|
|
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Laboratory of Cell Biology, Center for Cancer Research, National Cancer Institute, National Institutes of Health, Bethesda, Maryland
Received August 1, 2005; accepted January 4, 2006
| Abstract |
|---|
|
|
|---|
Functional cloning and retroviral cDNA libraries have been applied to define genes responsible for drug resistance, apoptosis, and so forth (Perez-Victoria et al., 2003
; Mourtada-Maarabouni et al., 2004
). In identifying genes related to cisplatin resistance, the approaches that have been used have a major drawback because of continuous stepwise challenge with increased cisplatin concentrations and may reflect secondary changes in genotype and phenotype during multistep selection of cisplatin-resistant cells. To explore genes primarily involved in cisplatin resistance, we inserted double-stranded cDNA into a retroviral expression vector, pLNCX2, from cisplatin-resistant KB-CP.5 cells that were selected by a single step of cisplatin at 0.5 µg/ml. An intermittent cisplatin selection procedure was designed for functional cloning, and subsequent identification of genes related to cisplatin resistance was obtained by PCR and sequencing. By this technique, 11 genes were found in the individual clones after functional cloning, including metallothionein, which has been reported to be associated with cisplatin resistance (Kelly et al., 1988
), and a chaperone, 10-kDa heat shock protein (HSP10), which had been found previously to be inducible by a metal salt, cadmium chloride (Lee et al., 2002
). A ribosomal protein, RPL36, was identified in this work, and in a second independent transfection, it was shown to confer
2.5-fold increased CP-r on transfected stable clones in comparison with the control vector-only-transfected cells. Therefore, this functional retroviral cloning system and modified intermittent selection provides a powerful tool for further cloning of genes able to confer CP-r.
| Materials and Methods |
|---|
|
|
|---|
Construction of a Retroviral cDNA Library. Double-stranded cDNA was synthesized from a single-step selection of the cisplatinresistant cell line KB-CP.5, which was maintained in medium containing cisplatin 0.5 µg/ml using a BD SMART cDNA library construction kit (Clontech) as described by the manufacturer. The synthesized double-stranded cDNA was digested with the restriction enzyme Sfi and then column-purified by a CHROMA SPIN-400. The lower cutoff cDNA size was 500 bp. Ligation of the Sfi-digested double-stranded cDNA to a retroviral expression vector pLNCX2 (Clontech) with Sfi-cut was performed according to the manufacturer's instructions, and the library was named KB-CP.5/pLNCX2. The retroviral cDNA library was transformed into DH5
competent cells (Invitrogen) and resulted in 1.8 x 106 clones (library complexity).
Retroviral Transduction and Programmed Cisplatin Selection. Retroviral supernatants were collected from KB-CP.5/pLNCX2-transfected retroviral packaging PT67 cells and then used to infect the recipient KB-3-1 cells. After selection with G418, a pool of 96,000 clones containing the KB-CP.5 cDNA was established. A programmed selection with cisplatin is shown in detail in Fig. 1B.
|
Preparation of RNA, and RT-PCR. For the determination of expression levels of genes of interest, RNAs were isolated from cells using an RNeasy kit (QIAGEN, Valencia, CA) according to the manufacturer's instructions. RT-PCR was performed using a GeneAmp kit (Applied Biosystems, Foster City, CA) according to the manufacturer's instructions. Specific primers for tested genes are listed below: ribosomal protein RPL36, 5'-AAATCCATTGCCCGTGTTC-3' (forward), and 5'-TCTTGGTCTTCAGGTTCTCC-3' (reverse); heat shock protein HSP10, 5'-AAGTTTCTTCCACTCTTTGACC-3' (forward) and 5'-TGAATCTCTCCACCCTTTCC-3' (reverse);
-catenin, GAGAGTGTGCTGAAGATTCTG (forward), and TGATTCGTCCTTGTCACC (reverse), which were used for verification of the quality and the size of genes in the library by PCR.
Gene Transfection and Assays of Cell Resistance Levels to Cisplatin, Carboplatin, and Sodium Arsenite. Full-length cDNA for the genes encoding RPL36 and HSP10 were purchased from the American Type Culture Collection (Manassas, VA). Both genes were inserted into a mammalian expression vector, pcDNA3.1 (Invitrogen), as described by the manufacturer. Gene transfection was done with Lipofectin (Invitrogen) by following the manufacturer's instructions. Stable transfected clones were isolated after selection with G418. For testing cell sensitivities to cisplatin, carboplatin, and sodium arsenite, cells were counted after 3 days using a Coulter Counter or Cell Counting Kit (CCK8; Dojindo Labs, Gaithersburg, MD) as described in the legend to Fig. 3. A clonogenic assay was used to further confirm the ability to confer CP-r for the positive genes, such as RPL36 and HSP10. Cells were seeded into 60-mm dishes (Corning Glassworks, Corning, NY). Cisplatin at a desired concentration was introduced into each dish before cell seeding. The medium was replaced every 3 days with medium containing cisplatin at the desired concentration. Colonies were stained with methylene blue at the end of 12 days of incubation and then counted. Control cells were transfected with insert-free vector only. The values are the means of triplicate determinations.
|
| Results |
|---|
|
|
|---|
. The titer of the unamplified library was
3 x 1011 colony-forming units/ml. The quality and insert size of the library is shown in Fig. 2A using the primers for pLNCX2 as described under Materials and Methods, indicating a distribution range of the inserts from 0.5 to 6 kb and enriched between 0.7 and 1.8 kb. To determine whether there were larger intact genes in this library,
-catenin, a known cDNA of 2.3 kb, was generated by PCR amplification and showed a full-length cDNA in the library (Fig. 2B).
|
The RetroPack PT67 cell line was used to package the library. This cell line expresses a dual-tropic/polytropic envelope, and the virus produced can infect a broad range of mammalian cells. The viral titer was determined by functional assay (G418 resistance) and resulted in 570 colony-forming units/ml. Transfection of the KB-CP.5 cDNA retroviral library into PT67 cells yielded 115,000 neo-r colonies after G418 selection (Fig. 1A). The viral medium (K-VM) was collected from these cells and then infected into the target KB-3-1 cells. A pool containing 93,000 neo-r clones was obtained after G418 selection (Fig. 1A). A control pool with 2000 neo-r clones was collected (Fig. 1C) using the vector only without inserts.
An intermittent cisplatin selection was developed in this work as shown in Fig. 1B. In brief, cells were intermittently selected with cisplatin at 0.6 µg/ml for 3 days and then cultured in medium without the drug for another 3 days for recovery. A second round of 3 days of cisplatin selection followed by a recovery period of 3 days was repeated. Cisplatin-resistant colonies appeared after a period of 12 days, and much larger colonies were seen in the group of KB-3-1 cells infected with the viral medium from the KB-CP.5/pLNCX2 cDNA retroviral library (K-VM), whereas the control cells, which were infected with the viral medium from the vector without inserts, showed much smaller colonies (VM). One hundred twelve individual colonies that survived in the K-VM group were cloned and propagated in 0.4 µg/ml cisplatin for genomic DNA preparation and further PCR determination. We tried to select cells continuously with cisplatin at different concentrations, but this approach was unsuccessful because of either cells being killed at high concentrations of cisplatin or spontaneously mutated at low concentrations, generating a high background of low-level cisplatin-resistant clones similar to the control. Therefore, a recovery period during the first two rounds of cisplatin selection seems to be important for functional gene cloning, particularly under the conditions described above.
Identification of Genes in Association with Cisplatin Resistance. All 112 cisplatin-resistant clones were analyzed by genomic PCR using the primers for the retroviral vector pLNCX2 as described under Materials and Methods (i.e., only the inserts containing the vector sequences at both ends could be detected in the clones). Figure 2C shows fragment(s) of different sizes from 0.5 to 1 kb in these clones. After sequencing, 11 inserts were identified after BLAST match and are listed in Table 1. Metallothionein 2A was 1 among the 11 genes observed, and this gene had been reported to be associated with resistance to cisplatin and other heavy metals (Kelly et al., 1988
; Yang et al., 1994
), demonstrating that the strategy applied in this work by functional cloning and using a retroviral cDNA library has the power to identify genes related to cisplatin resistance. It should be noted that there were several ribosomal protein genes in this pool, suggesting that overexpression of the ribosomal gene family might also play an important role in protecting cells from cisplatin-induced damage.
|
We chose a ribosomal protein, L36 (RPL36), and a chaperone gene, HSP10, in our pool to evaluate whether these two genes have roles in CP-r. Both RPL36 and HSP10 genes were inserted into a mammalian expression vector, pcDNA3.1, respectively, and then transfected into cisplatin-sensitive (CP-s) KB-3-1 cells separately. Individual clones were isolated from the transfectants after G418 selection. Figure 3A shows that the RPL36 gene (middle) was overexpressed in two clones of RPL36-transfected cells, KB/RPL36.C6 and KB/RPL36.C10. Both of the control cells (KB/V), which were transfected with vector only, and another transfected clone KB/HSP10.C2 showed much lower levels of the gene. At the top of the figure, HSP10 was well-expressed in KB/HSP10.C2 cells, which were transfected with the HSP10 gene (approximately 2-fold higher than the control KB/V), and in two other clones isolated from the RPL36 transfection. At the bottom are shown similar expression levels of
-actin in these four clones, serving as loading controls.
The sensitivities of these clones to cisplatin were then determined by a clonogenic assay. The results are shown in Fig. 3, B and C. Increased resistance to cisplatin (approximately 2.5
3-fold) was seen in the transfectants of RPL36, clones C6 and C10, and HSP10, clone C2, compared with the control vector-transfected only (Fig. 3C). In Fig. 3C, the amount and size of colonies in the clones expressing RPL36, clones C6 and C10 (c and d) or HSP10, clone C2 (b), were more numerous and larger than with the control vector only (a) after exposure to cisplatin 0.3 µg/ml for 12 days. These results demonstrate that, where overexpressed, the ribosomal protein RPL36 and the heat shock protein HSP10 may play roles in cisplatin resistance.
| Discussion |
|---|
|
|
|---|
In this work, two genes, a ribosomal protein (RPL36) and a heat shock protein (HSP10), were identified to confer cisplatin resistance by 2.5- to 3-fold using a retroviral cDNA library and functional cloning. Although the function of these two genes in CP-r is unknown, their effect may plausibly be related to increased protein synthesis and protein stabilization to protect cells from the toxic effect of cisplatin, directly or indirectly, in association with the regulation of proteins in DNA damage/repair, antiapoptotic processes, or detoxification of cisplatin. We repeated the selection using a somewhat different protocol by which cells were selected with 1 µg/ml cisplatin for 24 h, instead of intermittent exposure for a longer period of time, and then were allowed to recover with drug for a period of 8 to 10 days until cloning. By this method, we further isolated more RPL36-related genes, such as RPL36aL, found in 4 individual clones from a pool of 30 (Table 1, last entry). RPL36aL has 90% identity with the coding region of the RPL36 gene. This result provides independent evidence that the selection of the RPL36 gene family members is not a random event but reflects their association with CP-r. None of the transfected clones, however, were cross-resistant to carboplatin or sodium arsenite, as shown in Fig. 3, D and E, respectively. This does not necessarily indicate a different mechanism of resistance, because the original parent cell line, KB-CP.5, was more resistant to cisplatin (up to 50-fold), whereas the RPL36 and HSP10 transfectants showed only 2.5- to 3-fold resistance.
None of the cDNAs isolated so far from the cDNA library made from these cells confers this phenotype on the full range of resistance seen in the KB-CP.5 cells. We assume, therefore, that this phenotype either results from expression of more than one gene or that we have transfected genes whose overexpression confers CP-r by a mechanism different from that seen in KB-CP.5.
The 10-, 27-, 60-, and 70-kDa heat shock proteins and others have been linked to stress response in protein folding and unfolding in drug resistance (Mandic et al., 2002
; Shan et al., 2003
; Zhao et al., 2005
). Ribosomal proteins have been reported recently to be associated with the regulation of apoptosis, multidrug resistance (Wendel et al., 2004
), oncogenesis, and chemotherapy (Zhang and Berger, 2004
). Transfection of the ribosomal protein RPL23 into gastric cancer cells was reported to induce multidrug resistance, including CP-r, and to protect cells against vinblastine-induced DNA fragmentation but had no effect on intracellular drug accumulation (Shi et al., 2004
). Our finding in this work provides evidence that overexpression of RPL36 and HSP10 confers CP-r in KB-3-1 cells but does not confer resistance to sodium arsenite. The pattern of genes selected by cisplatin may reflect stress responses and cisplatin-specific resistance genes. Further functional cloning by selection with other agents, including carboplatin, would help to determine which genes are involved in general stress responses and which are unique to cisplatin.
Other genes were detected in the clones (Table 1), but RPS27, RPL41, and nucleolar protein family A, member 2, were tested individually and did not confer CP-r as shown in Fig. 3, F and G, respectively. Either these genes are not sufficient to confer CP-r but may be necessary in the context of other patterns of gene expression or they were simply false-positive results from the screen applied here where the background (vector alone) was not 0. The other genes listed in Table 1 could not be tested initially because full-length cDNAs were not readily available. Nevertheless, these results indicate that the functions of RPL36 and HSP10 in CP-r cells and their potential role in human cancers need to be further elucidated.
| Acknowledgements |
|---|
| Footnotes |
|---|
ABBREVIATIONS: HSP10, 10-kDa heat shock protein; RPL36, ribosomal protein L36; CP-r, cisplatin resistance; PCR, polymerase chain reaction; kb, kilobase(s); RT-PCR, reverse transcription-polymerase chain reaction.
Address correspondence to: Dr. Michael M. Gottesman, Laboratory of Cell Biology, National Cancer Institute, National Institutes of Health, 37 Convent Dr., Room 2108, Bethesda, MD 20892-4254. E-mail: mgottesman{at}nih.gov
| References |
|---|
|
|
|---|
Gottesman MM, Fojo T, and Bates SE (2002) Multidrug resistance in cancer: role of ATP-dependent transporters. Nat Rev Cancer 2: 48-58.[CrossRef][Medline]
Kelly SL, Basu A, Teicher BA, Hacker MP, Hamer DH, and Lazo JS (1988) Overexpression of metallothionein confers resistance to anticancer drugs. Science (Wash DC) 241: 1813-1815.
Lee MJ, Nishio H, Ayaki H, Yamamoto M, and Sumino K (2002) Upregulation of stress response mRNAs in COS-7 cells exposed to cadmium. Toxicology 174: 109-117.[CrossRef][Medline]
Liang XL, Shen DW, Garfield S, and Gottesman MM (2003) Mislocalization of membrane proteins associated with multidrug resistance in CP-r cancer cell lines. Cancer Res 63: 5909-5916.
Mandic A, Hansson J, Linder S, and Shoshan MC (2002) Cisplatin induces endoplasmic reticulum stress and nucleus-independent apoptotic signaling. J Biol Chem 278: 9100-9106.
Miller MA, Korn D, and Wang TS (1988) The evolutionary conservation of DNA polymerase alpha. Nucleic Acids Res 16: 7961-7973.
Mourtada-Maarabouni M, Kirkham L, Farzaneh F, and Williams GT (2004) Regulation of apoptosis by fau revealed by functional expression cloning and antisense expression. Oncogene 23: 9419-9426.[CrossRef][Medline]
Niedner H, Christen R, Lin X, Kondo A, and Howell SB (2001) Identification of genes that mediate sensitivity to cisplatin. Mol Pharmacol 60: 1153-1160.
Perez-Victoria FJ, Gamarro F, Ouellette M, and Castanys S (2003) Functional cloning of the miltefosine transporter. A novel P-type phospholipid translocase from Leishmania involved in drug resistance. J Biol Chem 278: 49965-49971.
Roberts D, Schick J, Conway S, Biade S, Laub PB, Stevenson JP, Hamilton TC, O'Dwyer PJ, and Johnson SW (2005) Identification of genes associated with platinum drug sensitivity and resistance in human ovarian cancer cells. Br J Cancer 92: 1149-1158.[CrossRef][Medline]
Shan YX, Liu TJ, Su HF, Samsamshariat A, Mestril R, and Wang PH (2003) Hsp10 and Hsp60 modulate Bcl-2 family and mitochondria apoptosis signaling induced by doxorubicin in cardiac muscle cells. J Mol Cell Cardiol 35: 1135-1143.[CrossRef][Medline]
Shen DW, Akiyama S-I, Schoenlein P, Pastan I, and Gottesman MM (1995) Characterization of high-level cisplatin-resistant cell lines established from a human hepatoma cell line and human KB adenocarcinoma cells: cross-resistance and protein changes. Br J Cancer 71: 676-683.[Medline]
Shen DW, Su A, Liang XJ, Pai-Panandiker A, and Gottesman MM (2004) Reduced expression of small GTPases and hypermethylation of the folate binding protein gene in cisplatin-resistant cells. Br J Cancer 91: 270-276.[CrossRef][Medline]
Shi Y, Zhai H, Wang X, Han Z, Liu C, Lan M, Du J, Guo C, Zhang Y, Wu K, et al. (2004) Ribosomal proteins S13 and L23 promote multidrug resistance in gastric cancer cells by suppressing drug-induced apoptosis. Exp Cell Res 296: 337-346.[CrossRef][Medline]
Wang D and Lippard SJ (2005) Cellular processing of platinum anticancer drugs. Nat Rev Drug Discov 4: 307-320.[CrossRef][Medline]
Wendel HG, De Stanchina E, Fridman JS, Malina A, Ray S, Kogan S, Cordon-Cardo C, Pelletier J, and Lowe SW (2004) Survival signalling by Akt and eIF4E in oncogenesis and cancer therapy. Nature (Lond) 428: 332-337.[CrossRef][Medline]
Yang YY, Woo ES, Reese CE, Bahnson RR, Saijo N, and Lazo JS (1994) Human metallothionein isoform gene expression in cisplatin-sensitive and resistant cells. Mol Pharmacol 45: 453-460.[Abstract]
Yasui K, Mihara S, Zhao C, Okamoto H, Saito-Ohara F, Tomida A, Funato T, Yokomizo A, Naito S, Imoto I, et al. (2004) Alteration in copy numbers of genes as a mechanism for acquired drug resistance. Cancer Res 64: 1403-1410.
Zhang Y and Berger SA (2004) Increased calcium influx and ribosomal content correlate with resistance to endoplasmic reticulum stress-induced cell death in mutant leukemia cell lines. J Biol Chem 279: 6507-6516.
Zhao R, Davey M, Hsu YC, Kaplanek P, Tong A, Parsons AB, Krogan N, Cagney G, Mai D, Greenblatt J, et al. (2005) Navigating the chaperone network: an integrative map of physical and genetic interactions mediated by the hsp90 chaperone. Cell 120: 715-727.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
C. Liao, B. Hu, M. J. Arno, and B. Panaretou Genomic Screening in Vivo Reveals the Role Played by Vacuolar H+ ATPase and Cytosolic Acidification in Sensitivity to DNA-Damaging Agents Such as Cisplatin Mol. Pharmacol., February 1, 2007; 71(2): 416 - 425. [Abstract] [Full Text] [PDF] |
||||
![]() |
E Tiligada Chemotherapy: induction of stress responses Endocr. Relat. Cancer, December 1, 2006; 13(Supplement_1): S115 - S124. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||