QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Data Supplement All Versions of this Article: mol.106.025304v1 70/2/549    most recent Submit a response Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Carney, S. A. Articles by Heideman, W. Search for Related Content PubMed PubMed Citation Articles by Carney, S. A. Articles by Heideman, W.

Aryl Hydrocarbon Receptor Activation Produces Heart-Specific Transcriptional and Toxic Responses in Developing Zebrafish

Molecular and Environmental Toxicology Program (S.A.C., R.E.P., W.H.), Pharmaceutical Sciences (J.C., R.E.P., W.H.), and Biomolecular Chemistry (K.M.X., W.H.), University of Wisconsin, Madison, Wisconsin; and Cardiovascular Research Center, Massachusetts General Hospital, Harvard University, Charlestown, Massachusetts (C.G.B.)

Received April 5, 2006; accepted May 19, 2006

	Abstract

Top Abstract Materials and Methods Results Discussion References

 
Proper regulation of the aryl hydrocarbon receptor (AHR), a ligand-activated transcription factor, is required for normal vertebrate cardiovascular development. AHR hyperactivation by 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) during zebrafish (Danio rerio) development results in altered heart morphology and function, culminating in death. To identify genes that may cause cardiac toxicity, we analyzed the transcriptional response to TCDD in zebrafish hearts. Zebrafish larvae were exposed to TCDD for 1 h at 72 h after fertilization (hpf), and the hearts were extracted for microarray analysis at 1, 2, 4, and 12 h after exposure (73, 74, 76, and 84 h postfertilization). The remaining body tissue was also collected at each time for comparison. TCDD rapidly induced expression in 42 genes within 1 to2hof exposure. These genes function in xenobiotic metabolism, proliferation, heart contractility, and pathways that regulate heart development. Furthermore, these expression changes preceded signs of cardiovascular toxicity, characterized by decreased stroke volume, peripheral blood flow, and a halt in heart growth. This identifies strong candidates for important AHR target genes. It is noteworthy that the TCDD-induced transcriptional response in the hearts of zebrafish larvae was substantially different from that induced in the rest of the body tissues. One of the biggest differences included a cluster of genes that were down-regulated 12 h after exposure in heart tissue, but not in the body samples. More than 70% of the transcripts in this heart-specific cluster promote cellular growth and proliferation. Thus, the developing heart stands out as being responsive to TCDD at both the level of toxicity and gene expression.

In addition to this adaptive response, it is now believed that the AHR/ARNT complex also plays a physiological function during development (Hahn, 2003). Manipulation of AHR activity disrupts the normal development of specific organs at specific developmental stages. This is very apparent in cardiovascular development: both overactivation and underactivation of the AHR/ARNT pathway during early life stages can disrupt vertebrate cardiovascular development.

Ahr-null mice show vascular defects (Fernandez-Salguero et al., 1996; Schmidt et al., 1996; Lahvis et al., 2000; Walisser et al., 2004) as well as defects in heart development (Fernandez-Salguero et al., 1997; Thackaberry et al., 2002; Lund et al., 2003), whereas AHR activation in mice exposed to the AHR agonist 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) during gestation produces alterations in heart size, myocyte proliferation, and basal and isoproterenol-responsive heart rate. An initial reduction in heart weight in developing mice seems to cause progressive cardiac hypertrophy (Lin et al., 2001; Thackaberry et al., 2005b). TCDD exposure during development also causes alterations in heart structure and function in birds (Cheung et al., 1981; Rifkind et al., 1985; Brunstrom and Lund, 1988; Canga et al., 1988, 1993; Walker et al., 1997; Walker and Catron, 2000; Sommer et al., 2005), including a reduction in cardiac myocyte number, a decrease in myocyte proliferation, and an increase in apoptosis (Ivnitski et al., 2001).

In embryonic fish, TCDD at parts-per-billion concentrations results in marked heart malformations, reduced peripheral blood flow, pericardial edema, and hemorrhage (Helder, 1980, 1981; Wisk and Cooper, 1990; Spitsbergen et al., 1991; Henry et al., 1997; Elonen et al., 1998; Hornung et al., 1999; Guiney et al., 2000; Teraoka et al., 2002). TCDD reduces heart size during development in both zebrafish and trout (Hornung et al., 1999; Antkiewicz et al., 2005). In zebrafish embryos, a reduction in cardiomyocyte numbers is the earliest known response to TCDD and is associated with compaction of the ventricle, elongation of the heart, and increased incidence of ventricular standstill. Effects on the heart can be seen before any observable effect on blood flow (Antkiewicz et al., 2005).

These developmentally specific responses suggest that the toxic responses are due to misregulation of a signaling pathway that is important for normal development. This is strengthened by recent work in which developmental defects in hypomorphic Ahr and Arnt mutant mice were reversed by using TCDD to titrate AHR activity toward normal levels (Walisser et al., 2004). In addition, there is growing evidence that the adaptive detoxification response, involving genes such as cyp1a, does not play a major role in the prominent developmental defects produced by TCDD (Carney et al., 2004). If TCDD produces cardiac toxicity through the misregulation of target genes normally controlled by the AHR/ARNT pathway (Bunger et al., 2003; Walisser et al., 2004) then identification of AHR/ARNT target genes should provide important insights into both TCDD toxicity and normal heart development.

Microarrays have been used to identify global gene expression changes induced by TCDD in a variety of vertebrate cell types (Puga et al., 2000b; Frueh et al., 2001; Martinez et al., 2002; Fisher et al., 2004; Jin et al., 2004; Vezina et al., 2004; Hanlon et al., 2005). A recent study identified TCDD-induced gene expression changes in whole zebrafish embryos after a 3-day exposure to TCDD, a point at which cardiac toxicity is strongly manifested (Handley-Goldstone et al., 2005). The study found TCDD-induced changes consistent with late stage heart failure, including transcripts involved in sarcomere structure and mitochondrial energy transfer. Whereas these gene expression changes are clearly associated with the pathological changes in the heart, the relationship between the transcript changes seen 3 days after initial exposure and the direct targets of AHR/ARNT is difficult to assess. In addition, important changes in transcripts in the heart might easily be masked by the signal from mRNA produced in the rest of the body, which is far more massive than the heart.

To identify AHR/ARNT target genes in the heart, we exposed zebrafish embryos to TCDD beginning at 72 h after fertilization (hpf) and measured TCDD-induced gene expression changes in the hearts of zebrafish larvae at 1, 2, 4, and 12 h after exposure, correlating the gene expression changes with the emergence of toxic responses. Because the hearts of zebrafish larvae are less than 200 µm in diameter and weigh less than 100 µg (Hu et al., 2000; Antkiewicz et al., 2005), we used a novel dissection method to rapidly extract sufficient numbers of hearts for Affymetrix microarray hybridization (Burns and MacRae, 2006). TCDD induced expression of a group of genes within only 1 to2hof exposure, identifying potential candidate AHR/ARNT targets. Toxic responses were not observed until 8 h after exposure. At 12 h after exposure, we observed repression of a considerably larger group of genes. More than 70% of these transcripts are involved in cell growth. This coincided with a halt in cardiomyocyte growth. It is remarkable that most of the alterations in expression were heart-specific: at all time points, the transcriptional response to TCDD in hearts was far more substantial than the response in the extracardiac tissues.

	Materials and Methods

Top Abstract Materials and Methods Results Discussion References

 
Zebrafish Embryos. Fertilized cmcl2::GFP+/- zebrafish (Danio rerio) embryos were obtained from adult male cmcl2::GFP+/+ (AB background) fish bred with female AB fish, maintained at 27° with a 14-h/10-h light/dark cycle, and used for each experiment except those experiments carried out to assess heart looping and myocyte cell number. To assess heart looping without pigment blocking, albino embryos were used (AB background). To assess myocyte cell number, cmcl2::dsRed2-nuc+/+ embryos were used (AB background). All embryos were raised in egg water (60 µg/ml Instant Ocean Salts; Aquarium Systems, Mentor, OH).

Waterborne Exposure of Larvae to TCDD. Recently hatched larvae were statically exposed to 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD, > 99% purity; Chemsyn, Lenexa, KS) for 1 h from 72 to 73 hpf by maintaining larvae in egg water containing either vehicle [0.1% dimethyl sulfoxide (DMSO)] or TCDD (1 ng/ml) as described previously (Carney et al., 2004).

Experimental Design. For experiments assessing cardiovascular toxicity n was defined as the set of larvae exposed to waterborne TCDD or vehicle in a single vial. For microarray analysis of gene expression changes in the heart three replicates (n = 3) were collected for each treatment at each time point. Each replicate consisted of 500 hearts pooled from six blocks. For each block, 130 larvae were exposed to either TCDD or vehicle in a single vial before the heart extraction procedure, which yielded approximately 80 to 90 hearts/130 larvae. For microarray analysis of gene expression changes in the body, 20 larval bodies were collected after the heart extraction procedure at 73, 74, 76, and 84 hpf from larvae exposed to TCDD or vehicle in a single vial at 72 hpf for 1 h. Three replicates (n = 3) were collected for each treatment at each time point. For real-time PCR analysis of gene expression changes in three heart replicates (n = 3) were collected in the same manner as for the microarray analysis. The sample collection times are shown in Fig. 1.

View larger version (28K): [in this window] [in a new window]   Fig. 1. Schematic of experimental design illustrating the timing of microarray analysis and assessment of cardiac function and heart morphology in zebrafish larvae exposed to TCDD at 72 hpf.

Microarray Analysis. Total RNA was isolated from 500 extracted hearts for each treatment group using a QIAGEN RNeasy Mini kit according to the manufacturer's protocol (QIAGEN, Valencia, CA). cDNA and biotin-labeled cRNA were produced from 1 µg of each RNA sample using the Affymetrix One-Cycle Target Labeling and Control Reagents kit according to the manufacturer's protocol (Affymetrix, Santa Clara, CA). Samples were hybridized on Affymetrix GeneChip Zebrafish Arrays following the procedure in the Affymetrix GeneChip Expression Analysis Technical Manual. In brief, 15 µg of fragmented biotin-labeled cRNA was hybridized to a zebrafish array for 16 h at 45° with rotation. After hybridization, arrays were washed and stained with streptavidin-phycoerythrin on an Affymetrix Fluidics Station 400 using protocol EukGE-W32v4. Arrays were scanned using the Agilent Gene Array Scanner. The relative abundance of each transcript was calculated by Affymetrix Microarray Suite (MAS) 5.0 software. Intensity values within each replicate for each treatment and time point were averaged for each transcript represented on the array. To determine the change in gene expression induced by TCDD, the log₂(TCDD/DMSO) was calculated from the averaged intensity values for each transcript represented on the array. Significant changes were determined by two-class unpaired Significance Analysis of Microarray (SAM) with a 10% false discovery rate for each time point using TIGR MultiExperiment Viewer (TMEV) software (Saeed et al., 2003) from The Institute for Genomic Research (TIGR). Subsequent hierarchical cluster analysis [average linkage cluster of genes, Euclidean distance (Eisen et al., 1998)] with TMEV software was performed on significant gene expression changes of 2-fold or more to group genes with similar TCDD-induced expression patterns. Raw microarray data were deposited in the European Bioinformatics Institute (EMBL-EBI) ArrayExpress database (accession number E-MEXP-758). TCDD-induced expression changes for genes selected from each cluster were confirmed with quantitative real-time PCR. Genes not annotated by Affymetrix MAS 5.0 software were blasted against the zebrafish genome (assembly version 37, February 2006) through the Ensembl Zebrafish Genome Browser maintained by the Wellcome Trust Sanger Institute. Protein translations of transcripts that mapped to known or novel zebrafish genes were blasted against the UniProt knowledgebase (Swiss-Prot + TrEMBL) through the ExPASy Proteomics Server maintained by the Swiss Institute of Bioinformatics. Gene functions were assigned based on results of peer-reviewed published primary literature.

Real-Time PCR. Total RNA was isolated from three replicates of 500 extracted hearts for each treatment group (n = 3 for TCDD and DMSO treatments at 73, 74, 76, and 84 hpf) using a QIAGEN RNeasy Mini kit according to the manufacture's protocol. cDNA was produced from 1 µg of each RNA sample using SuperScript II (Invitrogen) and anchored oligo(dT) primer (Integrated DNA Technologies, Coralville, IA). Quantitative real-time PCR using specific gene primers was performed using the Light Cycler (Roche Applied Science, Indianapolis, IN), with 1 µl of each cDNA sample in the presence of SYBR Green according to the manufacture's instructions. Gel electrophoresis and thermal denaturation (melt curve analysis) were used to confirm specific product formation. mRNA levels of analyzed genes were normalized to -actin mRNA to generate a relative expression ratio. The TCDD-induced change in mRNA expression is reported as the log₂ (TCDD relative expression ratio/DMSO relative expression ratio). Only significant TCDD-induced changes (p 0.05) are reported. All oligonucleotide primers were synthesized by Integrated DNA Technologies (Coralville, IA) and are written 5' to 3'. Oligonucleotides for real-time PCR were: -actin: forward, aagcaggagtacgatgagtc; reverse, tggagtcctcagatgcattg; cyp1a: forward, tgccgatttcatccctttcc; reverse, agagccgtgctgatagtgtc; mcm2: forward, aaagacgttcgcacggtatc; reverse, aagtccgggagactccagat; atp13b: forward, gcaactcagtgttccagcag; reverse, gaggatgttggggacttgag; endothelin1: forward, gctggaatacctcgctcaag; reverse, gcacatggctttggctttat, hey2: forward, cacccaacagcagctttaga; reverse, cccccaaacaaacagtagtga; pcna: forward, ctctgtccaagacggtcaca; reverse, acaatcgggaatccattgaa; irx4a: forward, gttatcgcgggaagttgtgt; reverse, caaggtccgagtccgtctaa; myogenin: forward, gccttggagggcttaatttc; reverse, gaatcagccttcctgactgc; and pik3r3: forward, tggtagcgaagtggtctgtc; reverse, aggcagccacaatgaaaagt.

Red Blood Cell Perfusion Rate. Red blood cell perfusion rate was measured in an intersegmental vessel of the trunk as an index of regional blood flow as described previously (Teraoka et al., 2002; Prasch et al., 2003; Carney et al., 2004). In brief, the number of red bloods cells passing a defined point in the intersegmental vessel in 10 s was counted from time-lapse videomicroscopy recordings.

Pericardial Sac Area. The magnitude and incidence of TCDD-induced pericardial edema in larvae was determined by quantitation of the pericardial sac area as described previously (Prasch et al., 2003; Carney et al., 2004). In brief, the pericardial sac area was outlined in lateral view images and quantitated using Scion Image for Windows (Scion Corporation, Frederick, MD).

Heart Looping. To assess the angle of looping between the atrium and ventricle, time-lapse recordings of the beating heart were made from larvae mounted in 3% methylcellulose and carefully positioned for time-lapse imaging of the ventral view of the heart with an Optronics MicroFire camera mounted on a Leica MZ16 stereomicroscope. From each recording, 10 frames were selected that represented the heart at various stages of contraction. In each frame, the angle of the atrium and ventricle from the sagittal plane was measured with NIH Image J 1.34 software (http://rsb.info.nih.gov/nihimage/), and these were averaged to yield an angle of looping for each heart.

Heart Function. The volume of the ventricle at end-diastole and end-systole and heart rate were measured in larvae to calculate stroke volume, ejection fraction, and cardiac output. The volume of the ventricle was approximated from linear dimensions taken from two-dimension images with Simpson's method, also called the method of discs (Schiller et al., 1989; Coucelo et al., 2000). This method approximates a ventricle volume by dividing the ventricle into slices of finite thickness from the apex to base and calculates the ventricle volume by addition of the individual slice volumes using the equation , where A is the planimetered area and T is the slice thickness. The two-dimensional image of each ventricle at end-diastole and end-systole was divided into 15 to 20 slices of 10 µm thickness. The planimeter area of each slice was calculated from its transverse diameter, which was assumed to be circular.

To generate a two-dimensional image of the ventricle at end-diastole and end-systole, time-lapse recordings were taken at 250 frames/s of the beating heart in larvae mounted in 3% methylcellulose with a MotionScope camera mounted on a Nikon TE300 inverted microscope. Frames that captured the ventricle at end-diastole and end-systole were identified and used to approximate the end-diastolic volume (EDV) and end-systolic volume (ESV). The ventricle was outlined in the selected frames, overlaid with a grid to designate the 10 µm divisions, and the transverse diameter recorded for each slice using MetaMorph software (Molecular Devices, Sunnyvale, CA). The same time-lapse recordings were used to calculate heart rate based on the number of frames between three beats.

Stroke volume (SV) and ejection fraction (EF) were calculated from the approximated EDV and ESV using the equations SV = EDV - ESV and EF = (EDV - ESV)/EDV x 100. Cardiac output (CO) was calculated from SV and heart rate (HR): CO = SV x HR.

Ventricle Size. Larvae were placed in 500 mM potassium chloride + 4 mg/ml Tricaine-S for 4 min to depolarize the cardiac myocytes resulting in a loss of excitability and cardiac arrest (Chambers, 2003). Larvae were immediately placed in 3% methylcellulose and the ventricle imaged with epifluorescence by a Micromax chargecoupled device camera (Princeton Scientific Instruments, Monmouth Junction, NJ) mounted on an inverted Nikon TE300 microscope. The volume of the arrested ventricle was calculated as described above.

Heart Myocyte Number. Cardiac myocytes were counted in cmcl2::dsRed2-nuc transgenic zebrafish larvae as described previously (Mably et al., 2003; Antkiewicz et al., 2005). Epifluorescence images were captured and the red fluorescent nuclei of the cardiac myocytes were counted to determine the number of cardiac myocytes.

Statistical Analysis. For blood flow, heart looping, pericardial sac area, EDV, ESV, HR, CO, EF, ventricle size, cardiac myocyte number, and real-time PCR quantitation of gene expression significance of TCDD-induced changes were determined using a two-way analysis of variance followed by the Fisher least-significant-difference test. These statistical analyses were performed using a Statistica 6.0 software package (StatSoft, Inc., Tulsa, OK). Results are presented as mean ± S.E.; level of significance was p 0.05.

	Results

Top Abstract Materials and Methods Results Discussion References

 
Experimental Design. In previous studies of TCDD-induced cardiovascular toxicity, zebrafish embryos were exposed to TCDD shortly after fertilization; a point well before the onset of heart development (Henry et al., 1997; Dong et al., 2002; Teraoka et al., 2002; Prasch et al., 2003; Antkiewicz et al., 2005). However, to identify AHR/ARNT target genes, we needed to identify cardiac transcripts that were altered immediately after initial AHR activation by TCDD. To do this, we needed to expose the zebrafish during a window in which TCDD can induce cardiovascular toxicity and the hearts have developed to a stage that enabled extraction for RNA isolation. Previous work by Belair et al. (2001) showed that hatched larvae exposed to TCDD at 72 hpf had severely reduced blood flow by 120 hpf, indicating that 72 hpf is well within the window of sensitivity to TCDD-induced cardiovascular toxicity. Hearts can be readily extracted from zebrafish larvae from 72 to 84 hpf. Therefore, at 72 hpf, zebrafish larvae were exposed for 1 h to TCDD or vehicle, and then hearts were collected at 1, 2, 4, and 12 h after dosing (73, 74, 76, and 84 hpf, respectively) for microarray analysis (Fig. 1). It should be mentioned that TCDD is not appreciably redistributed or metabolized during this time course, so that TCDD was present in the tissues at all time points. The hearts were extracted as whole organs, including the four chambers connected in series (sinus venosus, atrium, ventricle, and bulbus arteriosus) with epicardial, myocardial, and endocardial layers. To provide a context for interpreting the TCDD-induced gene expression changes in the heart, we also assessed the progression of cardiovascular toxicity in larvae exposed to TCDD at 72 hpf.

Cardiovascular Toxicity in TCDD-Treated Zebrafish Larvae. The earliest toxic response observed was a decrease in ventricular stroke volume at 8 h after TCDD exposure (Fig. 2). We observed no consistent effect on heart rate; however, applying an algorithm previously validated in another fish species allowed us to assess the ventricular end-diastolic and end-systolic volumes using time-lapse recordings of the beating zebrafish hearts (Coucelo et al., 2000). This revealed a TCDD-induced decrease in stroke volume at 8 h (80 hpf). The decrease in stroke volume produced a concomitant decrease in cardiac output.

View larger version (16K): [in this window] [in a new window]   Fig. 2. Cardiac function is reduced within 12 h in zebrafish larvae exposed to TCDD. Larvae were exposed to TCDD or vehicle for 1 h at 72 hpf, and the beating heart was imaged with time-lapse recordings at 4, 8, and 12 h after exposure (76, 80, and 84 hpf). A, stroke volume was calculated from EDV and ESV values approximated from two-dimensional images of the ventricle at end-diastole and end-systole. B, heart rate was calculated from the number of frames between three consecutive heart beats in the time-lapse recordings. C, cardiac output was calculated from stroke volume and heart rate. Values are mean ± S.E. of n = 5. *, significant difference between TCDD (1 ng/ml) and its respective vehicle control (0.1% DMSO) for each time point (p 0.05).

View larger version (18K): [in this window] [in a new window]   Fig. 3. Contribution of TCDD-induced changes in EDV and ESV to altered ejection fraction in larvae exposed to TCDD. Larvae were exposed to TCDD or vehicle for1 h at 72 hpf, and the beating heart was imaged with time-lapse recordings at 4, 8, and 12 h after exposure (76, 80, and 84 hpf). A, ejection fraction was calculated from EDV and ESV. B, ESV was approximated from a two-dimensional image of the ventricle at end-systole. C, EDV was approximated from a two-dimensional image of the ventricle at end-diastole. Values are mean ± S.E. of n = 5. *, significant difference between TCDD (1 ng/ml) and its respective vehicle control (0.1% DMSO) for each time point (p 0.05).

View larger version (100K): [in this window] [in a new window]   Fig. 4. TCDD exposure at 72 hpf causes cardiovascular toxicity in zebrafish larvae. Larvae were exposed to TCDD or vehicle for 1 h at 72 hpf and assessed for endpoints of cardiovascular toxicity at 4, 12, 24, and 48 h after exposure (76, 84, 96, and 120 hpf). A, red blood cell perfusion rates were measured in an intersegmental vessel posterior to the anal pore as an index of peripheral blood flow in larvae from each treatment group. B, pericardial area was measured from lateral view images of the pericardial sac area as an index of pericardial edema in larvae from each treatment group. C, the angle of the longest plane through the ventricle and atrium bisecting the atrioventricular valve from the sagittal plane was measured as an index of heart looping. Images at the right are representative photos of the ventral view of the heart depicting heart looping at 4, 12, 24, and 48 h after exposure to TCDD (1 ng/ml) or vehicle control (0.1% DMSO). Values are mean ± S.E. of n = 10. *, significant difference between TCDD and its respective vehicle control for each time point (p 0.05). Scale bar, 0.1 mm.

View larger version (18K): [in this window] [in a new window]   Fig. 5. Effect of TCDD exposure on heart size in developing zebrafish larvae. Larvae were exposed to TCDD or vehicle for 1 h at 72 hpf and assessed at 12 and 24 h (84 and 96 hpf). A, the volume of the ventricle was approximated from two-dimensional images captured after treatment with potassium chloride to arrest the heart. B, the number of cardiac myocytes was counted in epifluorescent images of flat-mounted cmcl2::deRed2-nuc transgenic larvae. Values are mean ± S.E. of n = 5. *, significant difference between TCDD (1 ng/ml) and its respective vehicle control (0.1% DMSO) for each time point (p 0.05).

It seems that TCDD halted growth of the heart at a point around 12 h after exposure. This is suggested by the fact that although the control hearts increased in size and cell number in the interval between the 12- and 24-h time points (84 to 96 hpf), the TCDD-treated hearts did not. The size of the ventricle and the number of cardiac myocytes in the hearts of TCDD-treated larvae at 24 h after exposure is about the same as observed at the 12-h point for both TCDD-treated and untreated larvae.

TCDD-Induced Transcriptional Response in the Heart. TCDD-induced gene expression changes in the heart were identified at all points examined, 1, 2, 4, and 12 h after TCDD exposure. Many of these changes preceded any observed change in heart morphology and function, whereas other sets of gene expression changes were correlated with the emergence of cardiac toxicity. Expression of 160 genes was changed 2-fold or more by TCDD exposure at one or more of these time points. Hierarchical clustering placed these transcripts into groups with similar TCDD-induced patterns of expression (Fig. 6A). At first, TCDD induced up-regulation of a small group of 19 genes at 1 h after TCDD exposure (73 hpf). The most strongly up-regulated of those genes fall into cluster 1, which is mostly composed of genes encoding xenobiotic metabolizing enzymes, cytochrome P450 1a, cytochrome P450 1b, and cytochrome P450 1c1, as well as myeloid-specific peroxidase and a transcript similar to a novel TCDD-inducible poly (ADP-ribose) polymerase (Fig. 6A, Table 1). Expression of the genes in clusters 1, 2, 3, 7, and 8 was altered within 1 to 2 h of TCDD activation of the AHR pathway (Fig. 6A); therefore, these genes are the strongest candidates for being AHR/ARNT targets. These transcriptional responses to TCDD precede the development of cardiac toxicity in zebrafish larvae and, except for the genes encoding xenobiotic metabolizing enzymes, they function mostly in cellular signaling pathways and transcriptional regulation (Fig. 6B). The data for these early responding genes, meeting the criterion of being up-regulated at either the 1- or 2-h point, are listed in Table 2.

View larger version (37K): [in this window] [in a new window]   Fig. 6. Clustering of TCDD-induced gene expression changes in the zebrafish heart. Larvae were exposed to TCDD or vehicle for 1 h at 72 hpf, and hearts were collected for microarray analysis at 1, 2, 4, and 12 h after initial exposure (73, 74, 76, and 84 hpf). A, hierarchical cluster of genes which TCDD significantly altered expression 2-fold at any time point. B, pie charts show biological functions of genes in clusters 1, 2, 3, 8 (pretoxicity gene expression changes), and 9 (post-toxicity gene expression changes).

The first three sets of samples for microarray analysis were collected at times that preceded observable TCDD-induced cardiac toxicity, which did not appear until 8 h after exposure. The great majority of expression changes at these time points (1-4 h after exposure) were positive, representing genes that are up-regulated by TCDD. However, the samples collected during the onset of toxicity at the 12-h point (84 hpf) revealed a large cluster of 76 transcripts that were down-regulated in hearts of TCDD-treated larvae (Fig. 6A, cluster 9). More than half of these genes are involved in cell division and proliferation (Fig. 6B, cluster 9) and function in DNA synthesis, replication, and repair; cell cycle control; chromosome condensation; mitotic spindle formation; and cytokinesis (Table 3 and Supplemental Table S1). These gene expression changes coincide with the onset of TCDD-induced cardiac toxicity and reduced peripheral blood flow. Therefore, they may be secondary consequences of earlier TCDD-induced transcriptional changes. They may also be homeostatic responses to TCDD-induced cardiac toxicity and ischemia. In addition to the genes controlling cell division and proliferation, TCDD exposure altered expression of genes that encode proteins involved in ion movement, calcium modulation, contractile function, and cell adhesion (Table 4 and Supplemental Table S1), processes that are necessary for normal myocyte contraction. TCDD also altered expression of genes from signaling pathways and transcription factors that play essential roles in normal heart development in zebrafish. These include members of the Notch and transforming growth factor- signaling pathways and transcription factors that control muscle-specific genes (Table 4 and S1).

Real-time quantitative PCR of selected genes was conducted to confirm the trends and patterns of the TCDD-induced transcriptional response in the zebrafish heart. TCDD-induced expression levels for each gene selected for real-time PCR analysis were normalized to -actin, the expression of which was not altered by TCDD treatment during this time course. The results of the real-time PCR analysis are shown in bold in Tables 1, 2, 3, 4 and confirm the TCDD-induced up-regulation or down-regulation of those genes in the zebrafish heart.

Comparison of TCDD-Induced Transcriptional Response in the Heart Versus Body. At each time point, the bodies of zebrafish larvae were also collected after removal of the hearts to allow microarray comparisons using extracardiac tissue. The set of genes altered 2-fold or greater by TCDD, in either the bodies or hearts, at any time point were organized by expression pattern using hierarchical clustering (Fig. 7A). Beyond a group of genes up-regulated across the time course by TCDD that consists mostly of genes encoding phase I and II metabolizing enzymes (Fig. 7A, lower box), there was little similarity in the transcriptional response to TCDD in the heart and body samples. There were fewer TCDD-induced up-regulated genes detected in the whole-body samples compared with the heart samples across all time points. Furthermore, the large cluster of genes down-regulated in the heart at the 12-h point (84 hpf) was not detected in the body samples (Fig. 7B). Most of the TCDD-induced gene expression changes detected in the body samples were also present in the heart samples, but most of the expression changes detected in the heart samples were not detected in the extracardiac tissues (Fig. 7B).

View larger version (32K): [in this window] [in a new window]   Fig. 7. Comparison of TCDD-induced gene expression changes in the zebrafish heart and whole body. Larvae were exposed to TCDD or vehicle for 1 h at 72 hpf, and hearts, as well as samples of bodies with hearts removed, were collected for microarray analysis at 1, 2, 4, and 12 h after initial exposure (73, 74, 76, and 84 hpf). A, hierarchical cluster of genes in which TCDD significantly altered expression by 2-fold in either the heart or body samples at any time point. B, number of genes up- or down-regulated 2-fold or more in the heart or body by TCDD exposure. The left column at each time point represents the number of genes significantly up-regulated (red) or down-regulated (green) in the heart (H), whereas the right column at each time point represents changes in the body (B). The hashed portion of each column represents the number of significantly altered genes found in both the heart and body samples, illustrating the amount of overlap in the genes regulated by TCDD in both heart and body.

	Discussion

Top Abstract Materials and Methods Results Discussion References

There were several striking aspects to our results. First, the almost immediate induction of the genes in the AHR battery in both heart and body samples indicated rapid TCDD activation of AHR in the heart tissue. Second, in the heart, we observed the expected early induction of a relatively small set of genes, followed by larger transcript clusters as time progressed. Third, with the exception of the small cluster of xenobiotic metabolizing genes, the majority of gene expression changes observed in the heart were not characteristic of zebrafish cells in general and were not observed in the body samples. Thus, in contrast to the majority of the surrounding tissues, the developing heart stands out as an organ in which TCDD induces both toxicity and changes in gene expression. Finally, the known functions of many of the transcripts altered in the heart by TCDD exposure are consistent with the nature and timing of TCDD-induced cardiotoxic responses.

TCDD Rapidly Induced a Cluster of Xenobiotic Metabolizing Genes in Both Heart and Body Samples. Genes in cluster 1 (Fig. 6A) encode xenobiotic metabolizing enzymes, including cytochrome P4501a, cytochrome P4501b1, and cytochrome P4501c1, as well as myeloid-specific peroxidase and a transcript similar to a novel TCDD-inducible poly (ADP-ribose) polymerase. Most of these were induced during the first hour of TCDD exposure in both heart and body samples. This cluster contains genes that are known direct targets for AHR and were therefore very likely to have been directly induced by AHR/ARNT binding to promoter elements. Although our study looked specifically at only one tissue type, the fact that this cluster of xenobiotic metabolizing genes was induced in both the heart and the extracardiac samples is consistent with the idea that the xenobiotic protective function may be widespread in cells expressing AHR and ARNT.

Temporal Patterns of Gene Expression in Heart and Extracardiac Tissues. Beyond the small cluster of xenobiotic metabolizing transcripts, the pattern of the transcriptional response in the heart was quite distinct from that in extracardiac tissues. The number of genes affected in the heart steadily increased, whereas the number of transcripts altered in the body samples remained relatively constant throughout the time course. In addition, the early changes in the heart samples were primarily gene induction events, but by 12 h after exposure, there was a large cluster of down-regulated heart transcripts. Given the fact that AHR/ARNT has been characterized as a transcriptional activator, the down-regulation of these genes may be a secondary response to earlier transcriptional changes. This pattern is consistent with a cascade of events, in which early activation of a small set of genes by AHR/ARNT leads to progressive cellular changes. Indeed, although the transcriptional effects of TCDD continued to increase over time, at 12 h after exposure, many of the initial transcriptional changes had diminished or disappeared.

Gene clusters 2 and 3 contained a group of genes that were rapidly altered in the heart, but were unaffected in the body samples. These clusters consisted largely of genes involved in controlling cellular growth, development, and homeostasis; such changes would be expected to have profound effects on heart cell growth and development.

Cluster 9 was even more striking in that it consisted of a heart-specific set of 71 transcripts down-regulated at 12 h after TCDD exposure (84 hpf). Another important feature about this gene cluster is that more than 70% of the genes in this cluster are involved in cell cycle progression.

Mechanisms of Cardiac Gene Regulation. Our results do not clearly distinguish transcripts that are directly regulated by AHR activation from those that are indirectly affected. However, TCDD very rapidly induced known AHR targets such as cyp1a in the heart cells. In this case, the changes are most easily explained by direct AHR/ARNT activation within the cardiac cells. In addition, the rapidity of the transcriptional response in the heart cells, occurring within an hour of TCDD exposure and hours before any perceptible hemodynamic change, argues against regulation of the early transcripts through indirect effects mediated by other cell types or as responses to physiological changes in blood flow.

The causes of later transcriptional changes in the heart are far more uncertain. As indicated, many of these are decreases in transcript abundance and may be secondary responses. Circulation has dropped at 12 h after TCDD exposure, and it is possible that tissues such as the peripheral vascular endothelium produce signals eliciting some of gene expression changes observed in heart cells at this later time point.

Heart versus Body. The transcriptional response to TCDD was remarkably different between the heart and body samples. However, it must be borne in mind that the gene expression changes measured in the bodies represent the average of the changes in a variety of tissues. This averaging effect may mask TCDD-induced transcript changes that occur in an organ or cell type that makes up only a small fraction of the tissue. Despite these uncertainties, the TCDD-induced pattern of transcript changes in the heart is clearly quite distinct from that produced in the body samples, where the xenobiotic metabolism response was predominant. This indicates that different cell or tissue types can have very distinct transcriptional responses to TCDD activation of AHR. It will be interesting to determine whether other TCDD-responsive tissues have characteristic transcriptional responses.

A set of microarray experiments examining the effects of TCDD on gene expression in the murine fetal heart has recently been reported (Thackaberry et al., 2005a). In this work, the authors discuss the lack of concordance between sets of genes identified in different published microarray experiments examining responses to TCDD. In a general sense, TCDD induced a similar set of xenobiotic metabolism genes in the mouse and zebrafish hearts. However, there were not strong similarities in the datasets. This probably stems in part from the major differences in the design of the experiments, in which we closely concentrated on the time frame after exposure. Furthermore, developing fish are substantially more sensitive to developmental abnormalities caused by AHR activation than mammals (Elonen et al., 1998).

Heart-Specific Physiological Responses. A common approach to studying the developmental effects of TCDD in zebrafish has been to expose embryos immediately after fertilization (Henry et al., 1997; Teraoka et al., 2002; Antkiewicz et al., 2005). The exposed embryos develop normally through gastrulation and early heart formation but then steadily exhibit signs of cardiotoxicity over the next few days (Antkiewicz et al., 2005). When larvae were exposed to TCDD after formation of the heart at 72 hpf, the cardiovascular response to AHR activation was clear cut, with signs of toxicity manifested after only 8 h of exposure (80 hpf). The two major responses observed were decreased end-diastolic volume (EDV) and a reduction in cardiomyocyte numbers. These were first observed at 8 and 24 h after exposure, respectively.

The decrease in EDV could be due to a decrease in the force of blood filling the ventricle or to a decrease in the ability of the ventricle to relax and dilate between contractions. There is precedence for the first model in that TCDD has been shown to increase vascular permeability in fish (Guiney et al., 2000; Dong et al., 2004). Proteins leaking from the blood into the intracellular space would decrease blood volume and central venous pressure.

Relaxation of the ventricle during diastole depends largely on the distensibility of the ventricle and clearing of Ca⁺² from the cytosol. Myocytes relax when Ca⁺² is sequestered into the sarcoplasmic reticulum or extruded to the intercellular space to prepare for the next contraction. In zebrafish embryo hearts, impaired extrusion of Ca⁺² from the cytosol results in defects in ventricle contraction and heart morphology (Ebert et al., 2005). Therefore, impairment of this mechanism or an increase in ventricle rigidity could reduce ventricular expansion during filling. The tight coupling between cardiac output and venous return makes it difficult to determine, based only on the heart function measurements examined, whether reduced filling or impaired ventricle relaxation caused the decrease in EDV. However, it is interesting to note that several genes needed for the maintenance of normal ionic balance and contractility were found among the early sets of transcripts altered by TCDD exposure.

Studies with mice, chicks, and fish suggest that regulation of cardiac myocyte proliferation is a key mechanism by which AHR alters heart growth during development (Ivnitski et al., 2001; Lin et al., 2001; Thackaberry et al., 2003, 2005a, b; Antkiewicz et al., 2005). Possible mechanisms include transcriptional regulation of genes that control proliferation as well as direct interactions between AHR and cell cycle regulatory proteins in the nucleus (Puga et al., 2000a, b). In our experiments, the reduction in cardiomyocyte number might also be secondary to reduced cardiac output because heart function and growth are tightly linked (Hove et al., 2003). However, gene expression changes that would inhibit heart cell proliferation were observed well before TCDD-induced heart dysfunction. For example, during the first 2 h of exposure, TCDD up-regulated two negative regulators of cell cycle progression: phosphoinositide-3-kinase polypeptide 3 p55 (pik3r3) and max interacting protein 1 (mxi1). Pik3r3 binds the retinoblastoma tumor suppressor protein to induce cell cycle arrest (Xia et al., 2003), and mxi1 is one member of a network of proteins that opposes myc signaling to suppress proliferation (Grandori et al., 2000). After only4hof TCDD exposure, TCDD decreased expression of proliferating cell nuclear antigen (pcna), as well as two minichromosome maintenance genes, mcm2 and mcm5, that play critical roles in DNA replication (Bailis and Forsburg, 2004). These are all known markers of proliferation (Saeed et al., 2003; Nolte et al., 2005). It is noteworthy that these cardiac-specific transcriptional responses occurred before any observable toxic responses. In addition, a halt in cellular proliferation would not produce noticeable changes in total cell number for at least several hours. Therefore, the plateau in cardiomyocyte number at 24 h after exposure (96 hpf) could be the result of a transcriptional process initiated shortly after TCDD exposure.

Although AHR/ARNT is likely to play roles in the cell beyond that of transcriptional activation, our model suggests that TCDD initiates cardiotoxicity by transcriptional misregulation of genes in the developing heart. This is based on the well known ability of the AHR/ARNT heterodimer to act as a transcriptional regulator and the demonstration that deletion of the nuclear localization sequence from AHR in mice results in resistance to TCDD toxicity (Bunger et al., 2003). This model is reinforced by the rapid changes in transcript abundance observed in heart cells after TCDD exposure. In such a model, the transcriptional changes that lead to toxicity should be identifiable among the sets of transcripts that are altered shortly after TCDD exposure.

	Acknowledgements

 
We thank Dorothy Nesbit for technical assistance with the real-time PCR analysis and Dagmara S. Antkiewicz for expertise with microscopy imaging. We also thank M. Waters and B. Guy for laboratory assistance.

	Footnotes

 
This work was supported by the University of Wisconsin Sea Grant Institute, National See Grant College Program, National Oceanic and Atmospheric Administration, U.S. Department of Commerce grant number NA16RG2257, Sea Grant Project Numbers R/BT-16 and R/BT-17, and by National Institutes of Health grant R01-ES012716 from the National Institute of Environmental Health Sciences (to W.H. and R.E.P.). This work was also supported by National Institutes of Health grant T32-ES07015 from the National Institute of Environmental Health Sciences (to S.A.C.) and the Molecular and Environmental Toxicology Program (University of Wisconsin-Madison) National Institute of Environmental Health Sciences Training grant contribution 357.

ABBREVIATIONS: AHR, aryl hydrocarbon receptor; ARNT, aryl hydrocarbon receptor nuclear translocator; TCDD, 2,3,7,8-tetrachlorodibenzo-p-dioxin; hpf, hours postfertilization; DMSO, dimethyl sulfoxide; PCR, polymerase chain reaction; EDV, end-diastolic volume; ESV, end-systolic volume; EF, ejection fraction; SV, stroke volume; CO, Cardiac output; HR, heart rate.

The online version of this article (available at http://molpharm.aspetjournals.org) contains supplemental material.

Address correspondence to: Warren Heideman, University of Wisconsin-Madison, School of Pharmacy, 5111 Rennebohm Hall, 777 Highland Avenue, Madison, WI 53705. E-mail: wheidema{at}wisc.edu

	References

Top Abstract Materials and Methods Results Discussion References

 
Antkiewicz DS, Burns CG, Carney SA, Peterson RE, and Heideman W (2005) Heart malformation is an early response to TCDD in embryonic zebrafish. Toxicol Sci 84: 368-377.[Abstract/Free Full Text]

Bailis JM and Forsburg SL (2004) MCM proteins: DNA damage, mutagenesis and repair. Curr Opin Genet Dev 14: 17-21.[CrossRef][Medline]

Belair CD, Peterson RE, and Heideman W (2001) Disruption of erythropoiesis by dioxin in the zebrafish. Dev Dyn 222: 581-594.[CrossRef][Medline]

Brunstrom B and Lund J (1988) Differences between chick and turkey embryos in sensitivity to 3,3',4,4'-tetrachloro-biphenyl and in concentration/affinity of the hepatic receptor for 2,3,7,8-tetrachlorodibenzo-p-dioxin. Comp Biochem Physiol C 91: 507-512.

Bunger MK, Moran SM, Glover E, Thomae TL, Lahvis GP, Lin BC, and Bradfield CA (2003) Resistance to 2,3,7,8-tetrachlorodibenzo-p-dioxin toxicity and abnormal liver development in mice carrying a mutation in the nuclear localization sequence of the aryl hydrocarbon receptor. J Biol Chem 278: 17767-17774.[Abstract/Free Full Text]

Burns CG and MacRae CA (2006) Purification of hearts from zebrafish embryos [published erratum appears in Biotechniques 40:596, 2006]. Biotechniques 40: 274, 276, 278.

Canga L, Levi R, and Rifkind AB (1988) Heart as a target organ in 2,3,7,8-tetrachlorodibenzo-p-dioxin toxicity: decreased beta-adrenergic responsiveness and evidence of increased intracellular calcium. Proc Natl Acad Sci USA 85: 905-909.[Abstract/Free Full Text]

Canga L, Paroli L, Blanck TJ, Silver RB, and Rifkind AB (1993) 2,3,7,8-Tetrachlorodibenzo-p-dioxin increases cardiac myocyte intracellular calcium and progressively impairs ventricular contractile responses to isoproterenol and to calcium in chick embryo hearts. Mol Pharmacol 44: 1142-1151.[Abstract]

Carney SA, Peterson RE, and Heideman W (2004) 2,3,7,8-Tetrachlorodibenzo-p-dioxin activation of the aryl hydrocarbon receptor/aryl hydrocarbon receptor nuclear translocator pathway causes developmental toxicity through a CYP1A-independent mechanism in zebrafish. Mol Pharmacol 66: 512-521.[Abstract/Free Full Text]

Chambers DJ (2003) Mechanisms and alternative methods of achieving cardiac arrest. Ann Thorac Surg 75: S661-S666.[Abstract/Free Full Text]

Cheung MO, Gilbert EF, and Peterson RE (1981) Cardiovascular teratogenicity of 2,3,7,8-tetrachlorodibenzo-p-dioxin in the chick embryo. Toxicol Appl Pharmacol 61: 197-204.[CrossRef][Medline]

Coucelo J, Joachim N, and Coucelo J (2000) Calculation of volumes and systolic indices of heart ventricle from Halobatrachus didactylus: echocardiographic noninvasive method. J Exp Zool 286: 585-595.[CrossRef][Medline]

Dong W, Teraoka H, Tsujimoto Y, Stegeman JJ, and Hiraga T (2004) Role of aryl hydrocarbon receptor in mesencephalic circulation failure and apoptosis in zebrafish embryos exposed to 2,3,7,8-tetrachlorodibenzo-p-dioxin. Toxicol Sci 77: 109-116.[Abstract/Free Full Text]

Dong W, Teraoka H, Yamazaki K, Tsukiyama S, Imani S, Imagawa T, Stegeman JJ, Peterson RE, and Hiraga T (2002) 2,3,7,8-Tetrachlorodibenzo-p-dioxin toxicity in the zebrafish embryo: local circulation failure in the dorsal midbrain is associated with increased apoptosis. Toxicol Sci 69: 191-201.[Abstract/Free Full Text]

Ebert AM, Hume GL, Warren KS, Cook NP, Burns CG, Mohideen MA, Siegal G, Yelon D, Fishman MC, and Garrity DM (2005) Calcium extrusion is critical for cardiac morphogenesis and rhythm in embryonic zebrafish hearts. Proc Natl Acad Sci USA 102: 17705-17710.[Abstract/Free Full Text]

Eisen MB, Spellman PT, Brown PO, and Botstein D (1998) Cluster analysis and display of genome-wide expression patterns. Proc Natl Acad Sci USA 95: 14863-14868.[Abstract/Free Full Text]

Elonen GE, Sphear RL, Holcombe GW, and Johnson RD (1998) Comparative toxicity of 2,3,7,8-tetrachlorodibenzo-p-dioxin to seven freshwater species during early life-stage development. Environ Toxicol Chem 17: 472-483.[CrossRef]

Fernandez-Salguero PM, Hilbert DM, Rudikoff S, Ward JM, and Gonzalez FJ (1996) Aryl-hydrocarbon receptor-deficient mice are resistant to 2,3,7,8-tetrachlorodibenzo-p-dioxin-induced toxicity. Toxicol Appl Pharmacol 140: 173-179.[CrossRef][Medline]

Fernandez-Salguero PM, Ward JM, Sundberg JP, and Gonzalez FJ (1997) Lesions of aryl-hydrocarbon receptor-deficient mice. Vet Pathol 34: 605-614.[Abstract]

Fisher MT, Nagarkatti M, and Nagarkatti PS (2004) Combined screening of thymocytes using apoptosis-specific cDNA array and promoter analysis yields novel gene targets mediating TCDD-induced toxicity. Toxicol Sci 78: 116-124.[Abstract/Free Full Text]

Frueh FW, Hayashibara KC, Brown PO, and Whitlock JP Jr (2001) Use of cDNA microarrays to analyze dioxin-induced changes in human liver gene expression. Toxicol Lett 122: 189-203.[CrossRef][Medline]

Grandori C, Cowley SM, James LP, and Eisenman RN (2000) The Myc/Max/Mad network and the transcriptional control of cell behavior. Annu Rev Cell Dev Biol 16: 653-699.[CrossRef][Medline]

Guiney PD, Walker MK, Spitsbergen JM, and Peterson RE (2000) Hemodynamic dysfunction and cytochrome P4501A mRNA expression induced by 2,3,7,8-tetrachlorodibenzo-p-dioxin during embryonic stages of lake trout development. Toxicol Appl Pharmacol 168: 1-14.[CrossRef][Medline]

Hahn ME (2003) Evolutionary and physiological perspectives on Ah receptor function and dioxin toxicity, in Dioxins and Health (Schecter A GT ed) pp 559-602, John Wiley and Sons, Hoboken, NJ.

Handley-Goldstone HM, Grow MW, and Stegeman JJ (2005) Cardiovascular gene expression profiles of dioxin exposure in zebrafish embryos. Toxicol Sci 85: 683-693.[Abstract/Free Full Text]

Hanlon PR, Zheng W, Ko AY, and Jefcoate CR (2005) Identification of novel TCDD-regulated genes by microarray analysis. Toxicol Appl Pharmacol 202: 215-228.[CrossRef][Medline]

Helder T (1980) Effects of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) on early life stages of the pike (Esox lucius, L.). Sci Total Environ 14: 183-193.

Helder T (1981) Effects of 2,3,7,8-tetrachlorodibenzo-dioxin (TCDD) on early life stages of rainbow trout (Salmo gairdneri, Richardson). Toxicology 19: 101-112.[CrossRef][Medline]

Henry TR, Spitsbergen JM, Hornung MW, Abnet CC, and Peterson RE (1997) Early life stage toxicity of 2,3,7,8-tetrachlorodibenzo-p-dioxin in zebrafish (Danio rerio). Toxicol Appl Pharmacol 142: 56-68.[CrossRef][Medline]

Hornung MW, Spitsbergen JM, and Peterson RE (1999) 2,3,7,8-Tetrachlorodibenzo-p-dioxin alters cardiovascular and craniofacial development and function in sac fry of rainbow trout (Oncorhynchus mykiss). Toxicol Sci 47: 40-51.[Abstract/Free Full Text]

Hove JR, Koster RW, Forouhar AS, Acevedo-Bolton G, Fraser SE, and Gharib M (2003) Intracardiac fluid forces are an essential epigenetic factor for embryonic cardiogenesis. Nature (Lond) 42: 172-177.

Hu N, Sedmera D, Yost HJ, and Clark EB (2000) Structure and function of the developing zebrafish heart. Anat Rec 260: 148-157.[CrossRef][Medline]

Ivnitski I, Elmaoued R, and Walker MK (2001) 2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) inhibition of coronary development is preceded by a decrease in myocyte proliferation and an increase in cardiac apoptosis. Teratol 64: 201-212.

Jin B, Kim G, Park DW, and Ryu DY (2004) Microarray analysis of gene regulation in the Hepa1c1c7 cell line following exposure to the DNA methylation inhibitor 5-aza-2'-deoxycytidine and 2,3,7,8-tetrachlorodibenzo-p-dioxin. Toxicol In Vitro 18: 659-664.[CrossRef][Medline]

Lahvis G, Lindell S, Thomas R, McCuskey R, Murphy C, Glover E, Bentz M, Southard J, and Bradfield C (2000) Portosystemic shunting and persistent fetal vascular structures in aryl hydrocarbon receptor-deficient mice. Proc Natl Acad Sci USA 97: 10442-10447.[Abstract/Free Full Text]

Lin TM, Ko K, Moore RW, Buchanan DL, Cooke PS, and Peterson RE (2001) Role of the aryl hydrocarbon receptor in the development of control and 2,3,7,8-tetrachlorodibenzo-p-dioxin-exposed male mice. J Toxicol Environ Health 64: 327-342.

Lund AK, Goens MB, Kanagy NL, and Walker MK (2003) Cardiac hypertrophy in aryl hydrocarbon receptor null mice is correlated with elevated angiotensin II, endothelin-1, and mean arterial blood pressure. Toxicol Appl Pharmacol 193: 177-187.[CrossRef][Medline]

Mably JD, Mohideen MA, Burns CG, Chen JN, and Fishman MC (2003) heart of glass regulates the concentric growth of the heart in zebrafish. Curr Biol 13: 2138-2147.[CrossRef][Medline]

Martinez JM, Afshari CA, Bushel PR, Masuda A, Takahashi T, and Walker NJ (2002) Differential toxicogenomic responses to 2,3,7,8-tetrachlorodibenzo-p-dioxin in malignant and nonmalignant human airway epithelial cells. Toxicol Sci 69: 409-423.[Abstract/Free Full Text]

Nolte T, Kaufmann W, Schorsch F, Soames T, and Weber E (2005) Standardized assessment of cell proliferation: the approach of the RITA-CEPA working group. Exp Toxicol Pathol 57: 91-103.[CrossRef][Medline]

Prasch AL, Teraoka H, Carney SA, Dong W, Hiraga T, Stegeman JJ, Heideman W, and Peterson RE (2003) Aryl hydrocarbon receptor 2 mediates 2,3,7,8-tetrachlorodibenzo-p-dioxin developmental toxicity in zebrafish. Toxicol Sci 76: 138-150.[Abstract/Free Full Text]

Puga A, Barnes SJ, Dalton TP, Chang C, Knudsen ES, and Maier MA (2000a) Aromatic hydrocarbon receptor interaction with the retinoblastoma protein potentiates repression of E2F-dependent transcription and cell cycle arrest. J Biol Chem 275: 2943-2950.[Abstract/Free Full Text]

Puga A, Maier A, and Medvedovic M (2000b) The transcriptional signature of dioxin in human hepatoma HepG2 cells. Biochem Pharmacol 60: 1129-1142.[CrossRef][Medline]

Rifkind AB, Sassa S, Reyes J, and Muschick H (1985) Polychlorinated aromatic hydrocarbon lethality, mixed-function oxidase induction, and uroporphyrinogen decarboxylase inhibition in the chick embryo: dissociation of dose-response relationships. Toxicol Appl Pharmacol 78: 268-279.[CrossRef][Medline]

Rowlands JC and Gustafsson JA (1997) Aryl hydrocarbon receptor-mediated signal transduction. Crit Rev Toxicol 27: 109-134.[Medline]

Saeed AI, Sharov V, White J, Li J, Liang W, Bhagabati N, Braisted J, Klapa M, Currier T, Thiagarajan M, et al. (2003) TM4: a free, open-source system for microarray data management and analysis. Biotechniques 34: 374-378.[Medline]

Schiller NB, Shah PM, Crawford M, DeMaria A, Devereux R, Feigenbaum H, Gutgesell H, Reichek N, Sahn D, Schnittger I, et al. (1989) Recommendations for quantitation of the left ventricle by two-dimensional echocardiography. American Society of Echocardiography Committee on Standards, Subcommittee on Quantitation of Two-Dimensional Echocardiograms. J Am Soc Echocardiogr 2: 358-367.[Medline]

Schmidt JV and Bradfield CA (1996) Ah receptor signaling pathways. Annu Rev Cell Dev Biol 12: 55-89.[CrossRef][Medline]

Schmidt JV, Su GH, Reddy JK, Simon MC, and Bradfield CA (1996) Characterization of a murine Ahr null allele: involvement of the Ah receptor in hepatic growth and development. Proc Natl Acad Sci USA 93: 6731-6736.[Abstract/Free Full Text]