QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) All Versions of this Article: mol.105.021352v1 69/6/1810    most recent Submit a response Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Zhang, L. Articles by Law, P.-Y. Search for Related Content PubMed PubMed Citation Articles by Zhang, L. Articles by Law, P.-Y.

Short- and Long-Term Regulation of Adenylyl Cyclase Activity by -Opioid Receptor Are Mediated by G_i2 in Neuroblastoma N₂A Cells

Department of Pharmacology, Medical School, University of Minnesota, Minneapolis, Minnesota

Received November 30, 2005; accepted March 8, 2006

	Abstract

Top Abstract Materials and Methods Results Discussion References

 
Activation of the opioid receptor results in short-term inhibition of intracellular cAMP levels followed by receptor desensitization and subsequent increase of cAMP above the control level (adenylyl cyclase superactivation). Using adenovirus to deliver pertussis toxin-insensitive mutants of the -subunits of G_i/o that are expressed in neuroblastoma Neuro2A cells (G_i2, G_i3, and G_o), we examined the identities of the G proteins involved in the short- and long-term action of the -opioid receptor (DOR). Pertussis toxin pretreatment completely abolished the ability of [D-Pen², D-Pen⁵]-enkephalin (DPDPE) to inhibit forskolin-stimulated intracellular cAMP production. Expression of the C352L mutant of G_i2, and not the C351L mutants of G_i3 or G_o, rescued the short-term effect of DPDPE after pertussis toxin treatment. The ability of G_i2 in mediating DOR inhibition of adenylyl cyclase activity was also reflected in the ability of G_i2, not G_i3 or G_o, to coimmunoprecipitate with DOR. Coincidently, after long-term DPDPE treatment, pertussis toxin treatment eliminated the antagonist naloxone-induced superactivation of adenylyl cyclase activity. Again, only the C352L mutant of G_i2 restored the adenylyl cyclase superactivation after pertussis toxin treatment. More importantly, the C352L mutant of G_i2 remained associated with DOR after long-term agonist and pertussis toxin treatment whereas the wild-type G_i2 did not. These data suggest that G_i2 serves as the signaling molecule in both DOR-mediated short- and long-term regulation of adenylyl cyclase activity.

The heterotrimeric G proteins serve as central signaling molecules connecting cellular signals transduced from opioid receptors. Involvement of G_i/o protein subunits (G_i1, G_i2, G_i3, and G_o) in AC superactivation is clearly indicated by the ability of pertussis toxin (PTX) to block this response (Avidor-Reiss et al., 1995; Fields and Casey, 1997; Connor and Christie, 1999; Nevo et al., 2000). However, the specific G subunit(s) responsible and by what means it regulates AC superactivation are still unresolved. Tso and Wong (2000a,b, 2001) reported that in HEK293 cells stably expressing µ-opioid receptors (MOR), AC superactivation induced by long-term µ-agonist treatment cannot be supported by either G_z (Tso and Wong, 2000b), G_i2 (Tso and Wong, 2000a), G_i1, or G_i3 (Tso and Wong, 2001) individually. On the other hand, G_o has been suggested to be responsible for MOR-induced AC superactivation in C6 glioma cells (Clark et al., 2004). However, in these studies, systems were pretreated with PTX before long-term agonist exposure. The blunting of the long-term response could be the result of the absence of initial receptor signals being transduced.

To address these questions on the identity of G proteins involved in both short-term inhibition and superactivation of AC activity, we use adenovirus to deliver the individual PTX-insensitive G_i/o -subunit mutant to neuroblastoma Neuro2A cells (N₂A) stably expressing -opioid receptor (DOR). It can be demonstrated that only the G_i2 and not G_i3 or G_o mutant could rescue the DPDPE induced inhibition of adenylyl cyclase activity after PTX pretreatment. Coincidentally, after long-term DPDPE treatment, only the G_i2 mutant could restore AC superactivation after PTX treatment. More importantly, only G_i2 and not G_i3 or G_o coimmunoprecipated with DOR. Therefore, the same G_i2 mediates both short-term inhibition and long-term superactivation of adenylyl cyclase activity.

	Materials and Methods

Top Abstract Materials and Methods Results Discussion References

 
Mutagenesis of PTX-Resistant G_i/o. Point mutations were accomplished using QuikChange site-directed mutagenesis methods as outlined by Stratagene (La Jolla, CA). Previous studies indicated that substitution of the cysteine (Cys) residue within the CAXX motif of the G_i/o -subunit with leucine (Leu) resulted in full efficacy of the mutant to transduce receptor signal (Bahia et al., 1998). Hence, the Cys³⁵¹ of G_i3 and G_o or Cys³⁵² of G_i2 was mutated to Leu. Point mutation primers were designed as follows: for G_i2, 5'-GAACAACCTGAAGGACCTAGGCCTCTTCTGAGGG-3'; for G_i3, 5'-CAACTTAAAGGAGCTCGGGCTTTACTGAGAG-3'; and for G_o, 5'-CAACAATCTCCGGGGCCTAGGCTTGTACTGACC-3'.

Adenovirus Construction. G_i2, G_i3, or G_o mutant was cloned into pShuttle-CMV vector (Stratagene) following the manufacturer's protocol. In brief, the recombinant plasmids were cotransformed with pAdEasy-1 into BJ 5183 cells by electroporation. The positive adeno-G_i2-Leu, adeno-G_i3-Leu, or adeno-G_o-Leu plasmid was transfected into HEK293 cells. The virus was harvested and amplified by repeatedly infecting HEK293 cells. The titer of virus was determined using the Adeno-X Rapid Titer Kit (Clontech, Mountain View, CA). The viruses used in current studies have titers from 3.0 to 8.0 x 10⁸ plaque-forming units/ml.

RT-PCR. Total RNA of N₂A cells was isolated using Tri Reagent (Molecular Research Center, Cincinnati, OH) according to the manufacturer's instructions. RNA samples were then treated with DNase I (Ambion, Austin, TX). Reverse transcription reaction (RT) was performed using First Strand cDNA Synthesis Kit (Roche Applied Science, Indianapolis, IN) according to the manufacturer's recommendations and 0.5 µg of DNase I-treated total RNA was added to each RT reaction. For each PCR reaction, 2 µl of RT reaction solution and 2 units of Taq DNA Polymerase (Roche Applied Science) was added to a final 50-µl scale. The PCR conditions were as follows: 2 min at 94°C and then 15 s at 94°C, 30 s at 60°C (53°C for G_i1 and G_oA), 30 s at 72°C for 25 cycles (35 cycles for G_i1 and G_oA), and 10 min at 72°C. The PCR primers for each specific G subunit were designed as follows: G_i1: forward, ATGAACCGAATGCATGAGAGCA; reverse, GTCCTT CCTTTTATTGAGGTCT; G_i2: forward, GCCAACAAGTACGACGAGGCA; reverse, GTATCTCTCACGCTTCTTGTGCT; G_i3: forward, ATGAACCGAATGCATGAGAGCA; reverse, TTTGGTGTCAGTG GCACAGGTA; G_oA: forward, CCCGTAGATTTTTGGCGATGA; reverse, CCGCATGCACGAGTCTCTCAT; G_oB: forward, CCCGTAGGT TTTTGGCGATGA; reverse, CATGCACGAATCCCTGAAGC.

Cell Culture and Virus Infection. N₂A cells stably expressing mouse DOR with hemagglutinin (HA) tagged at the N terminus were used in this study. Cells were cultured at 37°C in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum, 15 mM glucose, 0.43 M NaHCO₃, 100 units/ml penicillin, 100 µg/ml streptomycin (Invitrogen, Carlsbad, CA) and 1 mg/ml G418 (Geneticin; Invitrogen) in a 10% CO₂ incubator. Each T-75 cm² flask of cells at 70% confluence was infected with adeno-GFP (Gene Transfer Vector Core, The University of Iowa), adeno-G_i2-Leu, adeno-G_i3-Leu, or adeno-G_o-Leu viruses using Superfect transfection reagent (QIAGEN) according to the manufacturer's instructions, with a cell-to-virus ratio of 1:100. After 48 h, cells were harvested for Western blotting and immunoprecipitation experiments. For the DOR-mediated regulation of intracellular cAMP level, cells were seeded to 96-well plates 30 h after virus infection and cultured for another 18 h before cAMP assay.

cAMP Assay. For short-term DPDPE inhibition assay, cells were seeded on a 96-well plate for 18 h, culture medium was removed, and the cells were placed on ice. Then, 100 µl of incubation buffer with or without DPDPE was added to each well. The incubation buffer consisted of 0.5 mM 3-isobutyl-1-methylxanthine and 10 µM forskolin in Krebs-Ringer-HEPES buffer (110 mM NaCl, 25 mM glucose, 55 mM sucrose, 10 mM HEPES, 5 mM KCl, 1 mM MgCl₂, and 1.8 mM CaCl₂, pH 7.4). The assays were initiated by incubating the cells at 37°C for 15 min and then terminated by placing the plates in a water bath at 85°C for 6 min to lyse the cells and release the intracellular cAMP. The cAMP level was measured by using the AlphaScreen cAMP Detection Kit (BioSignal, Montreal, QC, Canada) and Biomek 2000 Laboratory Automation Workstation (Beckman Coulter, Fullerton, CA) as described previously (Qiu et al., 2003). For the experiments in which pertussis toxin (List Biological Laboratories Inc., Campbell, CA) was used, 100 ng/ml PTX was added to the culture medium, and cells were incubated 12 h before the cAMP assay. For long-term DPDPE treatment assay, 1 µM DPDPE was added to the culture medium for 18 h to completely desensitize the short-term response to DOR activation. Six hours before cAMP assays, or 12 h after the initiation of DPDPE treatment, PTX was added to the designated 96-well plates. Culture medium was aspirated, cells were washed with DMEM at 37°C once, and then 100 µl of treatment buffer with or without naloxone was added. After incubation at 37°C for 15 min, reactions were terminated by incubating at 85°C for 6 min and cAMP level in each well was measured as described previously.

Cell Membrane Purification, Immunoprecipitation, and Western Blotting. Cells from one T-75 cm² flask were harvested and the pellet was frozen at -80°C for at least 30 min. Five milliliters of ice-cold TEP buffer (50 mM Tris, pH 7.0, 2.5 mM EDTA, and 0.1 mM phenylmethylsulfonyl fluoride) was added and the mixture was allowed to incubate on ice for 15 min. The cell suspension was homogenized with a Dounce homogenizer for 10 strokes with pestle A and was centrifuged at 2500 rpm for 10 min. The resulting supernatant was transferred to a new tube and the pellet was resuspended in 2.5 ml of TEP buffer. The homogenization and centrifugation processes were repeated. The two supernatants were combined and centrifuged at 34,000 rpm for 1 h (Beckman rotor Ti80). The final supernatant was discarded, and the pellet was used for immunoprecipitation or Western blotting experiments. For immunoprecipitation, cells from one T-75 cm² flask of N₂A cells were treated either with or without 100 ng/ml PTX for 6 h, with 1 µM DPDPE for 18 h, or with 1 µM DPDPE for 12 h, then 100 ng/ml PTX was added during the last 6 h of DPDPE treatment. Cells were then collected and membranes were purified as described above. Membrane pellet was suspended in 1 ml of extraction buffer [100 mM NaCl, 10 mM Tris, pH 7.4, 5 mM EDTA, 1% digitonin (Sigma), 1 x Complete Protease Inhibitor Cocktail (Roche Applied Science)] and rotated slowly at 4°C overnight. Then the extract was centrifuged at 15,000 rpm for 20 min, and the resulting supernatant was diluted with 15 ml of buffer A (100 mM NaCl and 10 mM Tris, pH 7.4). The diluted supernatant was concentrated to 2 ml with Centriplus YM-30 (Millipore Corporation, Billerica, MA). To the concentrated solution, mouse monoclonal anti-HA antibody (1:200; Covance, Princeton, NJ) was added, and the mixture was incubated at 4°C overnight with slow rotation. Sixty microliters of protein G agarose beads (Invitrogen) was added, and the mixture was incubated at 4°C for 3 h with slow rotation. The protein G agarose beads were then pelleted by centrifuging at 15,000 rpm for 15 min at 4°C and were washed 5 times with buffer A. Protein samples were eluted from the beads with 1x SDS sample buffer (75 mM Tris, pH 6.8, 100 mM dithiothreitol, 2% SDS, 0.1% bromphenol blue, and 10% glycerol), and the samples were heated at 65°C for 5 min. Proteins in the samples were resolved by 12% SDS-polyacrylamide gel electrophoresis and electrophoretically transferred to polyvinylidene difluoride membranes (0.45 µm; Millipore). The membrane was blocked overnight at 4°C in a blocking solution (10% powdered nonfat milk in 0.1% Tris-buffered saline/Tween 20 (0.1% Tween 20, 25 mM Tris, and 150 mM NaCl, pH 7.6) and was then probed by anti-G_i2, anti-G_i3 (Roerig et al., 1992), or anti-G_o (New England Biolabs) antibodies (1:1000) for 1 h at room temperature in the blocking solution. After washing three times of 15 min each with 0.1% Tris-buffered saline/Tween 20, the membrane was probed with goat anti-rabbit secondary antibody conjugated with alkaline phosphatase (1:5000; Bio-Rad) for 1 h in the same blocking solution. The G_i2,G_i3,orG_o bands were detected by ECF substrate (GE Healthcare, Little Chalfont, Buckinghamshire, UK) and scanned by the Storm 860 imaging system (GE Healthcare). The band intensities were quantified and analyzed with the ImageQuant software (GE Healthcare).

View larger version (20K): [in this window] [in a new window]   Fig. 1. RT-PCR analysis showing the expression of Gi1,Gi2,Gi3,GoA, and GoB in N2A cells. The relative transcript levels of various Gi/o -subunits were determined by RT-PCR as described under Materials and Methods. Ten microliters of each PCR reaction (50 µl) was resolved on 1.5% NuSieve CTG agarose gel (Intermountain Scientific/BioExpress, Kaysville, UT) run in Tris-borate/EDTA buffer. The positions of molecular markers are indicated on the left side.

	Results

Top Abstract Materials and Methods Results Discussion References

Expression Pattern of Different G_i/o Subunits in N₂A Cells.

View larger version (30K): [in this window] [in a new window]   Fig. 2. Expression of PTX-resistant adeno-Gi2-leu, adeno-Gi3-leu, and adeno-Go-leu mutants in N2A cells. A, adenovirus infection efficiency of N2A cells. N2A cells were cultured on six-well plates to 70% confluence and were infected with adeno-GFP in the absence (-) or in the presence (+) of transfection reagent Superfect (QIAGEN) following the manufacturer's recommendations. A cell-to-virus ratio of 1:100 was used in the studies. Left, phase contrast views; right, fluorescence images of GFP. Images were taken after 48 h of virus infection using a Leica DMIRE2 microscope system (Leica Co.) with a 40x objective. B, Western analysis of adeno-Gi2-leu, adeno-Gi3-leu, and adeno-Go-leu mutants expressed in N2A cells. Similar to the studies summarized in A, N2A cells were infected with a cell-to-virus ratio of 1:100. On the left, cells were infected with adeno-GFP; on the right, cells were infected with individual mutants as indicated. In each sample, 50 µg of cell membrane extracts was loaded. The G bands were probed by specific anti-Gi2, Gi3, or Go antibodies (1:1000). C, the relative density of each G mutant subunits expressed in N2A cells. The relative density of the G in N2A cells infected with respective mutant was compared with that in cells infected with adeno-GFP (control). The density of control bands was designated as 100%. The white, shaded, and black bars represent the relative densities of adeno-Gi2-leu, adeno-Gi3-leu, and adeno-Go-leu mutants, respectively, compared with the control (n = 2).

Expression of PTX-Resistant Adeno-G_i2-Leu, Adeno-G_i3-Leu, and Adeno-G_o-Leu Mutants in N₂A Cells.

The Identity of the G Protein Involved in DOR Short-Term Inhibition of Adenylyl Cyclase Activity. To determine the identity of the G protein involved in DOR regulation of AC activity in N₂A cells, the ability of the PTX-insensitive mutants to restore DPDPE inhibition was investigated. As summarized in Fig. 3 and Table 1, overexpression of the PTX-insensitive G mutants affected neither the potency nor the maximal inhibition level of DPDPE. From the DPDPE concentration-dependent inhibition of forskolin-stimulated cAMP production in N₂A cell studies, the maximal inhibition levels were calculated to be 63 ± 2.7% (n = 4) for cells infected with GFP-adenovirus, and in G_i/o mutant-expressing cells, 61 ± 2.4% (n = 4) for cells infected with adeno-G_i2-leu, 62 ± 2.6% (n = 4) for cells infected with adeno-G_i3-leu, and 64 ± 2.5% (n = 4) for cells infected with adeno-G_o-leu. PTX-pretreatment totally abolished the DPDPE-induced inhibition effect on cAMP accumulation in control cells, adeno-G_i3-leu-, and adeno-G_o-leu-expressing cells. It is noteworthy that the inhibition effect of cAMP accumulation can still be observed after PTX-pretreatment only in adeno-G_i2-leu mutant expressing cells (41 ± 3.1%, n = 4; Fig. 3B). The potency of DPDPE in N₂A cells overexpressing the adeno-G_i2-leu mutant after PTX pretreatment was not significantly different from that of control cells without PTX treatment (Table 1). The inability of other PTX-insensitive G mutants to restore the DPDPE inhibition of AC activity in N₂A cells could not be caused by low expression of these G mutants, because a similar level of increase in the adeno-G_i3-leu, compared with that of adeno-G_i2-leu, was observed 48 h after virus infection as determined by Western analysis (Fig. 2). Similar results were observed in cells that express DOR endogenously, such as neuroblastoma x glioma hybrid NG108-15 and neuroblastoma NIE115 cells. The maximal inhibition levels were calculated to be 60 ± 3.5% and 58 ± 2.5% (n = 2) for NG108-15 and NIE115 cells infected with GFP-adenovirus and, in G_i/o mutant-expressing cells, 53 ± 2.8% and 58 ± 3.0% (n = 2), respectively, for cells infected with adeno-G_i2-leu, 55 ± 1.4% and 55 ± 6.0% (n = 2), respectively, for cells infected with adeno-G_i3-leu, and 59 ± 1.6% and 55 ± 3.7% (n = 2), respectively, for cells infected with adeno-G_o-leu, in NG108-15 (Fig. 4A) and NIE115 cells (Fig. 4B). PTX pretreatment totally abolished the DPDPE-induced inhibition effect on cAMP accumulation in control cells, adeno-G_i3-leu-, and adeno-G_o-leu-expressing cells. But the DPDPE inhibition effect of cAMP accumulation can still be observed after PTX pretreatment only in adeno-G_i2-leu mutant expressing cells (55 ± 3.0% and 61 ± 4.8%, n = 2, in NG108-15 and NIE115 cells, respectively). The potencies of DPDPE in these cells over-expressing the adeno-G_i2-leu mutant after PTX pretreatment (1.7 ± 0.6 and 1.5 ± 0.3 nM for NG108-15 and NIE115 cells, respectively) was not significantly different from those of control cells without PTX treatment (0.7 ± 0.2 and 0.6 ± 0.1 nM for NG108-15 and NIE115 cells, respectively). Thus, similar to reports using G protein -subunit selective antibodies (McKenzie and Milligan, 1990), DOR inhibition of AC activity is mediated via the G_i2 subunit in N₂A cells heterologously expressing DOR or in NG108-15 and NIE115 cells endogenously expressing the receptor.

View larger version (22K): [in this window] [in a new window]   Fig. 3. Gi2 involves in short-term DPDPE inhibition of forskolin-stimulated intracellular cAMP production. N2A cells were infected in a cell versus virus ratio of 1:100 with adeno-GFP (A), adeno-Gi2-leu (B), adeno-Gi3-leu (C), and adeno-Go-leu (D) mutants and were pretreated with PTX (100 ng/ml, 12 h, ) or without PTX (). The abilities of various concentrations of DPDPE to inhibit the 10 µM forskolin-stimulated intracellular cAMP production were determined as described under Materials and Methods. The values represent averages of the concentration-dependent curves generated from four separate virus infection experiments with triplicate determinations for each agonist concentration.

View this table: [in this window] [in a new window]   TABLE 1 The ability of various Gi/o -subunit mutants to rescue the DPDPE inhibition of forskolin-stimulated intracellular cAMP production in N2A cells after PTX treatment N2A cells were infected with respective adenoviruses as described under Materials and Methods. Thirty-six hours later, the cells were then treated with 100 ng/ml of PTX for 12 h before cAMP measurement. Then the ability of various concentrations of DPDPE to inhibit 10 µM forskolin-stimulated intracellular cAMP production was determined. The IC50 values represent the average and S.D. from four separate experiments. Values in parentheses represent the maximal DPDPE-induced inhibition of cAMP production.

View larger version (16K): [in this window] [in a new window]   Fig. 4. Gi2 is also involved in short-term DPDPE inhibition of forskolin-stimulated intracellular cAMP production in NG108-15 (A) and NIE115 (B) cells. Cells were infected in a cell-to-virus ratio of 1:100 with adeno-GFP, adeno-Gi2-leu, adeno-Gi3-leu, and adeno-Go-leu mutants and were pretreated with PTX (100 ng/ml, 12 h, ) or without PTX (). The abilities of various concentrations of DPDPE to inhibit the 10 µM forskolin-stimulated intracellular cAMP production were determined as described under Materials and Methods. The values represent averages of the maximal inhibition of forskolin-induced cAMP accumulation from DPDPE concentration-dependent curves generated from two separate virus infection experiments with triplicate determinations for each agonist concentration.

The Superactivation of Adenylyl Cyclase after Long-Term Treatment with DPDPE. Long-term treatment (18 h) of N₂A cells with DPDPE resulted in a complete loss of DOR-mediated inhibition of AC activity or receptor desensitization. The complete receptor desensitization was also accompanied by a dramatic rapid increase of forskolin-induced cAMP accumulation after agonist washout and/or addition of opioid antagonist such as naloxone, generally known as AC superactivation (Sharma et al., 1975, 1977; Thomas and Hoffman, 1987). Because after complete receptor desensitization, the intracellular cAMP level in agonist-treated cells in the presence of agonist was identical to that in the control cells in the absence of agonist (Sharma et al., 1975, 1977), AC superactivation has been attributed to a mechanism such as an increase in receptor constitutive activities caused by coupling of the receptor to G proteins other than G_i/o (Wong et al., 1992; Lai et al., 1995; Tsu et al., 1995). However, our earlier DOR high-affinity states binding studies in NG108-15 cells indicated reduction but not abolition of the agonist high-affinity states after long-term agonist treatment (Law et al., 1991). Such results suggested DOR remained coupled to G_i/o proteins after long-term agonist treatment. Hence, the PTX-insensitive G_i/o -subunits were used to examine the role of these G proteins in AC superactivation after long-term agonist treatment. To distinguish the effects of these mutants on receptor desensitization and AC super-activation, N₂A cells were infected with the G mutants first, and were subjected to long-term treatment with 1 µM DPDPE for 12 h to elicit complete receptor desensitization before treatment with 100 ng/ml of PTX during the last 6 h of agonist treatment so as to uncouple any G_i/o proteins from the receptor. Treating the N₂A cells according to this paradigm has resulted in a complete uncoupling of G_i/o proteins from DOR as reflected in the absence of agonist high-affinity binding states (Law et al., 1991; Chakrabarti et al., 1997).

When N₂A cells were treated with 1 µM DPDPE for 18 h, complete receptor desensitization was observed. After long-term treatment, 1 µM DPDPE elicited 4.8 ± 2.2% inhibition of forskolin-stimulated cAMP production compared with 64.3 ± 2.3% in cells not subjected to long-term treatment with the agonist. Similar levels of receptor desensitization were observed in N₂A cells infected either with adeno-G_i2, adeno-G_i3, or adeno-G_o. When nalox-one was used to displace the DPDPE bound to DOR during long-term treatment, there was a naloxone concentration-dependent increase in AC activity (Fig. 5). Such a naloxone concentration-dependent increase in AC activity was also observed in N₂A cells infected with various adenoviruses and treated with DPDPE. There was no statistically significant difference in the maximal level of AC superactivation in N₂A cells infected either with the adeno-GFP virus (215 ± 12%, n = 4), adeno-G_i2-leu virus (204 ± 14% n = 4), adeno-G_i3-leu virus (200 ± 7%, n = 4), or adeno-G_o-leu virus (230 ± 11%, n = 4). There was also no dramatic difference in the concentration of naloxone to induce 50% of maximal level (EC₅₀) of AC superactivation in the N₂A cells infected with these viruses (Table 2). When the N₂A cells infected either with adeno-GFP, adeno-G_i3-leu, or adeno-G_o-leu were treated with PTX after long-term DPDPE treatment, AC superactivation observed in the presence of antagonist was completely eliminated (Fig. 5. A, C, and D). Coincident with the short-term treatment experiment results, only the cells expressing with adeno-G_i2-leu showed superactivation after PTX-treatment. In these N₂A cells, the maximal level of adenylyl cyclase superactivation was observed to be 155 ± 6% (n = 4, Fig. 5B). Likewise, such a naloxone concentration-dependent increase in AC activity was observed in NG108-15 (Fig. 6A) and NIE115 (Fig. 6B) cells infected with various adenoviruses and treated with DPDPE. There was no statistically significant difference in the maximal level of AC superactivation in these cells infected either with the adeno-GFP virus (327 ± 55% and 284 ± 8%, for NG108-15 and NIE115 cells, respectively, n = 2), adeno-G_i2-leu virus (316 ± 28% and 296 ± 2%, respectively, n = 2), adeno-G_i3-leu virus (293 ± 16% and 252 ± 41%, respectively, n = 2), and adeno-G_o-leu virus (299 ± 8% and 257 ± 29%, n = 2). There was also no dramatic difference in the concentration of naloxone to induce 50% of maximal level (EC₅₀) of AC superactivation in these cells infected with these viruses (2.8 ± 0.1, 2.7 ± 1.2, 2.5 ± 0.8, and 2.4 ± 1.6 nM for NG108-15 cells and 2.4 ± 0.4, 2.9 ± 0.6, 1.4 ± 1.0, and 2.3 ± 0.7 nM for NIE115 cells infected either with the adeno-GFP, adeno-G_i2-leu, adeno-G_i3-leu, or adeno-G_o-leu virus, respectively). Coincident with the result from N₂A cells, only the cells expressing with adeno-G_i2-leu showed superactivation after PTX-treatment (304 ± 19% and 271 ± 40%, for NG108-15 and NIE115 cells, respectively, n = 2). Thus, although DOR could not inhibit the forskolin-stimulated intracellular cAMP production via the G_i2 after long-term DPDPE treatment, the same G_i2 protein was responsible for the expression of AC superactivation.

View larger version (21K): [in this window] [in a new window]   Fig. 5. Gi2 mutant restored the adenylyl cyclase superactivation after long-term treatment with DPDPE followed by PTX treatment. N2A cells were infected with adeno-GFP (A), adeno-Gi2-leu (B), adeno-Gi3-leu (C), and adeno-Go-leu (D) mutants in a cell-to-virus ratio of 1:100. These cells were treated with 1 µM DPDPE for 18 h () or with 1 µM DPDPE for 12 h followed by the addition of PTX (100 ng/ml) for 6 h (). Afterward, incubation medium was removed and cells were washed with DMEM at 37°C once to remove the agonist DPDPE. The ability of forskolin to stimulate the intracellular cAMP production was determined at various concentrations of naloxone as described under Materials and Methods. The amount of cAMP produced in the presence of naloxone was compared with that observed in the presence of 1 µM DPDPE. The values represent the averages from four separate virus infection experiments with triplicate determinations for each agonist concentration.

View this table: [in this window] [in a new window]   TABLE 2 The ability of various Gi/o -subunit mutants to restore the superactivation of adenylyl cyclase activity after chronic DPDPE and PTX treatment N2A cells were infected with various adenovirus and treated with DPDPE and PTX chronically as described under Materials and Methods. The superactivation of adenylyl cyclase in these cells was then measured in the presence of various concentrations of naloxone. The values represent the average naloxone concentrations needed to induce 50% maximal superactivation ± S.D. from four separate experiments. Values in parentheses represent the maximal agonist-induced increase in adenylyl cyclase activity after long-term DPDPE treatment.

View larger version (16K): [in this window] [in a new window]   Fig. 6. In NG108-15 (A) and NIE115 (B) cells, Gi2 mutant restored the adenylyl cyclase superactivation after long-term treatment with DPDPE followed by PTX treatment. Cells were infected with adeno-GFP, adeno-Gi2-leu, adeno-Gi3-leu, and adeno-Go-leu mutants in a cell-to-virus ratio of 1:100. These cells were treated with 1 µM DPDPE for 18 h () or with 1 µM DPDPE for 12 h followed by the addition of PTX (100 ng/ml) for 6 h (). Afterward, incubation medium was removed and cells were washed with DMEM at 37°C once to remove the agonist DPDPE. The ability of forskolin to stimulate the intracellular cAMP production was determined at various concentrations of naloxone as described under Materials and Methods. The amount of cAMP produced in the presence of naloxone was compared with that observed in the presence of 1 µM DPDPE. The values represent averages of maximal intracellular cAMP level from two separate virus infection experiments with triplicate determinations for each agonist concentration.

Coimmunoprecipitation of DOR and G_i2 Subunit. After long-term agonist treatment, the activation of the G_i/o proteins by DOR as reflected by [³⁵S]GTPS binding was completely abolished (Eisinger et al., 2002). Because the -subunits of G_i/o proteins are not known to activate AC activity, the observed AC superactivation in N₂A cells infected with adeno-G_i2-leu after PTX treatment could be attributed to the release of the subunits associated with this G protein. However, the observed AC superactivation with AC subtypes I and V excluded the absolute requirement for the G protein subunits in this cellular response (Nevo et al., 2000). The G_i2 could probably serve as a scaffold to recruit cellular proteins involved in AC superactivation. If this was the case, then G_i2 and not other G protein -subunits would be coimmunoprecipitated with DOR.

When HA epitope tagged DOR was immunoprecipitated with the anti-HA monoclonal antibody, as shown in Fig. 7A, G_i2 was coimmunoprecipitated with DOR. Western blotting analyses of similar immunoprecipitates with G_i3 and G_o selective antibodies did not reveal the presence of these G protein -subunits (Fig. 7B). Alteration in the extraction procedure by using detergents other than digitonin did not result in coimmunoprecipitation of G protein -subunits with DOR other than the G_i2. Thus, only G_i2 formed a tight complex with DOR that could be detected with the immunoprecipitation studies. PTX treatment lowered the amount of precipitated G_i2 proteins to 22% (n = 2) compared with the control (designated as 100%), whereas the amount of precipitated G_i2 proteins after long-term 1 µM DPDPE treatment was 69% (n = 2). Treating the cells with 1 µM DPDPE and PTX also lowered the amount of G_i2 proteins coimmunoprecipitated with DOR to 24% (n = 2). Again, as in the case with control cells, G_i3 and G_o could not be coimmunoprecipitated with DOR in the above drug and/or PTX treatments (Fig. 7B).

View larger version (25K): [in this window] [in a new window]   Fig. 7. Interaction of -opioid receptor and Gi2 subunit in vivo. N2A cells were treated with saline (control), with 100 ng/ml PTX for 6 h (+PTX), with 1 µM DPDPE for 18 h (+DPDPE), or with DPDPE for 12 h and then PTX for another 6 h (+DPDPE+PTX). Afterward, cells from one T-75 cm2 flask were harvested and immunoprecipitations were carried out as described under Materials and Methods. DOR was immunoprecipitated with the mouse monoclonal anti-HA antibody (Covance; 1:200), and the presence of Gi2 was determined with Western analysis using the polyclonal anti-Gi2 antibody (1:1000). A, top, Gi2 can be coimmunoprecipitated with DOR in control, PTX, DPDPE, and DPDPE+PTX treatment. Bottom, quantification (n = 2) of the relative band density shown in A, top, with the density of control bands designated as 100%. The white, dotted, black, and shaded bars represent the relative densities of control, PTX treatment, DPDPE treatment, and DPDPE with PTX treatment, respectively. B, Gi3 (top) and Go (bottom) cannot be coimmunoprecipitated with DOR in control, PTX, DPDPE, and DPDPE+PTX treatment. The cell lysates are loaded on the right lanes as the positive control. C, the effect of expression of adeno-Gi2-leu in the amount of Gi2 interacting with DOR. N2A cells were infected with the adeno-GFP (-) or with adeno-Gi2-leu (+) virus in a cell-to-virus ratio of 1:100. Subsequently, these cells were treated with (+) or without (-) 100 ng/ml of PTX for 6 h. Afterward, the cells from 1 T-75 cm2 flask were processed, DOR was immunoprecipitated, and Gi2 was detected on the Western blot as described in A.

The overexpression of G_i2-leu in N₂A cells infected with adeno-G_i2-leu significantly increased the amount of G_i2 proteins coimmunoprecipitated with DOR (Fig. 7C). PTX pretreatment did not significantly reduce the amount of G_i2 coimmunoprecipitated in these cells. Although no attempt to distinguish between the wild-type and mutant G_i2 in the coimmunoprecipitated was made, because PTX treatment reduced the amount of wild-type G_i2 that was coimmunoprecipitated (Fig. 7A), it is reasonable to assume that most of the G_i2 coimmunoprecipitated with DOR reflects the PTX-insensitive mutant. Overexpression of G_i3-leu or G_o-leu with respective adenovirus infection did not result in the coimmunoprecipitation of these proteins with DOR in either control or PTX-treated cells (data not shown). Again, these data suggest that DOR in particular tightly interacts with G_i2.

	Discussion

Top Abstract Materials and Methods Results Discussion References

 
Long-term opioid treatment results in the development of tolerance and dependence, which decreases the therapeutic effects of these drugs and contributes to the development of drug addiction. Studies with PTX have implicated a critical role of G_i/o in the mechanism of long-term opioid action (Lux and Schulz, 1986; Avidor-Reiss et al., 1995, 1996; Williams et al., 2001). However, a key question pertaining to the molecular basis of opioid-induced tolerance/dependence, the identity of the specific G-protein, which carries and transduces the signal, has never been answered clearly. Numerous attempts have been made to answer this question. For example, some studies suggested that opioid receptors could activate G_z, which is a PTX-insensitive G protein subunit (Wong et al., 1992; Lai et al., 1995; Tsu et al., 1995). However, these studies are controversial given that PTX can totally block the signals from activation of the opioid receptor to AC activity in both in vitro and in vivo models (Abood et al., 1985; Self and Stein, 1993; Fields and Casey, 1997). There is evidence to support the selectivity of G proteins involved in the activation of specific second-messenger systems. Studies with G-specific antibodies suggest that G_i2 mediates DOR inhibition of AC in NG108-15 cells (McKenzie and Milligan, 1990), although the cross activity between G_i1 and G_i2 of the antibodies used did not eliminate the role of G_i1 in this process. Using antisense oligodeoxynucleotides, it was shown that opioid-induced intracellular Ca²⁺ mobilization in ND8-47 neuroblastoma x DRG hybrid cells is mediated by G_i2 (Tang et al., 1995). Another study using antisense oligodeoxynucleotides showed that G_i2 and G_x/z antisense probes blocked spinal µ-opioid analgesia (Standifer et al., 1996). However, the unstable and less effective nature of the antisense oligodeoxynucleotides reduces the accuracy of these studies. The presence of G transcripts and partial reduction of the G subunit content after antisense oligodeoxynucleotides treatment might not be able to alter the signaling of an effector system that is efficiently coupled to the receptor, as in the case of DOR inhibition of adenylyl cyclase. Our recent small interfering RNA studies to knock-down G_i2 subunit transcripts revealed 75% reduction in the protein level without altering the DOR mediated inhibition of adenylyl cyclase activity (L. Zhang, H. H. Loh, and P. Y. Law, unpublished observation). Some other studies support that more than one type of G protein is involved in the same opioid receptor signal. For example, a series of articles suggested that in HEK293 cells stably expressing MOR, long-term µ-agonist treatment induced AC superactivation was not due to the activation of either G_z (Tso and Wong, 2000b), G_i2 (Tso and Wong, 2000a), G_i1, or G_i3 (Tso and Wong, 2001) individually. However, a methodological drawback in these studies is that the cell systems were pretreated with PTX before long-term agonist exposure, which caused blunting of initial receptor signals being transduced and resulted in the absence of the long-term response. To avoid this problem, in our current studies, N₂A cells were infected with individual genetically engineered PTX-resistant G proteins (G_i2, G_i3, and G_o) and were treated by DPDPE in the short or long term (18 h), then PTX was used to down-regulate all the endogenous G subunits. We could demonstrate that under this paradigm, before the PTX treatment, the DOR receptors in N₂A cells were completely desensitized, and that upon addition of naloxone, AC super-activation was observed. Based on these strategies, it is demonstrated that the selective activation of G_i2 by DOR receptors mediated both inhibition and superactivation of adenylyl cyclase activity. Expression of the G_i3 or G_o mutant did not rescue the inhibition or AC superactivation after PTX treatment. One could argue that the observed AC superactivation in the presence of the G_i2 mutant was the consequence of DOR resensitization during PTX treatment. However, this was not the case because DPDPE remained unable to lower the intracellular cAMP level after long-term agonist and PTX treatment. Moreover, only G_i2 and neither G_i3 nor G_o directly interacts with DOR tightly. Recent studies on rhodopsin suggested that there is a direct and tight interaction between rhodopsin dimers and G_t (Fotiadis et al., 2003; Liang et al., 2003). Hence, the model that G_i2 plays a crucial role connecting the opioid receptors and downstream adenylyl cyclase activity could offer a plausible explanation for our current studies. Further investigation will clearly be needed to elucidate the relationship of DOR, G_i2, and downstream functional molecules.

Although the current studies suggest the important role of G_i2 in DOR short- and long-term actions, it does not mean to rule out the possibility of participation of other signal pathways. For example, after activation of G proteins, G subunits are released. An indirect action of G with possible feedback regulatory functions, such as ERK/MAPK is possible. In support of this, Raf-1, a protein kinase in the MAPK signaling cascade, has been shown to play a role in DOR-mediated superactivation (Varga et al., 2002). However, other studies using MAPK inhibitors could not block AC superactivation after long-term agonist treatment (Tso and Wong, 2001). In addition, G could activate specific isozymes of adenylyl cyclase in the presence of Gs -subunit, such as type II (Weitmann et al., 2001) and IV (Debernardi et al., 1993). AC superactivation has been shown to be isozyme-specific, with the ability of long-term opioid treatment to superactivate the AC type I, V, VI, and VIII but not the type II, III, IV, and VII (Avidor-Reiss et al., 1996, 1997; Ammer and Christ, 2002). In N₂A cells, the expression of type II, III, IV, VI, and VII adenylyl cyclase is detected by RT-PCR (data not shown). These data, together with the observation that opioid agonist could not increase [³⁵S]GTPS binding after long-term treatment (Eisinger et al., 2002), suggest that the superactivation of adenylyl cyclase could not be directly related to the release of G from G. It also indicates the possibility that either G or G interacts with the cellular proteins, which can modulate the AC superactivation.

Instead of serving as a signaling molecule, G_i2 could serve as a scaffold molecule for proteins that could affect AC superactivation. Chakrabarti et al. (1998a,b) reported the phosphorylation of adenylyl cyclase during long-term morphine treatment. Whether AC superactivation is the result of such phosphorylation has not been demonstrated. Nevertheless, it is attractive to suggest that within the DOR-G_i2 complex, protein kinases mediate the observed AC superactivation. However, G_i2 could also serve as scaffold for other cellular proteins, such as the regulator of G protein signaling (RGS). RGS proteins act as GTPase-activating proteins to increase the rate of GTP hydrolysis by the G subunit and decrease the lifetime of the active G-GTP and free G subunits (De Vries et al., 2000; Hepler, 2003). Multiple RGS proteins have been shown to negatively regulate G protein-mediated opioid signaling and facilitate opioid receptor desensitization and internalization (Potenza et al., 1999; Garzon et al., 2001; Clark et al., 2003). Recently, studies using RGS9 knockout mice suggested that RGS9 is a potential negative modulator of opiate action in vivo, and opiate-induced changes in RGS9 level contribute to the behavioral and neural plasticity associated with long-term opiate administration (Zachariou et al., 2003). Thus, the observed AC superactivation could be the consequence of G_i2 recruiting specific RGS [for example, RGS4 (Cavalli et al., 2000)] to the vicinity of DOR, or the DOR receptor and G_i2 together decide the selectivity of specific RGS (Hepler, 2003; Roy et al., 2003).

In conclusion, the present studies suggest that, in N₂A cells, only G_i2 is required for both DPDPE-induced short-term inhibition and superactivation of adenylyl cyclase after long-term agonist treatment. Because agonist could not activate G proteins after long-term agonist treatment, as indicated by GTP binding studies, G_i2 has a dual functional role in two different opioid receptor signaling events resulting in opposing changes in adenylyl cyclase activities.

	Acknowledgements

 
We thank Dr. Timothy F. Walseth (University of Minnesota, Minneapolis, MN) for the G_o antibody.

	Footnotes

 
This research was supported in part by National Institutes of Health grants DA007339, DA016674, DA000564, DA001583, DA011806, K05-DA70544 (to H.H.L.), and K05-DA00513 (P.-Y.L.).

Article, publication date, and citation information can be found at http://molpharm.aspetjournals.org.

doi:10.1124/mol.105.021352.

ABBREVIATIONS: AC, adenylyl cyclase; PTX, pertussis toxin; HEK, human embryonic kidney; MOR, µ-opioid receptor; DOR, -opioid receptor; N₂A, Neuro2A; PCR, polymerase chain reaction; RT, reverse transcription; DMEM, Dulbecco's modified Eagle's medium; DPDPE, [D-Pen², D-Pen⁵]-enkephalin; MAPK, mitogen-activated protein kinase; ERK, extracellular-signal regulated kinase; RGS, regulator of G protein signaling; GFP, green fluorescent protein; HA, hemagglutinin; N₂A, neuroblastoma Neuro2A cells.

Address correspondence to: Lei Zhang, Department of Pharmacology, Medical School, University of Minnesota, 6-120 Jackson Hall, 321 Church Street SE, Minneapolis, MN 55455. E-mail: zhang247{at}umn.edu

	References

Top Abstract Materials and Methods Results Discussion References

 
Abood ME, Law PY, and Loh HH (1985) Pertussis toxin treatment modifies opiate action in the rat brain striatum. Biochem Biophys Res Commun 127: 477-483.[CrossRef][Medline]

Ammer H and Christ TE (2002) Identity of adenylyl cyclase isoform determines the G protein mediating chronic opioid-induced adenylyl cyclase supersensitivity. J Neurochem 83: 818-827.[CrossRef][Medline]

Avidor-Reiss T, Nevo I, Levy R, Pfeuffer T, and Vogel Z (1996) Chronic opioid treatment induces adenylyl cyclase V superactivation. Involvement of G. J Biol Chem 271: 21309-21315.[Abstract/Free Full Text]

Avidor-Reiss T, Nevo I, Saya D, Bayewitch M, and Vogel Z (1997) Opiate-induced adenylyl cyclase superactivation is isozyme-specific. J Biol Chem 272: 5040-5047.[Abstract/Free Full Text]

Avidor-Reiss T, Zippel R, Levy R, Saya D, Ezra V, Barg J, Matus-Leibovitch N, and Vogel Z (1995) kappa-Opioid receptor-transfected cell lines: modulation of adenylyl cyclase activity following acute and chronic opioid treatments. FEBS Lett 361: 70-74.[CrossRef][Medline]

Bahia DS, Wise A, Fanelli F, Lee M, Rees S, and Milligan G (1998) Hydrophobicity of residue³⁵¹ of the G protein G_i1 determines the extent of activation by the _2A-adrenoceptor. Biochemistry 37: 11555-11562.[CrossRef][Medline]

Breivogel CS, Selley DE, and Childers SR (1997) Acute and chronic effects of opioids on delta and mu receptor activation of G proteins in NG108-15 and SK-N-SH cell membranes. J Neurochem 68: 1462-1472.[Medline]

Cavalli A, Druey KM, and Milligan G (2000) The regulator of G protein signaling RGS4 selectively enhances _2A-adreoreceptor stimulation of the GTPase activity of G_o1 and G_i2. J Biol Chem 275: 23693-23699.[Abstract/Free Full Text]

Chakrabarti S, Rivera M, Yan SZ, Tang WJ, and Gintzler AR (1998a) Chronic morphine augments G/G_s stimulation of adenylyl cyclase: relevance to opioid tolerance. Mol Pharmacol 54: 655-662.[Abstract/Free Full Text]

Chakrabarti S, Wang L, Tang WJ, and Gintzler AR (1998b) Chronic morphine augments adenylyl cyclase phosphorylation: relevance to altered signaling during tolerance/dependence. Mol Pharmacol 54: 949-953.[Abstract/Free Full Text]

Chakrabarti S, Yang W, Law PY, and Loh HH (1997) The µ-opioid receptor down-regulates differently from the -opioid receptor: requirement of a high affinity receptor/G protein complex formation. Mol Pharmacol 52: 105-113.[Abstract/Free Full Text]

Charles CA and Hales GT (2004) From inhibition to excitation: Functional effects of interaction between opioid receptors. Life Sci 76: 479-485.[CrossRef][Medline]

Childers SR (1991) Opioid receptor-coupled second messengers. Life Sci 48: 1991-2003.[CrossRef][Medline]

Clark MJ, Harrison C, Zhong H, Neubig RR, and Traynor JR (2003) Endogenous RGS protein action modulates µ-opioid signaling through G_o. Effects on adenylyl cyclase, extracellular signal-regulated kinases and intracellular calcium pathways. J Biol Chem 278: 9418-9425.[Abstract/Free Full Text]

Clark MJ, Neubig RR, and Traynor JR (2004) Endogenous regulator of G protein signaling proteins suppress G_o-dependent, µ-opioid agonist-mediated adenylyl cyclase supersensitization. J Pharmacol Exp Ther 310: 215-222.[Abstract/Free Full Text]

Connor M and Christie MJ (1999) Opioid receptor signalling mechanisms. Clin Exp Pharmacol Physiol 26: 493-499.[CrossRef][Medline]

Debernardi MA, Munshi R, Yoshimura M, Cooper DM, and Brooker G (1993) Predominant expression of type-VI adenylate cyclase in C6-2B rat glioma cells may account for inhibition of cyclic AMP accumulation by calcium. Biochem J 293: 325-328.[Medline]

De Vries L, Zheng B, Fischer T, Elenko E, and Farquhar MG (2000) The regulator of G protein signaling family. Annu Rev Pharmacol Toxicol 40: 235-271.[CrossRef][Medline]

Eisinger DA, Ammer H, and Schulz R (2002) Chronic morphine treatment inhibits opioid receptor desensitization and internalization. J Neurosci 22: 10192-10200.[Abstract/Free Full Text]

Fields TA and Casey PJ (1997) Signalling functions and biochemical properties of pertussis toxin-resistant G-proteins. Biochem J 321: 561-571.[Medline]

Fotiadis D, Liang Y, Filipek S, Saperstein DA, Engel A, and Palczewski K (2003) Atomic-force microscopy: Rhodopsin dimers in native disc membranes. Nature (Lond) 421: 127-128.[CrossRef][Medline]

Garzon J, Rodriguez-Diaz M, Lopez-Fando A, and Sanchez-Blazquez P (2001) RGS9 proteins facilitate acute tolerance to mu-opioid effects. Eur J Neurosci 13: 801-811.[CrossRef][Medline]

Hepler JR (2003) RGS protein and G protein interactions: a little help from their friends. Mol Pharmacol 64: 547-549.[Free Full Text]

Koob GF and Bloom FE (1988) Cellular and molecular mechanism of drug dependence. Science (Wash DC) 242: 715-723.[Abstract/Free Full Text]

Lai HW, Minami M, Satoh M, and Wong YH (1995) Gz coupling to the rat kappaopioid receptor. FEBS Lett 360: 97-99.[CrossRef][Medline]

Law PY, Hom DS, and Loh HH (1991) Effect of chronic D-Ala², D-Leu⁵-enkephalin or pertussis toxin treatment on the high-affinity state of delta opioid receptor in neuroblastoma x glioma NG108-15 hybrid cells. J Pharmacol Exp Ther 256: 710-716.[Abstract/Free Full Text]

Law PY and Loh HH (1999) Regulation of opioid receptor activities. J Pharmacol Exp Ther 289: 607-624.[Abstract/Free Full Text]

Law PY, Wong YH, and Loh HH (2000) Molecular mechanisms and regulation of opioid receptor signaling. Annu Rev Pharmacol Toxicol 40: 389-430.[CrossRef][Medline]

Liang Y, Fotiadis D, Filipek S, Saperstein DA, Palczewski K, and Engel A (2003) Organization of the G protein-coupled receptors rhodopsin and opsin in native membranes. J Biol Chem 278: 21655-21662.[Abstract/Free Full Text]

Lux B and Schulz R (1986) Effect of cholera toxin and pertussis toxin on opioid tolerance and dependence in guinea-pig myenteric plexus. J Pharmacol Exp Ther 237: 995-1000.[Abstract/Free Full Text]

McKenzie FR and Milligan G (1990) Delta-opioid-receptor-mediated inhibition of adenylate cyclase is transduced specifically by the guanine-nucleotide-binding protein Gi2. Biochem J 267: 391-398.[Medline]