqui O, and Orbe J (2005) Monocyte cyclooxygenase-2 activity: a new therapeutic target for atherosclerosis? Curr Drug Targets Cardiovasc Haematol Disord 5: 303-311.[CrossRef][Medline]
Pollard AJ, Sparey C, Robson SC, Krainer AR, and Europe-Finner GN (2000) Spatio-temporal expression of the trans acting splicing factors SF2/ASF and hnRNPA1/A1B in the myometrium of the pregnant human uterus: a molecular mechanism for regulating regional protein isoform expression in vivo. J Clin Endocrinol Metab 85: 1928-1936.
Psaty BM and Furberg CD (2005) COX-2 inhibitorslessons in drug safety. N Engl J Med 352: 1133-1135.
Saukkonen K, Nieminen O, van Rees B, Vilkki S, Harkonen M, Juhola M, Mecklin JP, Sipponen P, and Ristimaki A (2001) Expression of cyclooxygenase-2 in dysplasia of the stomach and in intestinal-type gastric adenocarcinoma. Clin Cancer Res 7: 1923-1931.
Sazani P and Kole R (2003) Therapeutic potential of antisense oligonucleotides as modulators of alternative splicing. J Clin Investig 112: 481-486.[CrossRef][Medline]
Sazani P, Vacek MM, and Kole R (2002) Short-term and long-term modulation of gene expression by antisense therapeutics. Curr Opin Biotech 13: 468-472.[CrossRef][Medline]
Schmajuk G, Sierakowska H, and Kole R (1999) Antisense oligonucleotides with different backbones. Modification of splicing pathways and efficacy of uptake. J Biol Chem 274: 21783-21789.
Sierakowska H, Sambade MJ, Agrawal S, and Kole R (1996) Repair of thalassemic human
-globin mRNA in mammalian cells by antisense oligonucleotides. Proc Natl Acad Sci USA 93: 12480-12844.
Sierakowska H, Sambade MJ, Schumperli D, and Kole R (1999) Sensitivity of splice sites to antisense oligonucleotides in vivo. RNA 5: 369-377.[Abstract]
Slater D, Dennes W, Sawdy R, Allport V, and Bennett P (1999) Expression of cyclo-oxygenase types-1 and -2 in human myometrium throughout pregnancy. J Mol Endocrinol 22: 11125-11130.
Slater DM, Berger L, Newton R, Moore GE, and Bennett PR (1995) Expression of cyclooxygenase types 1 and 2 in human fetal membranes at term. Am J Obstet Gynecol 172: 77-82.[CrossRef][Medline]
Summerton J (1999) Morpholino antisense oligomers: the case for an RNase H-independent structural type. Biochem Biophys Acta 1489: 141-158.[Medline]
Tucker ON, Dannenberg AJ, Yang EK, Zhang F, Teng L, Daly JM, Soslow RA, Masferrer JL, Woerner BM, Koki AT, et al. (1999) Cyclooxygenase-2 expression is up-regulated in human pancreatic cancer. Cancer Res 59: 987-990.
Warner TD and Mitchell JA (2005) Cyclooxygenases: new forms, new inhibitors and lessons from the clinic. FASEB J 18: 790-804.
Williams CS, Mann M, and DuBois RN (1999) The role of cyclooxygenases in inflammation, cancer and development. Oncogene 18: 7908-7916.[CrossRef][Medline]
Wolff H, Saukkonen K, Anttila S, Karjalainen A, Vainio H, and Ristimaki A (1998) Expression of cyclooxygenase-2 in human lung carcinoma. Cancer Res 58: 4997-5001.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||