QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Data Supplement All Versions of this Article: mol.105.020198v1 70/1/227    most recent Submit a response Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Briggs, C. A. Articles by Surowy, C. S. Search for Related Content PubMed PubMed Citation Articles by Briggs, C. A. Articles by Surowy, C. S.

Untranslated Region-Dependent Exclusive Expression of High-Sensitivity Subforms of 42 and 32 Nicotinic Acetylcholine Receptors

Neuroscience Research, Abbott Laboratories, Abbott Park, Illinois (C.A.B., E.J.G., C.B.P., R.T., M.D.M., C.S.S.); and Institute for Behavioral Genetics, University of Colorado, Boulder, Colorado (M.J.M.)

Received October 21, 2005; accepted March 21, 2006

	Abstract

Top Abstract Materials and Methods Results Discussion References

 
42 nicotinic acetylcholine receptors (nAChRs) are recognized as the principal nicotine binding site in brain. Recombinant 42 nAChR demonstrate biphasic concentration-response relationships with low- and high-EC₅₀ components. This study shows that untranslated regions (UTR) can influence expression of high-sensitivity subforms of 42 and 32 nAChR. Oocytes injected with 4 and 2 RNA lacking UTR expressed biphasic concentration-response relationships for acetylcholine with high-sensitivity EC₅₀ values of 0.5 to 2.5 µM (14–24% of the population) and low-sensitivity EC₅₀ values of 110 to 180 µM (76–86%). In contrast, message with UTR expressed exclusively the high-sensitivity 42 nAChR subform with an acetylcholine EC₅₀ value of 2.2 µM. Additional studies revealed pharmacological differences between high- and low-sensitivity 42 subforms. Whereas the antagonists dihydro--erythroidine (IC₅₀ of 3–6 nM) and methyllycaconitine (IC₅₀ of 40–135 nM) were not selective between high- and low-sensitivity 42, chlorisondamine, mecamylamine, and d-tubocurarine were, respectively, 100-, 8-, and 5-fold selective for the 42 subform with low sensitivity to acetylcholine. Conversely, agonists that selectively activated the high-sensitivity 42 subform with respect to efficacy as well as potency were identified. Furthermore, two of these agonists were shown to activate mouse brain 42 as well as the ferret high-sensitivity 42 expressed in Xenopus laevis oocytes. With the use of UTR-containing RNA, exclusive expression of a novel high-sensitivity 32 nAChR was also achieved. These studies 1) provide further evidence for the existence of multiple subforms of 42 nAChR, 2) extend that to 32 nAChR, 3) demonstrate UTR influence on 2-containing nAChR properties, and 4) reveal compounds that interact with 42 in a subform-selective manner.

Despite the potential huge diversity of nAChR, most CNS functions have been ascribed to 42, 3-containing (3*), 6*, and 7 nAChR. In particular, approximately 90% of the high-affinity nicotine binding sites in rat brain consist of 42 (Clarke et al., 1985; Whiting et al., 1987; Flores et al., 1992; Zoli et al., 1995; Champtiaux et al., 2003). From a functional perspective, native 42 nAChR EC₅₀ values for nicotine and the neurotransmitter acetylcholine are in the low micromolar range (Alkondon and Albuquerque, 1993; Marks et al., 1993, 1999), 1 to 2 orders of magnitude lower than for other nAChR and consistent with higher affinity binding to 42. In contrast, recombinant 42 nAChR expressed in oocytes and mammalian cell lines have demonstrated variable functional potencies for acetylcholine and nicotine with lower sensitivity (>40 µM) EC₅₀ values (Gopalakrishnan et al., 1996; Chavez-Noriega et al., 1997; Sabey et al., 1999; Papke et al., 2000) as well as the higher sensitivity (3 µM) EC₅₀ values (Court et al., 1994; Papke and Heinemann, 1994; Buisson et al., 1996; Gopalakrishnan et al., 1996; Kuryatov et al., 1997; Olale et al., 1997; Labarca et al., 2001). Indeed, individual cells may express both high- and low-sensitivity forms of recombinant 42 and 44 (Covernton and Connolly, 2000; Houlihan et al., 2001) in a proportion that may be influenced by 4 polymorphism (Kim et al., 2003), by 2 content (Zwart and Vijverberg, 1998; Buisson and Bertrand, 2001; Nelson et al., 2003; Zhou et al., 2003), or by prolonged (overnight) exposure to nicotine or low temperature (Buisson and Bertrand, 2001; Nelson et al., 2003). However, it is not clear whether low- as well as high-sensitivity 42 nAChR are expressed in CNS, what their respective roles in behavior or development may be, or how the proportion of high- and low-sensitivity forms may be regulated apart from long-term exposure to nicotine.

In this study, we present evidence that untranslated regions (UTRs) of the nAChR transcripts influence the expression of high- and low-sensitivity nAChR to the extent of permitting exclusive expression of the high-sensitivity 42 nAChR subform. This property does not seem to be limited to 42 nAChR but extends at least to 32 nAChR as well.

Among the various nAChR, 42 are unusual in that they are potentiated rather than inhibited by the neuroactive steroid 17-estradiol (Nakazawa and Ohno, 2001; Curtis et al., 2002) through a mechanism involving the carboxyl terminus of the 4 subunit (Paradiso et al., 2001). Estradiol also potentiated ferret 42 nAChR, and with apparently greater effect on the high-sensitivity subform. Thus, 42 physiology may be regulated through selective modulation by endogenous substances as well as through expression of nAChR with differing sensitivity to the neurotransmitter acetylcholine.

We also evaluated the selectivity of several antagonists and agonists to identify compounds that may be useful for examining the roles of high- and low-sensitivity 42 nAChR. With both high-sensitivity and mixed sensitivity forms of 42, dihydro--erythroidine (DHE) and methyllycaconitine were potent antagonists but did not seem to distinguish between the high- and low-sensitivity subforms. In contrast, mecamylamine, d-tubocurarine, and chlorisondamine were 8-, 5-, and 100-fold selective for the low-sensitivity form. None of the antagonists examined was selective for the high-sensitivity 42, which, is the form more sensitive to acetylcholine. In contrast, some agonists did seem to be very selective for the high-sensitivity 42 nAChR subform. Two of these agonists were shown to be active at mouse brain 42 nAChR as well as at ferret high-sensitivity 42 nAChR expressed in oocytes, supporting the idea that the high-sensitivity 42 nAChR subform is expressed in brain.

	Materials and Methods

Top Abstract Materials and Methods Results Discussion References

 
Total RNA was prepared from ferret brain (Analytical Biological Services, Inc., Wilmington, DE) with the use of TRIzol reagent (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions. Poly-A+ RNA was isolated with the use of the Oligotex mRNA system (QIAGEN, Valencia, CA). Two different methods were used in cloning the nAChR subunits. One method involved identification of a full-length clone from a cDNA library, whereas the other method used standard PCR techniques to amplify fragments. The cDNA library screening used for 4 and 2 provided coding sequence and genomic 5'- and 3'-UTRs, whereas the PCR method used for 3, 4, and 2 generated coding sequence without the UTR.

Isolation of 4 and 2 from a cDNA Library. cDNA was synthesized from ferret brain poly-A+ RNA by using the Orient Express kit with random primers, ligated to EcoRI/HindIII linkers (Novagen, Madison, WI), and digested with EcoRI + HindIII (New England Biolabs, Beverly, MA). The cDNA was fractionated on a sucrose gradient to remove material smaller than 500 bp. The vector pcDNA3.1(–) (Invitrogen) was digested with EcoRI and HindIII, treated with calf intestinal alkaline phosphatase, and purified over a Chromaspin-TE 1000 column (Clontech, Mountain View, CA). Vector and cDNA were ligated with a Novagen DNA ligation kit and transformed into ElectroMax DH10B cells (Invitrogen) by electroporation. The electroporation mixture was diluted to approximately 1000 transformants/ml in autoclaved 2% tryptone, 1% yeast extract, 1% NaCl, 0.3% SeaPrep agarose (Cambrex Bio Science Rockland, Inc., Rockland ME); equilibrated to 37°C; and supplemented with 100 mg/ml ampicillin. Aliquots (40 ml) were poured into sterile 50-ml tubes, chilled in iced water for 30 min to solidify the agarose, and incubated at 30°C for 2 days. Tubes were inverted several times to mix colonies, and a small aliquot from each tube was stored at –80°C in 15% glycerol. The remaining cells were centrifuged, and plasmid DNA isolated with REAL Prep 96 kit (QIAGEN). In total, 384 library aliquots (four 96-well plates) were prepared, representing approximately 20 million clones.

For library screening, plasmid DNA was denatured with base and spotted on positively charged nylon membranes (Roche Molecular Biochemicals, Indianapolis, IN) with a 96-pin device (V&P Scientific, San Diego, CA). The membranes were neutralized, and the DNA was fixed by UV exposure (Stratalinker; Statagene, La Jolla, CA). Membrane replicates were then hybridized individually to various oligonucleotides that had been labeled with T4 polynucleotide kinase (Invitrogen) and [-³²P]ATP, washed at varying stringencies, and exposed at –80°C with Kodak BioMax intensifying screens and BioMax film. The following oligonucleotide probes were prepared according to a design based upon homology to published nAChR subunits and to partial ferret sequence data derived from short PCR fragments: oligonucleotide 1, GCCGCTCTTCTACACCATCAACCTCATC (highly conserved for all and nAChR subunits); oligonucleotide 2, GAACGGTTGCTGAAGACACTCTTCTCCGGCTACAACAAGTGGTC (ferret 4, N-terminal half); oligonucleotide 3, GGCGGCTCATCGAGTCCATGCACAAGGTGGCCAGCGCCCC (ferret 4, C-terminal half); oligonucleotide 4, GAGCGGCTAGTGGAGCATCTCCTGGACCCCTCCCGGTACAACAAG (ferret 2, N-terminal half); and oligonucleotide 5, ACCATCGGCATGTTCCTGCAGCCTCTCTTCCAGAACTACAC (human 2, C-terminal half).

Based upon hybridization signals, individual library aliquots believed to contain full-length 4 and 2 subunit cDNA clones were identified. Colonies from each were plated onto agar, grown, transferred to nylon membranes, and screened with oligonucleotide probes. For 4, a mixture of oligonucleotides 1, 2, and 3 was used; for 2, a mixture of oligonucleotides 1, 4, and 5 was used. Individual colonies were identified and characterized. All 4 colonies were found to contain identical inserts for the complete coding sequences plus 5' and 3' noncoding regions. There were two different cDNA inserts for 2; one insert began with 5' noncoding sequences and extended toward the middle, whereas the other insert began in the middle coding region and ended in 3' noncoding sequences. Because there were several hundred nucleotides of overlap between the latter two clones that included a unique BsgI restriction site, a series of restriction digestions and ligations were used to produce a full-length 2 clone.

Isolation of 3, 4, and 2 cDNAs by PCR. cDNA prepared from either total RNA or poly-A+ RNA was amplified by PCR with the use of the Superscript II preamplification system (Invitrogen) and either oligo(dT) or random hexamer primers. First strand cDNA synthesis was performed according to the manufacturer's instructions. In brief, the RNA was primed with either random hexamers or oligo(dT) in the presence of dNTPs, and reactions were initiated by the addition of 50 U of Superscript II reverse transcriptase. After termination of the reaction, the remaining RNA template was removed by treatment with 2 U of RNase H, and partial cDNAs were then amplified by PCR with the use of gene-specific primers. Primers were designed to correspond to areas that are divergent from sequences of other nAChR subunits but show relatively good homology between human and rat cDNA sequences of the desired nAChR subunit. In some instances, degenerate primers were used. DNA sequences were amplified by PCR with the use of either Advantage HF, Advantage HF2 (Clontech), or Amplitaq Gold (PerkinElmer Life and Analytical Sciences, Boston, MA) polymerases. In brief, for 2, after initial template denaturation for 3 min at 94°C, amplification was performed with thermal cycles of 94°C for 30 s, followed by 68°C for 3 min for 35 cycles (two-step PCR), followed by a final extension at 68°C for 7 min. For 4 and 3, the template was denatured for 30 s at 94°C, and amplification was performed with thermal cycles of 94°C for 15 s, followed by 68°C for 3 min for 35 cycles, followed by a final extension at 68°C for 7 min. In some instances, PCR was performed in the presence of 5% dimethyl sulfoxide or by using Advantage-GC2 (Clontech), when specific GC-rich areas of the cDNAs were unobtainable under more standard PCR conditions. A 20-µl aliquot of the reaction was run on a 1% agarose gel and PCR products of the expected size were extracted with the use of the QIAquick kit (QIAGEN), cloned into the pCR 2.1-TOPO vector (Invitrogen), and expanded with the use of One Shot TOP 10 chemically competent Escherichia coli (Invitrogen) in preparation for sequencing. DNA sequences were identified and confirmed with overlapping sequences generated from different PCR primer sets. For the 3 nAChR subunit, four overlapping partial cDNA clones were used to construct a full-length clone, for the 4 subunit three overlapping clones were used, and for the 2 cDNA four overlapping clones were used. Primer sequences used to generate these partial cDNAs are shown in Table 1.

Full-length cDNA was prepared by using gene splicing by overlap extension and PCR amplification; resultant cDNA was confirmed by sequencing. These clones contained minimal or no 5'- or 3'-UTR sequence. cDNAs were subcloned into mammalian expression vectors by EcoRI digestion of the plasmids in the pCR2.1-TOPO vector, cDNA fragment isolation from 1% agarose gels, and subsequent ligation into the EcoRI site of either pcDNA3.1(–)Hygro (for the 4 and 3 subunits) or pcDNA3.1(–) (for the 2 subunit). Capped cRNA was prepared by using mMessage mMachine (Ambion, Austin, TX) transcription via the T7 promoter in the pcDNA 3.1 vector.

Expression of nAChR in Xenopus laevis Oocytes. Female X. laevis frogs were obtained from Nasco (Fort Atkinson, WI) and were maintained and treated with standard protocols approved by Abbott's Institutional Animal Care and Use Committee. The preparation of X. laevis oocytes, injection with cDNA or cRNA prepared by standard techniques, and measurement of nAChR responses by using two-electrode voltage-clamp followed procedures similar to those described previously (Briggs et al., 1995). In brief, ovaries were removed surgically from a X. laevis frog under tricaine anesthesia (0.28% in deionized water), and oocytes were prepared after incubation for 1 to 2 h at room temperature in 2 mg/ml collagenase (Sigma type 1A) in low-Ca²⁺ Barth's solution, pH 7.55, containing 87.5 mM NaCl, 2.5 mM KCl, 1 mM MgCl₂, 10 mM Na-HEPES, and 100 µg/ml gentamicin. Oocytes were maintained, before and after injection, at 17–18°C in normal Barth's solution, pH 7.55, containing 90 mM NaCl, 1 mM KCl, 0.66 mM NaNO₃, 0.74 mM CaCl₂, 0.82 mM MgCl₂, 2.4 mM NaHCO₃, 2.5 mM sodium pyruvate, 10 mM Na-HEPES buffer, and 100 µg/ml gentamicin. Glass Petri dishes were used to avoid any potential interference with nAChR function by substances found in some plastics (Papke et al., 1994).

For expression of nAChR, oocytes were injected within 24 h of their preparation and were used 2 to 7 days after injection. Each oocyte was injected with either 40 to 50 nl of nAChR RNA or 10 to 15 nl of nAChR DNA. The total concentration of RNA or DNA was approximately 1 µg/µl determined spectrophotometrically. Injections were conducted with the use of like preparations only (e.g., RNA with RNA or DNA with DNA). Results were similar with either RNA or DNA, but RNA was preferred in studies with varied message ratios to avoid transcription variance.

For measuring functional nAChR responses, oocytes were transferred to room temperature OR-2 solution, pH 7.4, containing 90 mM NaCl, 2.5 mM KCl, 2.5 mM CaCl₂, 1.0 mM MgCl₂, 5 mM Na-HEPES buffer, and 0.5 µM atropine to block endogenous muscarinic receptors. In some experiments, CaCl₂ was replaced by BaCl₂ to prevent secondary activation of a Ca²⁺-dependent Cl^– current. Compounds were applied, and responses were measured at –60 mV cell potential in the POETs apparatus, a computer-controlled robotic device that controls compound delivery, electrophysiological response recording, and data storage and measurement in a searchable database (Trumbull et al., 2003). The device operates six oocyte-containing chambers, applies compounds using a robotic pipettor (Gilson, Middleton, WI) (typically, 4 ml/min for 4 s followed by 3- to 5-min wash by perfusion), records responses under two-electrode voltage clamp using Geneclamp 500 amplifiers (Molecular Devices, Sunnyvale, CA), National Instruments analog-to-digital converter (Austin, TX), and an IBM-compatible computer. Custom software was used to schedule compound application to the oocytes at user-defined intervals (typically 3–5 min), store the recordings in a searchable database, retrieve the responses, quantify the responses by peak amplitude or integral, and perform curve fitting or export the data to other software for further analysis. For the data presented here, concentration-response parameters were determined by nonlinear curve-fitting in Prism (GraphPad Software, San Diego, CA) and the built-in variable slope sigmoidal curve (Hill equation) or a biphasic version that was the sum of two independent Hill equations. In general, the concentration-response parameters for curve fitting were not constrained except that the bottom of the curve was set equal to 0; exceptions are noted.

In each oocyte, responses to test compound were normalized to the maximal response to acetylcholine (100 µM or 1 mM as indicated, depending upon the nAChR), and the stability of responses during testing was monitored by applying acetylcholine at regular intervals during the experiment. Agonist responses typically were measured as the compound-induced peak (maximal) inward current relative to the baseline holding current. In some experiments, the response integral ("area under the curve") also was measured, with the beginning and end of the integration period defined by the beginning and end of the activation of the Gilson syringe pump used to apply compound. Similar concentration-response parameters were obtained by integral or peak amplitude.

View larger version (10K): [in this window] [in a new window]   Fig. 1. Ferret 4 and 2 UTR. The sizes of the 5'-UTR (top-down diagonal) and 3' UTR (bottom-up diagonal) segments of ferret 4 and 2 cloned from the cDNA library are diagrammed relative to the length of the coding sequences. The 2 3'-UTR (1267 nucleotides) was nearly as long as the coding region (1437 nucleotides). Complete sequences are shown in Supplemental Data.

Total agonist-stimulated responses were calculated as the increase in signal above the basal efflux rate, which was calculated by a nonlinear least-squares fit of the data before and after the peak response (Marks et al., 1999, 2004). Responses were normalized by dividing the agonist-stimulated response by the basal efflux. Each experiment also included samples stimulated with 10 µM nicotine to facilitate comparison of results between experiments.

Materials. Acetylcholine, atropine, bovine serum albumin, collagenase type IA, dihydro--erythroidine, 17-estradiol, gentamicin, mecamylamine, methyllycaconitine, (–)-nicotine tartrate, and d-tubocurarine were purchased from Sigma Chemical Co. (St. Louis, MO). Chlorisondamine was purchased from Tocris Cookson Inc. (Ellisville, MO). HEPES and sucrose were from Boehringer-Ingelheim (Indianapolis, IN). CsCl and Budget Solve scintillation fluid were from Research Products International (Mt. Prospect, IL). Carrier-free ⁸⁶RbCl was from PerkinElmer Life and Analytical Sciences (Boston, MA). A-163554, A-162035, and A-168939 were synthesized at Abbott Laboratories as described by Lin et al. (2001).

	Results

Top Abstract Materials and Methods Results Discussion References

 
In cloning ferret 4 and 2 nAChR, two approaches were used. One approach involved the use of primers designed to encompass the coding region with minimal 3' and 5' extension, and the other approach involved the use of a cDNA library with oligonucleotide probes directed toward the coding regions. Because the latter approach is based upon hybridization to long, potentially full-length cDNA derived from mRNA, it permits isolation of cDNAs containing UTR. Indeed, 4 and 2 messages with relatively long 3'- and 5'-UTR were isolated by the cDNA library screening. The relative sizes of the ferret 4 and 2 nAChR UTR segments are diagrammed in Fig. 1. The Supplemental Data shows ferret 3, 4, and 2 nAChR amino acid sequences and ferret 4 and 2 nAChR UTR nucleotide sequences aligned with corresponding human and rat sequences.

Expression of High- and Low-Sensitivity 42 nAChR. Oocytes injected with RNA or DNA derived from these clones expressed functional 42 nAChRs, but with different results depending upon whether the messages contained UTR sequences. In the following, "4(u)" refers to 4 coding sequence with 5'- and 3'-UTR; likewise, "2(u)" refers to 2 coding sequence with 5'- and 3'-UTR.

Oocytes injected with ferret 4 and 2 (1:1 ratio) lacking UTR expressed typical acetylcholine-gated currents and a biphasic concentration-response relationship as reported previously for human and rat 42 (Zwart and Vijverberg, 1998; Chavez-Noriega et al., 2000; Buisson and Bertrand, 2001; Nelson et al., 2003). In contrast, when 4(u) and 2(u) were used, the concentration-response relationship was monophasic with an EC₅₀ value similar to the high-sensitivity portion of the biphasic relationship seen with the use of messages without the UTR. Concentration-response relationships for acetylcholine are shown in Fig. 2, and extracted parameters are given in Table 2. In view of the unexpected results with the 4(u)2(u) combination, the initial measurements were repeated in 30 oocytes from three donor X. laevis with similar results from each cell.

View larger version (16K): [in this window] [in a new window]   Fig. 2. Concentration-response curves for acetylcholine at ferret 42 nAChR expressed from messages with and without UTR. Ferret nAChR subunits were expressed in X. laevis oocytes by using standard techniques and responses to acetylcholine applied for 5 s were obtained at –60 mV and measured at peak amplitude relative to the baseline holding current. In each oocyte, responses to various concentrations of acetylcholine were normalized to reference control responses to account for cell to cell variance in level of receptor expression. The reference control, designed to elicit a maximal response (100 µM acetylcholine for high-sensitivity 42 from UTR-containing messages and 1 mM acetylcholine for other nAChR), was contained in a solution separate from the test solutions, and was applied at regular intervals during the experiment to detect fluctuations in responsiveness. A, data combined from 30 oocytes (three separate preparations) injected with UTR-containing 4 [4(u)) and 2 (2(u)] nAChR messages in approximately equal amounts (1:1 ratio). The curve shows a Hill equation fit to the combined data with an EC50 value of 2.2 µM [1.9–2.6 µM confidence interval (CI)], Hill slope of 1.05 ± 0.06, and plateau of 105 ± 0.8%. Curves fit to individual data from each of 28 oocytes provided similar results; in the other two oocytes, data were insufficient for curve fitting. B, data are from seven oocytes injected with a 1:1 ratio 4 and 2 nAChR messages lacking UTR. The fitted curve is the sum of two independent Hill equations with EC50 values of 0.54 µM (0.086–3.41 µM CI) and 114 µM (90–145 µM CI), Hill slopes of 1.01 ± 0.35 and 1.39 ± 0.23, and plateaus of 13 ± 4 and 84 ± 6%. Data are shown as mean ± S.E.M. or mean ± 95% CI for EC50 values.

View this table: [in this window] [in a new window]   TABLE 2 Isolation of a high-sensitivity 42 subform using UTR-containing messages expressed in oocytes Data for EC50 are shown as mean and 95% confidence interval. Data for the Hill coefficient (nH) are shown as mean ± S.E.M. For 4(u)2(u) 1:1 and 42(u) 1:5, the data were fit by the monophasic Hill equation. Otherwise, the data were better fit by a biphasic curve representing the sum of two independent Hill equations; the proportion of the high-affinity component was estimated from the plateau values of the two fitted components. Receptors were expressed from 4 and 2 messages lacking UTR and from other messages, designated 4(u) and 2(u), that contained the same coding regions plus 3'- and 5'-UTR segments.

Zwart and Vijverberg (1998) reported that increasing the proportion of 2 message to an 4/2 ratio of 1:9 could lead to the appearance of a biphasic concentration-response curve with expression of a higher sensitivity component. Reasoning that the effect we observed may result from higher levels of 2 protein caused by increased translation of 2 owing to the presence of UTR, we attempted to generate monophasic high-sensitivity acetylcholine concentration curves by adjusting the 4/2 ratio by using messages without UTR. Decreasing the 4/2 ratio to as much as 1:120 increased the high-sensitivity proportion (Fig. 3; Table 2); however, the acetylcholine concentration-response curves remained biphasic. Thus, we were unable express exclusively monophasic high-sensitivity ferret 42 using messages lacking UTR.

View larger version (29K): [in this window] [in a new window]   Fig. 3. Inability to isolate high- and low-sensitivity components by adjusting ratio of messages lacking UTR. Oocytes were injected with 4 and 2 subunit messages in various ratios according to nucleotide content. Volume and total nucleotide content were similar. Relative amounts injected were nine 4 to one 2 (A), one 4 to one 2 (B), one 4 to nine 2 (C), one 4 to 20 2 (D), one 4 to 60 2 (E), and one 4 to 120 2 (F). Data for B are the same as in Fig. 2B and are reproduced here to facilitate comparison with other 4/2 ratios. Concentration-response parameters, determined as in Fig. 2, are provided in Table 2.

View larger version (19K): [in this window] [in a new window]   Fig. 4. Both 4- and 2-UTR contribute to exclusive expression of the high-sensitivity 42 nAChR. Oocytes were injected with equal amounts of 4 subunit message without or with 3'- and 5'-UTR plus 2 subunit message without or with 3'- and 5'-UTR. Data are shown for 42 nAChR from 4 and 2 messages both lacking UTR (A), 4(u)2 nAChR from 4 message containing 3'- and 5'-UTR and 2 message lacking UTR (B), 42(u) nAChR from 4 message lacking UTR and 2 message containing 3'- and 5'-UTR (C), and 4(u)2(u) nAChR from 4 and 2 messages both containing 3'- and 5'-UTR (D). Concentration-response parameters, determined as in Fig. 2, are provided in Table 2.

View larger version (16K): [in this window] [in a new window]   Fig. 5. Increased proportion of 2 message containing UTR eliminates the low-sensitivity component. Oocytes were injected with 4 and 2 nAChR subunit messages both lacking UTR (open symbols) or 4 nAChR subunit message lacking UTR plus 2 nAChR subunit message containing 3'- and 5'-UTR in a 1:5 nucleotide content ratio (closed symbols). Exclusive expression of the high-sensitivity component was obtained with an excess of UTR-containing 2 subunit relative to 4 subunit. Data are from four oocytes of each type measured on the same day and concentration-response parameters are provided in Table 2.

View larger version (23K): [in this window] [in a new window]   Fig. 6. Expression of high-sensitivity 32 nAChR with the use of UTR-containing message. Oocytes were injected with 3 subunit message lacking UTR plus 2 subunit message either lacking UTR (open symbols) or containing 3'- and 5'-UTR (closed symbols). The 3/2 nucleotide content ratios were 1:1 (A), 1:5 (B), 1:10 (C), and 1:20 (D). Concentration-response parameters are provided in Table 3.

View this table: [in this window] [in a new window]   TABLE 3 Potencies for acetylcholine at high-sensitivity and mixed-sensitivity ferret 32 For 32(u) 1:10 and 1:20 ratios, the data for acetylcholine concentrations up to 1 mM were fit with a monophasic Hill equation. Other data were fit with a biphasic curve, as in Table 2. Hill coefficients for 32 1:20 were constrained to fit the data. Receptors were expressed from 3 message lacking UTR and from 2 messages lacking (2) or containing [(2(u)] 3'- and 5'-UTR segments.

Antagonist Potency at 42 Subforms. It remains unclear whether native 42 nAChR are better represented by the higher-sensitivity form, the lower sensitivity form, or whether both forms may be expressed and regulated differentially according to cell type or maturation. However, the 4(u) and 2(u) clones represent sequences that, because they contain partial or full UTR, are closer to the native mRNA that would be expressed in brain than are the clones without UTR. Thus, it was of interest to explore the pharmacology of the high- and low-sensitivity 42 nAChR with the aim of uncovering selective tools that could be used to elucidate the properties and physiological roles of the receptors.

Five antagonists were evaluated for their effects on high- and low-sensitivity forms of 42. This was performed by using receptors expressed from 4(u)2(u) to generate the high-sensitivity form alone, and from 42 without UTR to generate mixed high- and low-sensitivity receptors. We were not able to express the low-sensitivity form alone. With both 4(u)2(u) and 42, antagonist IC₅₀ values were measured against two concentrations of acetylcholine, 2 µM (near the high-sensitivity EC₅₀) and 200 µM (near the low-sensitivity EC₅₀). In the mixed sensitivity 42 population, most (97%) of the response to 2 µM acetylcholine should have been from the high-sensitivity 42 subform, whereas for 200 µM acetylcholine most (81%) of the response should have been from the low-sensitivity 42 subform based upon concentration-response parameters shown in Table 2. The antagonist concentration-inhibition curves are shown in Figs. 7 and 8, and IC₅₀ values are in Table 4.

View larger version (23K): [in this window] [in a new window]   Fig. 7. Antagonists dihydro--erythroidine and methyllycaconitine are not selective for high-versus low-sensitivity 42 nAChR. Concentration-inhibition data for dihydro--erythroidine (DHE, A and B) and methyllycaconitine (MLA, C and D) were obtained in oocytes expressing a mixture of high- and low-sensitivity 42 nAChR (open symbols) and in oocytes expressing exclusively the high-sensitivity 42 nAChR from UTR-containing 4 and 2 messages (closed symbols). For both mixed sensitivity and exclusively high-sensitivity nAChR, inhibition was measured against 2 µM acetylcholine (A and C) and 200 µM acetylcholine (B and D). Concentration-inhibition parameters are provided in Table 4.

View larger version (30K): [in this window] [in a new window]   Fig. 8. Three antagonists seem selective for the low-sensitivity 42 component. Concentration-inhibition data for mecamylamine (A and B), d-tubocurarine (C and D), and chlorisondamine (E and F) were obtained as described in Fig. 7. Data are shown for oocytes expressing mixed-sensitivity 42 nAChR (open symbols) and high-sensitivity 42 nAChR from UTR-containing 4 and 2 messages (closed symbols). For both mixed and high-sensitivity 42, the inhibition of responses to 2 µM acetylcholine (A, C, and E) and 200 µM acetylcholine (B, D, and F) was measured. Concentration-inhibition parameters are provided in Table 4.

View this table: [in this window] [in a new window]   TABLE 4 Antagonist potencies at ferret 42 and at the high-sensitivity form expressed from UTR-containing 4(u) and 2(u) Concentration-inhibition curves projected to 100% inhibition for methyllycaconitine, mecamylamine, d-tubocurarine, and chlorisondamine, but not for DHE. For DHE acting on 42 the projected maximal inhibition was 80 ± 3% with 2 µM acetylcholine and 95 ± 4% with 200 µM acetylcholine, whereas these values at 4(u)2(u) were 90 ± 2% with 2 µM acetylcholine and 84 ± 3% with 200 µM acetylcholine.

Neither DHE nor methyllycaconitine distinguished between the high-and low-sensitivity forms (Fig. 7). IC₅₀ values were 3 to 6 nM for DHE and 40 to 135 nM for methyllycaconitine under all conditions. In contrast, chlorisondamine, and to some extent mecamylamine and d-tubocurarine, seemed to be selective for the low-sensitivity form (Fig. 8). When 200 µM acetylcholine and the mixed sensitivity 42 were used, the IC₅₀ values were 0.2 µM for mecamylamine, 0.9 µM for d-tubocurarine, and 0.2 µM for chlorisondamine. When the isolated high-sensitivity form, 4(u)2(u), and 2 µM acetylcholine were used, IC₅₀ values were 8-, 5-, and 100-fold higher for mecamylamine, d-tubocurarine, and chlorisondamine, respectively.

Modulation of 42 Subforms by Estradiol. 17-Estradiol is a neuroactive steroid that has been found to potentiate human 42, whereas inhibiting other nAChR (Nakazawa and Ohno, 2001; Paradiso et al., 2001; Curtis et al., 2002). Estradiol clearly potentiated the acetylcholine response at the high-sensitivity ferret 4(u)2(u), as shown in Fig. 9. In the mixed sensitivity population, however, the potentiation was weaker. It was not clear whether this was due to a selective potentiation of the high-sensitivity subform or to a mixture of effects at both subforms.

View larger version (21K): [in this window] [in a new window]   Fig. 9. Estradiol potentiation of 42 nAChR. Acetylcholine concentration-response data in the absence and presence of 10 µM 17-estradiol were obtained from three oocytes expressing high-sensitivity 42 nAChR by using UTR-containing messages and from three oocytes expressing mixed sensitivity 42 nAChR by using messages lacking UTR. The concentration of acetylcholine in the reference control was 100 µM for both mixed and high-sensitivity 42 oocytes. A, at high-sensitivity 42 nAChR, estradiol increased the maximal response by 64%. In the absence (open symbols) and presence (closed symbols) of estradiol, respectively, the acetylcholine EC50 values were 2.2 µM (1.8–2.6 µM CI) and 1.7 µM (1.0–2.7 µM CI), Hill slopes were 1.10 ± 0.10 and 1.10 ± 0.24, and plateaus were 102 ± 2 and 166 ± 8% relative to 100 µM acetylcholine in the absence of estradiol. B, estradiol also potentiated acetylcholine responses in the mixed sensitivity population, but overall the effect was smaller than with high-sensitivity 42 alone. Concentration-response parameters were determined as for other data, except that Hill slopes were constrained to be shared between data with and without estradiol to fit biphasic curves. For the high-sensitivity component, in the absence (open symbols) and presence (closed symbols) of estradiol, respectively, the acetylcholine EC50 values were 1.2 µM (0.59–2.6 µM CI) and 0.82 µM (0.31–2.2 µM CI), Hill slopes were 1.06 ± 0.18, and plateaus were 24 ± 3 and 43 ± 8% relative to control 100 µM acetylcholine in the absence of estradiol. For the low-sensitivity component in the absence and presence of estradiol, respectively, the acetylcholine EC50 values were 290 µM (210–400 µM CI) and 120 µM (77–190 µM CI), Hill slopes were 1.31 ± 0.13, and plateaus were 320 ± 30 and 310 ± 40% relative to control 100 µM acetylcholine in the absence of estradiol.

Agonist Efficacy at 42 Subforms. In rat brain, 42 makes up the majority of the high-affinity binding sites for (–)-nicotine (Whiting et al., 1991; Flores et al., 1992). However, in the mixed sensitivity population generated from 42 messages lacking UTR, the apparent potency and efficacy values for (–)-nicotine were similar to those for acetylcholine (Fig. 10). In the high-sensitivity populations generated from 4 and 2 messages containing UTR, or 4 message lacking UTR plus 2 message containing UTR (1:5 message ratio), (–)-nicotine was as potent as in the mixed sensitivity population, but its apparent efficacy was only 24% relative to acetylcholine.

View larger version (16K): [in this window] [in a new window]   Fig. 10. Effects of nicotine in the high- and mixed sensitivity 42 populations. Responses to (–)-nicotine were normalized to control 1 mM acetylcholine in each oocyte. In the mixed sensitivity 42 population generated from messages lacking UTR (n = 15), (–)-nicotine activated both high- and low-sensitivity components. The fitted curve shows EC50 values of 1.1 µM (0.52–2.5 µM CI) and 41 µM (31–54 µM CI), Hill slopes of 1.2 (constrained) and 2.3 ± 0.78, and plateaus of 31 ± 5 and 63 ± 7% relative to 1 mM acetylcholine. However, in the high-sensitivity populations generated with the use of 4 and 2 messages both containing UTR [4(u)2(u), 1:1 ratio; n = 4], the apparent efficacy of (–)-nicotine was less. The EC50 value was 0.49 µM (0.22–1.1 µM CI), the Hill slope was 1.16 ± 0.43, and the plateau was 24 ± 2%. Similar results were obtained with the use of 4 message lacking UTR and 2 message containing UTR [42(u) 1:5; n = 3], with which the (–)-nicotine EC50 value was 0.40 µM (0.24–0.66 µM CI), the Hill slope was 1.20 ± 0.30, and the plateau was 24 ± 1%. Fitted curves for both high-sensitivity subforms are shown in the figure but are essentially overlapping.

View larger version (19K): [in this window] [in a new window]   Fig. 11. Selectivity of A-163554 for high-sensitivity 42. Responses are shown for A-163554 acting on the high-sensitivity receptor expressed from 4 and 2 messages containing UTR [4(u)2(u); n = 3] and the mixed sensitivity population expressed from messages lacking UTR (42; n = 3). As an additional control, full concentration-response relationships for acetylcholine were determined in the same three 42 oocytes exposed to A-163554. The fitted curves for A-163554 at 4(u)2(u) show an EC50 value of 4.8 µM (3.1–7.3 µM CI), Hill slope of 1.34 ± 0.28 and plateau of 167 ± 12% relative to 1 mM acetylcholine. When mixed sensitivity 42 was used, the responses to A-163554 again were fitted well by a monophasic concentration-response curve, with an EC50 value of 0.74 µM (0.23–2.4 µM CI), Hill slope of 0.85 ± 0.30, and plateau of 15 ± 2% relative to 1 mM acetylcholine. The same 42 oocytes demonstrated a biphasic concentration response to acetylcholine with EC50 values of 0.92 µM (0.39–2.2 µM CI) and 105 µM (92–119 µM CI), Hill slopes of 1.05 ± 0.26 and 1.35 ± 0.13, and plateaus of 19 ± 3 and 85 ± 5% relative to 1 mM acetylcholine.

View larger version (17K): [in this window] [in a new window]   Fig. 12. Selectivity of A-162035 for high-sensitivity 42. Responses are shown for A-162035 acting on the high-sensitivity receptor expressed from 4 and 2 messages containing UTR [4(u)2(u); n = 3] and the mixed sensitivity population expressed from messages lacking UTR (42; n = 4). The fitted curves for A-162035 at 4(u)2(u) show an EC50 value of 0.13 µM (0.11–0.16 µM CI), Hill slope of 1.49 ± 0.20, and plateau of 113 ± 3% relative to 1 mM acetylcholine. When 42 mixed sensitivity receptors were used, A-162035 did not have a clear biphasic concentration-response relationship, but the low Hill slope suggested that the compound may act upon more than one receptor type. The fitted curve shown reflects an EC50 value of 4.6 µM (0.02–108 µM CI), Hill slope of 0.57 ± 0.35, and plateau of 41 ± 26% relative to 1 mM acetylcholine.

View larger version (16K): [in this window] [in a new window]   Fig. 13. Selectivity of A-168939 for high-sensitivity 42. Responses are shown for A-168939 acting on the high-sensitivity receptor expressed from 4 and 2 messages containing UTR [4(u)2(u); n = 6] and the mixed sensitivity population expressed from messages lacking UTR (42; n = 6). The fitted curve for A-168939 at 4(u)2(u) shows an EC50 value of 0.71 µM (0.54–0.93 µM CI), Hill slope of 1.31 ± 0.18, and plateau of 86 ± 3% relative to 1 mM acetylcholine. A-168939 had little effect at 42 mixed-sensitivity receptors. The fitted curve reflects an EC50 value of 7.5 µM (0.16–360 µM CI), Hill slope of 0.65 ± 0.40, and plateau of 8 ± 4% relative to 1 mM acetylcholine. The low Hill slope may reflect activation of more than one receptor type or simply the difficulty in resolving the concentration-response relationship for such small responses.

A-163554 and A-168939 were somewhat less efficacious at 42 than anticipated from their efficacy at 4(u)2(u) and assumption of 15% high-sensitivity subform in the mixed sensitivity 42 population. This may be due to functional differences between high-sensitivity subforms from 4(u)2(u) compared with 42 or to variance in the relative amount of the high-sensitivity subform expressed from 42. A-162035 seemed more efficacious than the other analogs at 42, probably because of some activity at low-sensitivity as well as high-sensitivity 42.

Agonist Efficacy at Native 42. A-162035 and A-168939 were used to test whether receptors similar to the high-sensitivity 42 subform could be expressed in brain. A-162035 (Fig. 14A) and A-168939 (Fig. 14B) each stimulated 42-mediated ⁸⁶Rb⁺ flux in mouse thalamic synaptosomes. The EC₅₀ values for ⁸⁶Rb⁺ flux (see figure legend) were remarkably similar to the EC₅₀ values determined by using ferret 4(u)2(u), despite the differences in species and assay types. Furthermore, maximal responses to A-162035 and A-168939 were nearly as large as the response to 10 µM (–)-nicotine, which has been shown to be selective for the high-sensitivity 42 nAChR response in mouse thalamus (Marks et al., 1999, 2004). Figure 14C also shows the thalamic synaptosome response to 10 µM(–)-nicotine in relation to the biphasic acetylcholine concentration-response relationship. Responses to 10 to 100 µM A-162035 and A-168939 were essentially completely blocked by 2 µM DHE, which also has been shown to be selective for the high-sensitivity 42 nAChR in this assay.

View larger version (15K): [in this window] [in a new window]   Fig. 14. Activation of native 42 nAChR by A-162035 and A-168939. Mouse thalamic synaptosome Rb+ flux was measured in response to A-162035, A-168939, and acetylcholine in the absence and presence of DHE. Graphs also show the response to 10 µM (–)-nicotine () measured in each experiment as a positive control for high-sensitivity 42. A, concentration-response for A-162035 in the absence (; n = 4–5 each data point) and presence (; n = 3) of 2 µM DHE. The fitted curve for A-162035 shows an EC50 value of 0.12 µM (0.039–0.34 µM CI), Hill slope of 1.00 ± 0.33, and plateau of 8 ± 2% relative to the maximal response. B, concentration-response for A-168939 in the absence (; n = 4–5 each data point) and presence (; n = 3) of 2 µM DHE. The fitted curve for A-168939 shows an EC50 value of 0.24 µM (0.11–0.50 µM CI), Hill slope of 1.00 ± 0.24, and plateau of 10 ± 1% relative to the maximal response. C, for comparison, concentration-response for acetylcholine in the absence (; n = 4) and presence (; n = 4) of 2 µM DHE. Note the change in ordinate and abscissa scales compared with A and B. The concentration-response curve for acetylcholine was biphasic in the absence of DHE. The fitted curve shows a high-sensitivity component with EC50 value of 0.77 µM (0.24–2.4 µM CI), Hill slope of 1.06 ± 0.40, and plateau of 18 ± 4% and a low-sensitivity component with EC50 value of 57 µM (28–115 µM CI), Hill slope of 2.00 ± 0.97, and plateau of 16 ± 4%.

Higher concentrations of A-162035 (3 µM) and A-168939 (10 µM) seemed to inhibit the synaptosomal response to the same compounds (Fig. 14), possibly because of nAChR channel block or desensitization. A similar effect, at somewhat higher concentrations, was observed with ferret 42 expressed in oocytes (Figs. 12 and 13). High concentrations of acetylcholine and nicotine also can produce an inhibitory effect (Figs. 2, 3, 4, 5, 6, 7, 8, 9, 10). The mechanism of this inhibition was not investigated.

	Discussion

Top Abstract Materials and Methods Results Discussion References

 
The main findings in this study are that 1) ferret 42 nAChR could be expressed exclusively in the high-sensitivity form only from UTR-containing message; 2) the principal determinant seems to be in the 2-UTR, although 4-UTR also may contribute; 3) a high-sensitivity form of 32 also could be exclusively expressed with UTR-containing 2; 4) high- and low-sensitivity 42 could be distinguished pharmacologically by certain antagonists and agonists as well as by the potency of the neurotransmitter acetylcholine; and 5) agonists selective for the high-sensitivity 42 subform were active at native 42 in mouse brain as well as at recombinant ferret 42.

It has been reported that the proportion of high-sensitivity 42 could be increased by increasing the amount of 2 message (Zwart and Vijverberg, 1998) or by prolonged exposure to low concentrations of nicotine or reduced temperature (Buisson and Bertrand, 2001; Nelson et al., 2003). Zhou et al. (2003) also revealed biphasic concentration-response curves and monophasic high-sensitivity concentration-response curves for acetylcholine depending upon the 4-2 concatamer arrangement or the addition of free 2 message. These studies have suggested that high- and low-sensitivity components may correspond to 4₍₂₎2₍₃₎, and 4₍₃₎2₍₂₎ pentamers, respectively.

When ferret messages were used, increasing the relative amount of 2 message seemed to increase the proportion of high-sensitivity 42, similar to previous reports with 42 from other species. Zwart and Vijverberg (1998) also observed mixed high- and low-sensitivity 42, even with the 1:9 message ratio. However, exclusive expression of the high-sensitivity 42 subform (or the high-sensitivity 32 subform) could be achieved by using ferret 2 message containing UTR, but not by using messages lacking UTR. It is assumed that the same 4 and 2 proteins are expressed with or without UTR. High-sensitivity ferret 42 expression may be particularly dependent upon the presence of UTR for message stability or protein translation, and at very low 4/2 ratios without UTR the small amount of 4 may limit the ability to detect functional 42 expression. Short UTR segments in the human messages (Nelson et al., 2003; Zhou et al., 2003) and possibly rat messages (Zwart and Vijverberg, 1998) used in previous reports also may have influenced high-sensitivity 42 expression; this remains to be investigated. In addition, it should be noted that the 2 TM3-TM4 cytoplasmic loop is shorter in ferret 2 than in human and rat 2, largely because of two sequences of amino acids, one of eight amino acids located 38 residues upstream from TM4 and the other of 13 amino acids located 15 residues further upstream. It is possible that 42 or 32 assembly could be affected by the shorter loop. However, next to TM3 and TM4 the critical "proximal" amino acids of the cytoplasmic loop (Kuo et al., 2005) are identical in ferret, human, and rat.

The ferret 4-UTR also seemed to have an effect on exclusive expression of the high-sensitivity form. It is notewoerthy that the 5' 4-UTR contains an open reading frame (ORF) that seems to be conserved among ferret, rat, and human (Supplemental Data). Examples of an upstream ORF affecting downstream translation are known (Morris and Geballe, 2000). However, there is no direct evidence that the 4 5' ORF affects coding sequence translation or is itself translated.

For 32, a wide range of acetylcholine EC₅₀ values have been reported, from 1.2 to 443 µM (Gerzanich et al., 1995; Chavez-Noriega et al., 1997; Colquhoun and Patrick, 1997), and Covernton and Connolly (2000) suggested a biphasic 32 concentration-response. Using ferret 2 with UTR, we demonstrated that 32 as well as 42 indeed could exhibit a biphasic concentration-response relationship for acetylcholine. Furthermore, the high-sensitivity 32 subform could be exclusively expressed by using a 1:20 ratio of 3/2(u). To our knowledge, this is the first report that decreasing 3/2 message ratio influences 32 sensitivity to acetylcholine, and the first exclusive expression of the high-sensitivity subform.

In many studies with recombinant 42 nAChR, higher EC₅₀ forms seem to predominate (Gopalakrishnan et al., 1996; Chavez-Noriega et al., 2000; Houlihan et al., 2001; Nelson et al., 2003), whereas predominant low EC₅₀ values are observed in other forms (Bertrand et al., 1990; Buisson et al., 1996; Kuryatov et al., 1997). In CNS, 42 nAChR demonstrate low EC₅₀ corresponding to high-sensitivity 42 (Alkondon and Albuquerque, 1993, 1995; Marks et al., 1993, 1999; Marszalec et al., 1999). Such variances raise questions regarding the extension of recombinant nAChR pharmacology to native nAChR.

To identify compounds that may be useful in evaluating the physiological roles of high- and low-sensitivity 42, several antagonists and agonists were evaluated for selectivity. These experiments used 4(u)2(u) to express exclusively the high-sensitivity subform, and 42 to express a mixture of high- and low-sensitivity subforms. Although the antagonists DHE and methyllycaconitine were not selective between 42 subforms, chlorisondamine, mecamylamine and d-tubocurarine were somewhat selective for the low-sensitivity 42 subform. Our results with d-tubocurarine were generally similar to those of Zwart and Vijverberg (1998), who used another species' 42. Both studies found low IC₅₀ (0.5–1 µM) and low Hill coefficient (n_H) (0.71–0.77) for 1:1 42 and high concentrations of acetylcholine (200 or 300 µM), and both found similar values (2–5 µM IC₅₀ values, 0.67–0.78 Hill coefficients) for high sensitivity 42 and lower concentrations of acetylcholine (2 or 10 µM). With 1:9 42 and 300 µM acetylcholine, Zwart and Vijverberg (1998) observed a biphasic concentration-inhibition curve, although it is not clear to what extent this was due to d-tubocurarine properties or the mixture of low- and high-sensitivity 42 obtained with the 1:9 ratio. In our experiments with 4(u)2(u) and 200 µM acetylcholine or 1:1 42 and 2 µM acetylcholine, we observed high IC₅₀ values (50–100 µM) and low Hill coefficients (0.39–0.41), possibly reflecting an unresolved combination of low and high potencies for d-tubocurarine. The different potencies of d-tubocurarine at 42 may reflect differences between high- and low-sensitivity 42 receptors, differences between the two binding sites in each receptor, or different mechanisms of inhibition such as binding site displacement and channel block.

In addition to antagonists selective for low-sensitivity 42, agonists displaying efficacy selective for high-sensitivity 42 could be identified. Analogs of A-84543 (Lin et al., 2001) seemed to activate predominantly high-sensitivity 42. A-163554, A-162035, and A-168939 were full agonists at the high-sensitivity 4(u)2(u) subform. In contrast, these compounds had the appearance of partial agonists in the mixed sensitivity 42 population expressed from message lacking UTR, to an extent consistent with high efficacy at the high-sensitivity component and low efficacy at the low-sensitivity component.

To determine whether such compounds could activate native 42, the effect on ⁸⁶Rb⁺ flux in mouse brain thalamic synaptosomes was measured under conditions selective for the 42 component. A-162035 and A-168939 stimulated ⁸⁶Rb⁺ flux to an extent nearly similar to that of 10 µM nicotine, which has been shown to produce a near-maximal 42 effect in this assay (Marks et al., 1999, 2004). Indeed, the EC₅₀ values for these compounds in mouse brain were similar to the values determined with the use of high-sensitivity 4(u)2(u) expressed in X. laevis oocytes. Furthermore, thalamic responses to A-162035 and A-168939 were blocked by the 42 antagonist DHE. These observations support the idea that high-sensitivity 42 represents a native 42 nAChR.

A simple assumption is that the mixed sensitivity 42 responses resulted from expression of different 42 receptors [e.g., 4₍₃₎2₍₂₎, and 4₍₂₎2₍₃₎] with the high-sensitivity component (4₍₂₎3₍₃₎) corresponding to the receptor expressed from UTR-containing 4 and 2 messages or low 4/2 ratios. Biphasic concentration-response curves were fit by the sum of two Hill equations, assuming independent activation of the two components. Most data were consistent with these assumptions. However, some apparent discrepancies were noted. Chlorisondamine was less potent against 4(u)2(u) than 42 stimulated by 2 µM acetylcholine even though responses were expected to be predominantly (97%) from the receptor with high-sensitivity to acetylcholine in both measurements. Nicotine was a partial agonist (24%) at 4(u)2(u), yet it seemed to be essentially a full agonist at the high-sensitivity component of ferret mixed sensitivity 42 expressed in oocytes and at the high-sensitivity component in mouse thalamic synaptosomes. The explanation is not known, but it is possible that high- and low-sensitivity components result from differences in the binding sites within the nAChR pentamer (e.g., - versus -), nonindependent - dimer function conditioned by the fifth subunit in the pentamer, or perhaps larger scale interactions in receptor clusters.

The UTR-containing mRNAs that facilitated expression of high-sensitivity 42 and 32 represent naturally expressed messages. UTRs can regulate expression at the mRNA and/or protein levels. Within some UTRs are sequences that can interact with regulatory proteins, RNA sequences, or other molecules and thereby provide means for regulating the expression of the encoded protein (Morris and Geballe, 2000; Mazumder et al., 2003; Wilusz and Wilusz, 2004). Through such processes, the expression of high- and low-sensitivity nAChR subforms may be regulated in neurons, possibly developmentally, according to cell type, or in response to various extracellular messengers. Such regulatory processes potentially could affect a variety of nAChR physiological and pharmacological actions, including nicotine dependence, antinociception, and cognitive function.

	Acknowledgements

 
We thank David G. McKenna for expert technical assistance.

	Footnotes

 
This work was supported by Abbott Laboratories.

Article, publication date, and citation information can be found at http://molpharm.aspetjournals.org.

doi:10.1124/mol.105.020198.

ABBREVIATIONS: nAChR, nicotinic acetylcholine receptor; CNS, central nervous system; UTR, untranslated region; DHE, dihydro--erythroidine; PCR, polymerase chain reaction; A-163554, (R)-2-chloro-3-(5,5-dimethyl-hexa-1,3-dienyl)-5-(pyrrolidin-2ylmethoxy)pyridine dihydrochloride; A-162035, (R)-2-chloro-3-phenyl-5-(pyrrolidin-2-ylmethoxy)-pyridine hydrochloride; A-168939, (R)-5-chloro-6-(2-pyridin-4-yl-vinyl)-2-pyrrolidin-2-yl-furo[3,2-b]pyridine dihydrochloride; A-84543, 3-[2-((S)-pyrrolidinyl)methoxypyridine; TM, transmembrane; ORF, open reading frame; CI, confidence interval; MLA, methyllycaconitine.

The online version of this article (available at http://molpharm.aspetjournals.org) contains supplemental material.

Address correspondence to: Dr. Clark A. Briggs, Neuroscience Research, R47W Bldg. AP9A-3, Abbott Laboratories, 100 Abbott Park Rd., Abbott Park, IL 60064. E-mail: clark.briggs{at}abbott.com

	References

Top Abstract Materials and Methods Results Discussion References

 
Alkondon M and Albuquerque EX (1993) Diversity of nicotinic acetylcholine receptors in rat hippocampal neurons. I. Pharmacological and functional evidence for distinct structural subtypes. J Pharmacol Exp Ther 265: 1455–1473.[Abstract/Free Full Text]

Alkondon M and Albuquerque EX (1995) Diversity of nicotinic acetylcholine receptors in rat hippocampal neurons. 3. Agonist actions of the novel alkaloid epibatidine and analysis of type-II current. J Pharmacol Exp Ther 274: 771–782.[Abstract/Free Full Text]

Alkondon M and Albuquerque EX (2004) The nicotinic acetylcholine receptor subtypes and their function in the hippocampus and cerebral cortex. Prog Brain Res 145: 109–120.[Medline]

Bertrand D, Ballivet M, and Rungger D (1990) Activation and blocking of neuronal nicotinic acetylcholine receptor reconstituted in Xenopus oocytes. Proc Natl Acad Sci USA 87: 1993–1997.[Abstract/Free Full Text]

Briggs CA, McKenna DG, and Piattoni-Kaplan M (1995) Human 7 nicotinic acetylcholine receptor responses to novel ligands. Neuropharmacology 34: 583–590.[CrossRef][Medline]

Buisson B and Bertrand D (2001) Chronic exposure to nicotine upregulates the human alpha 4 beta 2 nicotinic acetylcholine receptor function. J Neurosci 21: 1819–1829.[Abstract/Free Full Text]

Buisson B, Gopalakrishnan M, Arneric SP, Sullivan JP, and Bertrand D (1996) Human 42 neuronal nicotinic acetylcholine receptor in HEK 293 cells: a patchclamp study. J Neurosci 16: 7880–7891.[Abstract/Free Full Text]

Champtiaux N and Changeux JP (2004) Knockout and knockin mice to investigate the role of nicotinic receptors in the central nervous system. Prog Brain Res 145: 235–251.[Medline]

Champtiaux N, Gotti C, Cordero-Erausquin M, David DJ, Przybylski C, Lena C, Clementi F, Moretti M, Rossi FM, Le Novere N, et al. (2003) subunit composition of functional nicotinic receptors in dopaminergic neurons investigated with knockout mice. J Neurosci 23: 7820–7829.[Abstract/Free Full Text]

Chavez-Noriega LE, Crona JH, Washburn MS, Urrutia A, Elliott KJ, and Johnson EC (1997) Pharmacological characterization of recombinant human neuronal nicotinic acetylcholine-receptors H-22, H-24, H-2, H-34, H-42, H-44 and H-7 expressed in Xenopus oocytes. J Pharmacol Exp Ther 280: 346–356.[Abstract/Free Full Text]

Chavez-Noriega LE, Gillespie A, Stauderman KA, Crona JH, Claeps BO, Elliott KJ, Reid RT, Rao TS, Velicelebi G, Harpold MM, et al. (2000) Characterization of the recombinant human neuronal nicotinic acetylcholine receptors 3 2 and 42 stably expressed in HEK293 cells. Neuropharmacology 39: 2543–2560.[CrossRef][Medline]

Clarke PBS, Schwartz RD, Paul SM, Pert CB, and Pert A (1985) Nicotinic binding in rat brain: autoradiographic comparison of [³H]acetylcholine, [³H]nicotine and [¹²⁵I]--bungarotoxin. J Neurosci 5: 1307–1315.[Abstract]

Colquhoun LM and Patrick JW (1997) 3, 2 and 4 form heterotrimeric neuronal nicotinic acetylcholine receptors in Xenopus oocytes. J Neurochem 69: 2355–2362.[Medline]

Court JA, Perry EK, Spurden D, Lloyd S, Gillespie JI, Whiting P, and Barlow R (1994) Comparison of the binding of nicotinic agonists to receptors from human and rat cerebral cortex and from chick brain (42) transfected into mouse fibroblasts with ion channel activity. Brain Res 667: 118–122.[CrossRef][Medline]

Covernton PJO and Connolly JG (2000) Multiple components in the agonist concentration-response relationships of neuronal nicotinic acetylcholine receptors. J Neurosci Methods 96: 63–70.[CrossRef][Medline]

Curtis L, Buisson B, Bertrand S, and Bertrand D (2002) Potentiation of human 42 neuronal nicotinic acetylcholine receptor by estradiol. Mol Pharmacol 61: 127–135.[Abstract/Free Full Text]

Flores CM, Rogers SW, Pabreza LA, Wolfe BB, and Kellar KJ (1992) A subtype of nicotinic cholinergic receptor in rat brain is composed of 4 and 2 subunits and is up-regulated by chronic nicotine treatment. Mol Pharmacol 41: 31–37.[Abstract]

Gerzanich V, Peng X, Wang F, Wells G, Anand R, Fletcher S, and Lindstrom J (1995) Comparative pharmacology of epibatidine: a potent agonist for neuronal nicotinic acetylcholine receptors. Mol Pharmacol 48: 774–782.[Abstract]

Gopalakrishnan M, Monteggia LM, Anderson DJ, Molinari EJ, Piattoni-Kaplan M, Donnelly-Roberts DL, Arneric SP, and Sullivan JP (1996) Stable expression, pharmacological properties and regulation of the human neuronal nicotinic acetylcholine 42 receptor. J Pharmacol Exp Ther 276: 289–297.[Abstract/Free Full Text]

Gotti C and Clementi F (2004) Neuronal nicotinic receptors: from structure to pathology. Prog Neurobiol 74: 363–396.[CrossRef][Medline]

Hogg RC and Bertrand D (2004) Neuronal nicotinic receptors and epilepsy, from genes to possible therapeutic compounds. Bioorg Med Chem Lett 14: 1859–1861.[CrossRef][Medline]

Houlihan LM, Slater Y, Guerra DL, Peng JH, Kuo YP, Lukas RJ, Cassels BK, and Bermudez I (2001) Activity of cytisine and its brominated isosteres on recombinant human alpha 7, alpha 4 beta 2 and alpha 4 beta 4 nicotinic acetylcholine receptors. J Neurochem 78: 1029–1043.[CrossRef][Medline]

Kim H, Flanagin BA, Qin C, Macdonald RL, and Stitzel JA (2003) The mouse Chrna4 A529T polymorphism alters the ratio of high to low affinity alpha 4 beta 2 nAChRs. Neuropharmacology 45: 345–354.[CrossRef][Medline]

Kuo YP, Xu L, Eaton JB, Zhao L, Wu J, and Lukas RJ (2005) Roles for nicotinic acetylcholine receptor subunit large cytoplasmic loop sequences in receptor expression and function. J Pharmacol Exp Ther 314: 455–466.[Abstract/Free Full Text]

Kuryatov A, Gerzanich V, Nelson M, Olale F, and Lindstrom J (1997) Mutation causing autosomal dominant nocturnal frontal lobe epilepsy alters Ca²⁺ permeability, conductance and gating of human 42 nicotinic acetylcholine receptors. J Neurosci 17: 9035–9047.[Abstract/Free Full Text]

Labarca C, Schwarz J, Deshpande P, Schwarz S, Nowak MW, Fonck C, Nashmi R, Kofuji P, Dang H, Shi WM, et al. (2001) Point mutant mice with hypersensitive alpha 4 nicotinic receptors show dopaminergic deficits and increased anxiety. Proc Natl Acad Sci USA 98: 2786–2791.[Abstract/Free Full Text]

Lin NH, Li YH, He Y, Holladay MW, Kuntzweiler T, Anderson DJ, Campbell JE, and Arneric SP (2001) Synthesis and structure-activity relationships of 5-substituted pyridine analogues of 3-[2-((S)-pyrrolidinyl)methoxyl pyridine, A-84543: a potent nicotinic receptor ligand. Bioorg Med Chem Lett 11: 631–633.[CrossRef][Medline]

Marks MJ, Farnham DA, Grady SR, and Collins AC (1993) Nicotinic receptor function determined by stimulation of rubidium efflux from mouse brain synaptosomes. J Pharmacol Exp Ther 264: 542–552.[Abstract/Free Full Text]

Marks MJ, Whiteaker P, Calcaterra J, Stitzel JA, Bullock AE, Grady SR, Picciotto MR, Changeux JP, and Collins AC (1999) Two pharmacologically distinct components of nicotinic receptor-mediated rubidium efflux in mouse brain require the 2 subunit. J Pharmacol Exp Ther 289: 1090–1103.[Abstract/Free Full Text]

Marks MJ, Rowell PP, Cao JZ, Grady SR, McCallum SE, and Collins AC (2004) Subsets of acetylcholine-stimulated 86Rb+ efflux and [125I]-epibatidine binding sites in C57BL/6 mouse brain are differentially affected by chronic nicotine treatment. Neuropharmacology 46: 1141–1157.[CrossRef][Medline]

Marszalec W, Aistrup GL, and Narahashi T (1999) Ethanol-nicotine interactions at alpha-bungarotoxin-insensitive nicotinic acetylcholine receptors in rat cortical neurons. Alcohol Clin Exp Res 23: 439–445.[CrossRef][Medline]

Mazumder B, Seshadri V, and Fox PL (2003) Translational control by the 3'-UTR: the ends specify the means. Trends Biochem Sci 28: 91–98.[CrossRef][Medline]

Morris DR and Geballe AP (2000) Upstream open reading frames as regulators of mRNA translation. Mol Cell Biol 20: 8635–8642.[Free Full Text]

Nakazawa K and Ohno Y (2001) Modulation by estrogens and xenoestrogens of recombinant human neuronal nicotinic receptors. Eur J Pharmacol 430: 175–183.[CrossRef][Medline]

Nelson ME, Kuryatov A, Choi CH, Zhou Y, and Lindstrom J (2003) Alternate stoichiometries of 42 nicotinic acetylcholine receptors. Mol Pharmacol 63: 332–341.[Abstract/Free Full Text]

Olale F, Gerzanich V, Kuryatov A, Wang F, and Lindstrom J (1997) Chronic nicotine exposure differentially affects the function of human 3, 4 and 7 neuronal nicotinic receptor subtypes. J Pharmacol Exp Ther 283: 675–683.[Abstract/Free Full Text]

Papke RL, Craig AG, and Heinemann SF (1994) Inhibition of nicotinic acetylcholine receptors by bis (2,2,6,6-tetramethyl-4-piperidinyl) sebacate (Tinuvin 770), an additive to medical plastics. J Pharmacol Exp Ther 268: 718–726.[Abstract/Free Full Text]

Papke RL and Heinemann SF (1994) Partial agonist properties of cytisine on neuronal nicotinic receptors containing the 2 subunit. Mol Pharmacol 45: 142–149.[Abstract]

Papke RL, Webster JC, Lippiello PM, Bencherif M, and Francis MM (2000) The activation and inhibition of human nicotinic acetylcholine receptor by RJR-2403 indicate a selectivity for the alpha 4 beta 2 receptor subtype. J Neurochem 75: 204–216.[CrossRef][Medline]

Paradiso K, Zhang J, and Steinbach JH (2001) The C terminus of the human nicotinic alpha 4 beta 2 receptor forms a binding site required for potentiation by an estrogenic steroid. J Neurosci 21: 6561–6568.[Abstract/Free Full Text]

Sabey K, Paradiso K, Zhang J, and Steinbach JH (1999) Ligand binding and activation of rat nicotinic 42 receptors stably expressed in HEK293 cells. Mol Pharmacol 55: 58–66.[Abstract/Free Full Text]

Trumbull JD, Maslana ES, McKenna DG, Nemcek TA, Niforatos W, Pan JY, Parihar AS, Shieh CC, Wilkins JA, Briggs CA, et al. (2003) High throughput electrophysiology using a fully automated, multiplexed recording system. Recept Channels 9: 19–28.[CrossRef][Medline]

Whiting P, Esch F, Shimasaki S, and Lindstrom J (1987) Neuronal nicotinic acetylcholine receptor beta-subunit is coded for by the cDNA clone alpha 4. FEBS Lett 219: 459–463.[CrossRef][Medline]

Whiting P, Schoepfer R, Lindstrom J, and Priestley T (1991) Structural and pharmacological characterization of the major brain nicotinic acetylcholine receptor subtype stably expressed in mouse fibroblasts. Mol Pharmacol 40: 463–472.[Abstract]

Wilusz CJ and Wilusz J (2004) Bringing the role of mRNA decay in the control of gene expression into focus. Trends Genet 20: 491–497.[CrossRef][Medline]

Zhou Y, Nelson ME, Kuryatov A, Choi C, Cooper J, and Lindstrom J (2003) Human {alpha}4{beta}2 acetylcholine receptors formed from linked subunits. J Neurosci 23: 9004–9015.[Abstract/Free Full Text]

Zoli M, Le Novère N, Hill JA Jr, and Changeux J-P (1995) Developmental Regulation of nicotinic ACh receptor subunit mRNAs in the rat central and peripheral nervous systems. J Neurosci 15: 1912–1939.[Abstract]

Zwart R and Vijverberg HPM (1998) Four pharmacologically distinct subtypes of 42 nicotinic acetylcholine receptor expressed in Xenopus laevis oocytes. Mol Pharmacol 54: 1124–1131.[Abstract/Free Full Text]

This article has been cited by other articles:

				C. D. Son, F. J. Moss, B. N. Cohen, and H. A. Lester Nicotine Normalizes Intracellular Subunit Stoichiometry of Nicotinic Receptors Carrying Mutations Linked to Autosomal Dominant Nocturnal Frontal Lobe Epilepsy Mol. Pharmacol., May 1, 2009; 75(5): 1137 - 1148. [Abstract] [Full Text] [PDF]

				N. B. Fedorov, L. C. Benson, J. Graef, P. M. Lippiello, and M. Bencherif Differential Pharmacologies of Mecamylamine Enantiomers: Positive Allosteric Modulation and Noncompetitive Inhibition J. Pharmacol. Exp. Ther., February 1, 2009; 328(2): 525 - 532. [Abstract] [Full Text] [PDF]

				M. Moroni, R. Vijayan, A. Carbone, R. Zwart, P. C. Biggin, and I. Bermudez Non-Agonist-Binding Subunit Interfaces Confer Distinct Functional Signatures to the Alternate Stoichiometries of the {alpha}4{beta}2 Nicotinic Receptor: An {alpha}4-{alpha}4 Interface Is Required for Zn2+ Potentiation J. Neurosci., July 2, 2008; 28(27): 6884 - 6894. [Abstract] [Full Text] [PDF]

				A. Kuryatov, J. Onksen, and J. Lindstrom Roles of Accessory Subunits in {alpha}4{beta}2* Nicotinic Receptors Mol. Pharmacol., July 1, 2008; 74(1): 132 - 143. [Abstract] [Full Text] [PDF]

				C. Gotti, M. Moretti, N. M. Meinerz, F. Clementi, A. Gaimarri, A. C. Collins, and M. J. Marks Partial Deletion of the Nicotinic Cholinergic Receptor {alpha}4 or {beta}2 Subunit Genes Changes the Acetylcholine Sensitivity of Receptor-Mediated 86Rb+ Efflux in Cortex and Thalamus and Alters Relative Expression of {alpha}4 and {beta}2 Subunits Mol. Pharmacol., June 1, 2008; 73(6): 1796 - 1807. [Abstract] [Full Text] [PDF]

				R. Zwart, A. L. Carbone, M. Moroni, I. Bermudez, A. J. Mogg, E. A. Folly, L. M. Broad, A. C. Williams, D. Zhang, C. Ding, et al. Sazetidine-A Is a Potent and Selective Agonist at Native and Recombinant {alpha}4{beta}2 Nicotinic Acetylcholine Receptors Mol. Pharmacol., June 1, 2008; 73(6): 1838 - 1843. [Abstract] [Full Text] [PDF]

				R. M. Drenan, R. Nashmi, P. Imoukhuede, H. Just, S. McKinney, and H. A. Lester Subcellular Trafficking, Pentameric Assembly, and Subunit Stoichiometry of Neuronal Nicotinic Acetylcholine Receptors Containing Fluorescently Labeled {alpha}6 and 3 Subunits Mol. Pharmacol., January 1, 2008; 73(1): 27 - 41. [Abstract] [Full Text] [PDF]

				L. Tapia, A. Kuryatov, and J. Lindstrom Ca2+ Permeability of the ({alpha}4)3(beta2)2 Stoichiometry Greatly Exceeds That of ({alpha}4)2(beta2)3 Human Acetylcholine Receptors Mol. Pharmacol., March 1, 2007; 71(3): 769 - 776. [Abstract] [Full Text] [PDF]

				M. Moroni, R. Zwart, E. Sher, B. K. Cassels, and I. Bermudez {alpha}4beta2 Nicotinic Receptors with High and Low Acetylcholine Sensitivity: Pharmacology, Stoichiometry, and Sensitivity to Long-Term Exposure to Nicotine Mol. Pharmacol., August 1, 2006; 70(2): 755 - 768. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Data Supplement All Versions of this Article: mol.105.020198v1 70/1/227    most recent Submit a response Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Briggs, C. A. Articles by Surowy, C. S. Search for Related Content PubMed PubMed Citation Articles by Briggs, C. A. Articles by Surowy, C. S.