|
|
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Department of Pharmacology, University of Milan, Milan, Italy (A.B., L.G., S.F., G.M., A.N., G.C.); Gene Transfer Laboratory, IST, Genoa, Italy (R.G.); and Department of Experimental Pathology and Oncology, University of Florence, Florence, Italy (S.C.)
Received July 30, 2006; accepted October 31, 2006
| Abstract |
|---|
|
|
|---|
Most inducible genes, including those coding for growth factors, receptors, or regulatory proteins, have unstable mRNAs because cells may have to modulate the corresponding protein level rapidly (Chen and Shyu, 1995
). For these genes, the rate of mRNA turnover is the crucial step in regulating basic functions, including cell cycle, cell viability, and reaction to stress (Winzen et al., 2004
; Cheadle et al., 2005
).
The differences in phenotypes among cells are due mainly to untranslated sequences involved in regulation rather than in coding sequences. Regulatory factors include RNA binding proteins that heavily influence individual's proteome by regulating RNA stability and translation. These proteins associate with multiple messenger RNAs according to a model of coordinated gene expression of functionally related transcripts (Keene and Lager, 2005
).
At the level of individual transcript, we have shown that the turnover of the bcl2 messenger can be regulated by the protein Bcl2 itself. A combinatorial mechanism is emerging of RNA regulation by multitarget proteins responsible for different levels of specificity and functionality.
Two major degradation mechanisms have been shown to affect mammalian mRNAs half-life: deadenylation decapping-mediated decay (Gao et al., 2001
; Bail and Kiledjian, 2006
), and decay mediated by the ARE motives (Guhaniyogi and Brewer, 2001
; Raijmakers et al., 2004
). In both pathways, gene-specific stretches, usually located in the 3'-UTR and 5'-UTR, are needed for degradation (Stoecklin et al., 2006
).
|
mRNA turnover has been found to be located in discrete cytoplasmic foci, the processing bodies. Under stress conditions that lead to stalled translation, preinitiation complexes can aggregate in cytoplasmic granules from which selected transcripts are degraded (Brengues et al., 2005
; Kedersha et al., 2005
).
Understanding the molecular mechanisms that regulate the rate of degradation and learning how each mRNA is maintained at the desired level in the cellular cytoplasm are crucial issues. Future studies might unravel new pathogenic pathways leading to many diseases, including cancer (Audic and Hartley, 2004
; Denkert et al., 2004
) or neurodegenerative disorders (Si et al., 2004
) and disclose new therapeutic strategies to regulate gene expression by exogenous means. Moreover, inhibition of the degradation process increases the cellular amount of RNA and of its relative protein.
The regulation of inducible proteins causes obvious phenotypes. For instance, increasing the cellular level of the antiapoptotic protein Bcl2 can protect cells from apoptotic stimuli, although it might have transforming effects (Meijerink et al., 2005
). The degradation of Bcl2 mRNA is an ARE-dependent process (Schiavone et al., 2000
) mediated by trans- acting elements (Donnini et al., 2004
). The rate of Bcl2 mRNA degradation is also dependent on the amount of the Bcl2 protein in the cells (Bevilacqua et al., 2003a
).
In the present work, three ORNs designed on the ARE motif (b-ARE) of Bcl2 mRNA have been studied through UV cross-linking assays to prove their AUBP inactivation according to a decoy-aptamer mechanism.
|
| Materials and Methods |
|---|
|
|
|---|
-D-ribofuranosyl-benzimidazole (DRB) was purchased from Sigma-Aldrich (St. Louis, MO).
Plasmids, Synthetic Transcripts, and Recombinant Proteins. The KpnI/HindIII 240-base pair fragment containing the SV40 promoter was excised from the pGL3-promoter vector and cloned into the corresponding restriction sites of the pGL4.71 vector (Promega, Madison, WI) to obtain the pGL4.71P plasmid. The 5'-primer CGTCTAGAGTCAACATGCCTGC and the 3'-primer CGTCTAGAGGTGATCCGGCCAA (flanked at the 5'-end by a CG overhang followed by the XbaI restriction site) were used to amplify the 400-base pair segment containing the 3'-UTR ARE sequence from the human bcl2 cDNA fragment. This fragment was cloned into the XbaI cloning site at the 3'-end of the hRlucP gene coding for Renilla reniformis luciferase of the pGL4.71P plasmid to produce the pGL4.71P b-ARE plasmid. Synthetic Bcl2 RNA (b-RNA) (540 nt) used for in vitro degradation assays was prepared as described previously (Bevilacqua et al., 2003a
). For UV cross-linking assays, radiolabeled bcl2 transcript was synthesized as described previously (Chen et al., 2001
). Proteins GST-KSRP, GST-HuR, and GST-AUF1(p37) were produced in BL21 and purified using glutathione affinity-Sepharose 4B (GE Healthcare, Little Chalfont, Buckinghamshire, UK) resin, whereas histidine-tagged TTP were produced in Escherichia coli and purified using glutathione affinity-Sepharose 4B or nickel-nitrilotriacetic acid (QIAGEN, Valencia, CA).
UV Cross-Linking. UV cross-linking assays were performed as described previously (Chen et al., 2001
) with minor modifications. Each AUBP (KSRP, 400 ng; TTP, 300 ng; and HuR or p37-AUF1 200 ng) and 32P-labeled b-RNA (0.5 ng = 2 x 105 cpm) were incubated at room temperature for 20 min in an RNA-binding buffer (20 µl) containing 10 mM HEPES, pH 7.6, 3 mM MgCl2, 100 mM KCl, 2 mM dithiothreitol, 5% glycerol, 0.5% Nonidet P-40, 1 µg of yeast RNA, and 1 µg of heparin. For competition experiments, unlabeled ORNs (1, 10, and 100 µM) were incubated with lysates for 10 min before the addition of the RNA probe. Unbound RNA was digested with RNAase T1 (200 units per reaction) for 15 min at 37°C. Reaction mixtures were transferred to a 96-well plate and irradiated at 4°C for 10 min with a UV Stratalinker (Stratagene, La Jolla, CA). After digestion with RNase A (200 ng per reaction) for 10 min at 37°C, samples were separated by electrophoresis on reducing 10% SDS-polyacrylamide gels. Gels were dried, and 32P-labeled proteins were made visible by autoradiography.
|
Cell Transfection. HEK 293 cells were cotransfected with pcDNA3 and pGL4.71P b-ARE plasmid expressing the chimeric mRNA Rluc-b-ARE by using Lipofectamine 2000 (Invitrogen, Carlsbad, CA). After 48 h, cells were replated in selective media containing 0.8 mg/ml antibiotic G418 (Sigma-Aldrich). Single clones were selected for their resistance to G418 and luciferase activity.
RNA Immunoprecipitation Assay. RNA immunoprecipitation was performed according to Gherzi et al. (2004
) with slight modifications. In brief, HEK 293 cells, stably expressing pGL4.71P b-ARE plasmid, were transfected with ORNs at 1.5 µM. After 48 h, cells were lysed in a buffer containing 50 mM Tris-HCl, pH 8.0, 150 mM NaCl, 100 mM NaF, 1 M Na3VO4, 1 mM EGTA, 1 mM EDTA, 1% Triton X-100, 2 mM phenylmethylsulfonyl fluoride, 10 mM vanadyl ribonucleoside complex, and 1 mg/ml aprotinin for 15 min at 4°C. Lysates, spun at 14,000g for 15 min at 4°C, and supernatants were incubated overnight with rabbit
KSRP (Gherzi et al., 2004
) or TTP (purchased from Dr. W. Rigby, Dartmouth Medical School, Hanover, NH) or
HuR MoAb (Santa Cruz Biotechnology, Santa Cruz, CA) at 4°C under rotation and purified with protein A (rabbit antibodies) or Sepharose G (MoAb). RNA, extracted with RNAzol, was determined by real-time RT-PCR using an Rluc-b-ARE chimeric probe.
Western Blot Analysis. The assays were performed under standard conditions. Blots were probed with
Bcl2 (Dako North America, Inc., Carpinteria, CA),
p27, and
HuR (Santa Cruz) MoAbs or rabbit
KSRP,
TTP, and 
-actin (Sigma-Aldrich) and detected by ECL Plus kit (GE Healthcare).
Statistics. The data were expressed as means ± S.D., statistical significance was calculated by using a Student's t test, where *, P
0.05 and **, P
0.01.
| Results |
|---|
|
|
|---|
Oligoribonucleotides were added at 1 µM to the RNA-AUBP mixture in the reaction tube of the UV cross-linking assay. Figure 1B shows that each ORN inhibited the binding of AUBPs to the b-RNA in a sequence-specific fashion.
ORN2 was the most effective in displacing KSRP, HuR, and AUF1. In the TTP assay, the three ORNs inhibited the binding event with similar efficacy. Although UV cross-linking is only a semiquantitative assay, ORNs were able to displace AUF1, an effective regulator of the b-RNA half-life (Lapucci et al., 2002
), in a dose-response fashion (Fig. 1C). To address the displacement activity in cells, HEK 293 cells stably transfected with pGL4.71P b-ARE plasmid expressing chimeric mRNA Rluc-b-ARE were treated with ORNs (1.5 µM). RNA immunoprecipitation assays were performed 30 h after transfection with ORNs to evaluate the effect on AUBPs binding to b-ARE. The amount of the relevant RNA was significantly reduced in cells treated with sense ORNs, as shown in Fig. 1D.
In Vitro Inhibition of b-RNA Degradation. Whether displacement of AUBPs might change the rate of b-RNA turnover was analyzed by a cell-free degradation assay. The b-RNA fragment including b-ARE, labeled by incorporation of the precursor DlG-UTP, was transcribed as reported previously (Bevilacqua et al., 2003a
). An IGFR RNA fragment, labeled as above, was added to the degradation mixture as a control. For the decay assays, cell lysates from DOHH2 lymphoma cells were mixed with the relevant transcripts and incubated at 37°C for the indicated times.
The three ORNs, used in combination to span the entire b-ARE motif at a final concentration of 10 µM, proved highly effective (Fig. 2A). Figure 2B shows that the half-life of the b-RNA was more than twice that of samples containing degORNs. In contrast, the degradation rate of the IGFR transcript, not expressing ARE motifs, was unaffected. The slowdown of b-RNA turnover by the ORNs was dose-dependent: the activity increased from 1 to 10 µM and decreased at higher doses (Fig. 2, C and D). Oligonucleotides designed in between ORN1 and ORN2 or ORN2 and ORN3 or flanking the core sequence did not display a significant activity (data not shown).
|
Increased Level and Stabilization of RNAs in Cell Lines. Raji lymphoma cells and HL60 promyelocytic cells were exposed to three ORNs mixed to a total concentration of 1.5 µMin N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium methylsulfate. The amount of Bcl2 mRNA in the cells was measured by real-time RT-PCR (TaqMan Probe System) at the indicated times.
As shown in Fig. 4, A and C, ORNs were able to increase the amount of Bcl2 mRNA in both cell lines, with the highest activity being obtained 48 h after treatment. The possibility that ORNs might stabilize Bcl2 mRNA was studied by analyzing the amount of Bcl2 mRNA in extracts from cells treated with the transcription inhibitor DRB. Using the real-time RT-PCR, the Bcl2 mRNA half-life was calculated as 4.5 h in untreated cells and as more than 7 h in ORN-treated Raji cells (Fig. 4B); it was 3.5 h in untreated versus 6 h in ORN-treated HL60 cells (Fig. 4D). Individual AUBPs can interact and regulate the mRNA decay of many genes (Chen and Shyu, 1995
); it is thus possible that the AUBPs displacement can stabilize ARE-expressing genes other than bcl2 (Supplemental Data S1). Therefore, we measured the amount of c-myc RNA in HL60 cells (Fig. 4E) and the amount of MKK6 and p27 RNA in Raji cells (Fig. 4, F and G). The amount of all three RNAs was significantly increased in cells treated with sense-oriented ORNs.
|
|
| Discussion |
|---|
|
|
|---|
In direct UV cross-linking assays, ORNs successfully competed with the b-ARE motif, probably inhibiting the interaction of recombinant HuR, KSRP, AUF1, or TTP with b-RNA. Although both stabilizing and destabilizing AUBPs were displaced by oligonucleotides, RNA stabilization turned out as the final effect of ORN treatment.
ORN2, designed on the central region of the ARE motif, was the most effective to inhibit the binding of all four AUBPs. In this subregion are located relevant determinants for the degradation machinery, determinants that are required for the binding of important AUBPs. The binding activity of HuR and KSRP to the b-ARE was strongly decreased also in HEK 293 cells upon ORNs treatment, as shown by RNA immunoprecipitation.
Each AUBP, including those studied here, can bind AREs present in several mRNAs (Good, 1995
; Lu and Schneider, 2004
). How one AUBP can bind different nucleotide structures is not yet known. A possibility is the recognition of characterizing elements such as the AUUUA pentamer or U-rich stretches expressed in the 3'-UTR of many messengers (Winzen et al., 2004
; Fialcowitz et al., 2005
). According to the post-transcriptional operon model (Keene and Lager, 2005
), RNA binding proteins coordinately regulate the expression of multiple mRNAs encoding functionally related proteins. These mechanisms provide combinatorial regulation of genetic information, including the evolution of multifunctionality of eukaryotic proteins. Systems and high through put approaches have provided insight into coordinated post-transcription regulation of gene expression. Multiple interactions have been shown by micro-RNAs, which can also complement short 3'-UTR stretches (5-8 nt) within a variety of RNA targets contributing to regulate protein synthesis along a coordinated fashion (Yoon and De Micheli, 2005
; Kim and Nam, 2006
). This study, although not involved directly into this matter, suggests that characterizing structures expressed in most AREs may behave as shared targets for AUBPs.
The binding of a protein to different AREs of unrelated transcripts was inhibited by sequence-specific ORNs mimicking endogenous structures. Meanwhile, one single ORN can compete with different AUBPs.
The decoy activity in vitro and in cell lines actually turned out to regulate the rate of b-RNA degradation. In the cell-free system, ORNs protected b-RNA from the degradative action of an effective cell extract. The most effective individual ORN was ORN2, although ORN3 showed no detectable activity. Thus, the stabilizing activity mirrored the decoy activity. Moreover, the effect of the triple ORN mixture on the rate of b-RNA degradation was dose-dependent. This suggests that the decreased interaction of destabilizing AUBPs with Bcl2 mRNA transcript, due to the ORN presence, leads to an mRNA stabilization.
In different human cell lines, ORNs were able to significantly increase the level of Bcl2 mRNA. The biochemical mechanism might be dependent on the ORN ability to slow down the rate of degradation, as shown by the time course determinations of the Bcl2 mRNA in cells treated with a transcription inhibitor.
Not entirely unexpected, ORNs also inhibited the rate of degradation of unrelated mRNAs whose decay is dependent on AREs and AUBPs. These observations might figure out the coordinated and temporally linked regulation of functionally related transcripts.
Consistent with the increased amount of mRNA, the level of Bcl2 protein was significantly and dose-dependently higher in cells exposed to ORNs. Moreover, as predicted above, the level of proteins encoded by stabilized RNAs were increased as well. It is shown that the p27 protein, which fluctuates during the cell cycle often in coordination with the level of Bcl2 (Calastretti et al., 2001
; Greider et al., 2002
), was also up-regulated. Although the mechanism of RNA augmentation by ORNs homologous to the b-ARE motif is only in part understood, the findings described here are in keeping with a model in which ARE is regulated at different levels of specificity and coordination (Keene and Lager, 2005
).
The ARE of the bcl2 gene, characterized by a unique nucleotide sequence, might be targeted specifically by the relevant protein that actually regulates the rate of degradation of its own RNA, according to a negative feedback mechanism (Bevilacqua et al., 2003a
). The bcl2 transcript can also be regulated specifically by antisense-oriented oligoribonucleotides targeting the b-ARE motif (Ghisolfi et al., 2005
), supporting the concept of the individual regulation.
Conversely, the coordinated regulation of multiple related transcripts, as shown here by the use of sense-oriented ORNs, is not in contrast with the single transcript regulation. On the basis of studies on AUBP displacement, sequence-specific ORNs, by competing for the docking sites of proteins that recognize common elements within the ARE structures, might exert a multitranscript activity. These findings support a combinatorial modality for the coordinating transcript regulation based on the interaction of trans-acting factors and cis-elements.
| Acknowledgements |
|---|
| Footnotes |
|---|
A.B. and L.G. contributed equally to this work.
ABBREVIATIONS: ARE, adenine-uridine rich element; AUBP, adenine-uridine binding protein; ORN, oligoribonucleotide; UTR, untranslated region; b-ARE, bcl2 adenine-uridine rich element; b-RNA, 3'-untranslated region of Bcl2 RNA; HEK, human embryonic kidney; degORNs, 2'-O-methyl-degenerated oligoribonucleotide; DRB, 5,6-dichloro-1-
-D-ribofuranosyl-benzimidazole; GST, glutathione transferase; RT-PCR, reverse transcription polymerase chain reaction; MoAb, monoclonal antibody; IGFR, insulin-like growth factor-I receptor; nt, nucleotide MKK6, mitogen-activated protein kinase kinase 6; Rluc, Renilla reniformis luciferase.
The online version of this article (available at http://molpharm.aspetjournals.org) contains supplemental material. ![]()
Address correspondence to: Dr. Angelo Nicolin, Department of Pharmacology, University of Milan, Via Vanvitelli 32, 20129 Milan, Italy. E-mail: angelo.nicolin{at}unimi.it
| References |
|---|
|
|
|---|
Bail S and Kiledjian M (2006) More than 1 + 2 in mRNA decapping. Nat Struct Mol Biol 13: 7-9.[CrossRef][Medline]
Bakheet T, Williams BR, and Khabar KS (2006) ARED 3.0: the large and diverse AU-rich transcriptome. Nucleic Acids Res 34: D111-D114.
Barreau C, Paillard L, and Osborne HB (2006) AU-rich elements and associated factors: are there unifying principles? Nucleic Acids Res 33: 7138-7150.
Bevilacqua A, Ceriani MC, Canti G, Asnaghi L, Gherzi R, Brewer G, Papucci L, Schiavone N, Capaccioli S, and Nicolin A (2003a) Bcl-2 protein is required for the adenine/uridine-rich element (ARE)-dependent degradation of its own messenger. J Biol Chem 278: 23451-23459.
Bevilacqua A, Ceriani MC, Capaccioli S, and Nicolin A (2003b) Post-transcriptional regulation of gene expression by degradation of messenger RNAs. J Cell Physiol 195: 356-372.[CrossRef][Medline]
Brengues M, Teixeira D, and Parker R (2005) Movement of eukaryotic mRNAs between polysomes and cytoplasmic processing bodies. Science (Wash DC) 310: 486-489.
Calastretti A, Bevilacqua A, Ceriani C, Viganò S, Zancai P, Capaccioli S, and Nicolin A (2001) Damaged microtubules can inactivate BCL-2 by means of the mTOR kinase. Oncogene 20: 6172-6180.[CrossRef][Medline]
Cheadle C, Fan J, Cho-Chung YS, Werner T, Ray J, Do L, Gorospe M, and Becker KG (2005) Stability regulation of mRNA and the control of gene expression. Ann NY Acad Sci 1058: 196-204.[CrossRef][Medline]
Chen CY, Gherzi R, Ong S, Chan EL, Raijmakers R, Pruijn GJM, Stoecklin G, Moroni C, Mann M, and Karin M (2001) AU binding proteins recruit the exosome to degrade ARE-containing mRNAs. Cell 107: 451-464.[CrossRef][Medline]
Chen CY and Shyu AB (1995) AU-rich elements: characterization and importance in mRNA degradation. Trends Biochem Sci 20: 465-470.[CrossRef][Medline]
Cougot N, Babajko S, and Séraphin B (2004) Cytoplasmic foci are sites of mRNA decay in human cells. J Cell Biol 165: 31-40.
Denkert C, Weichert W, Winzer KJ, Muller BM, Noske A, Niesporek S, Kristiansen G, Guski H, Dietel M, and Hauptmann S (2004) Expression of the ELAV-like protein HuR is associated with higher tumor grade and increased cyclooxygenase-2 expression in human breast carcinoma. Clin Cancer Res 10: 5580-5586.
Donnini M, Lapucci A, Papucci L, Witort E, Jacquier A, Brewer G, Nicolin A, Capaccioli S, and Schiavone N (2004) Identification of TINO: a new evolutionarily conserved BCL-2 AU-rich element RNA-binding protein. J Biol Chem 279: 20154-20166.
Fialcowitz EJ, Brewer BY, Keenan BP, and Wilson GM (2005) A hairpin-like structure within an AU-rich mRNA-destabilizing element regulates trans-factor binding selectivity and mRNA decay kinetics. J Biol Chem 280: 22406-22417.
Gao M, Wilusz CJ, Peltz SW, and Wilus J (2001) A novel mRNA-decapping activity in HeLa cytoplasmic extracts is regulated by AU-rich elements. EMBO (Eur Mol Biol Organ) J 20: 1134-1143.[CrossRef][Medline]
Gherzi R, Lee KY, Briata P, Wegmuller D, Moroni C, Karin M, and Chen CY (2004) A KH domain RNA binding protein, KSRP, promotes ARE-directed mRNA turnover by recruiting the degradation machinery. Mol Cell 5: 571-583.
Ghisolfi L, Papucci L, Bevilacqua A, Canti G, Tataranni G, Lapucci A, Schiavone N, Capaccioli S, and Nicolin A (2005) Increased Bcl2 expression by antisense oligoribonucleotides targeting the adenine-uridine-rich element motif. Mol Pharmacol 68: 816-821.
Good PJ (1995) A conserved family of elav-like genes in vertebrates. Proc Natl Acad Sci USA 92: 4557-4561.
Greider C, Chattopadhyay A, Parkhurst C, and Yang E (2002) BCL-xL and BCL2 delay Myc-induced cell cycle entry through elevation of p27 and inhibition of G1 cyclin-dependent kinases. Oncogene 21: 7765-7775.[CrossRef][Medline]
Guhaniyogi J and Brewer G (2001) Regulation of mRNA stability in mammalian cells. Gene 265: 11-23.[CrossRef][Medline]
Kedersha N, Stoecklin G, Ayodele M, Yacono P, Lykke-Andersen J, Fritzler MJ, Scheuner D, Kaufman RJ, Golan DE, and Anderson P (2005) Stress granules and processing bodies are dynamically linked sites of mRNP remodeling. J Cell Biol 169: 871-884.
Keene JD and Lager PJ (2005) Post-transcriptional operons and regulons coordinating gene expression. Chromosome Res 13: 327-337.[CrossRef][Medline]
Kim VN and Nam JW (2006) Genomics of microRNA. Trends Genet 22: 165-173.[CrossRef][Medline]
Kindler S, Wang H, Richter D, and Tiedge H (2005) RNA transport and local control of translation. Annu Rev Cell Dev Biol 21: 223-245.[CrossRef][Medline]
Lapucci A, Donnini M, Papucci L, Witort E, Tempestini A, Bevilacqua A, Nicolin A, Brewer G, Schiavone N, and Capaccioli S (2002) AUF1 is a bcl-2 ARE-binding protein involved in bcl-2 mRNA destabilization during apoptosis. J Biol Chem 277: 16139-16146.
Lu JY and Schneider RJ (2004) Tissue distribution of AU-rich mRNA-binding proteins involved in regulation of mRNA decay. J Biol Chem 279: 12974-12979.
Meijerink J, Van Lieshout E, Beverloo HB, Van Drunen E, Mensink E, Macville M, and Pieters R (2005) Novel murine B-cell lymphoma/leukemia model to study BCL2-driven oncogenesis. Int J Cancer 114: 917-925.[CrossRef][Medline]
Moore MJ (2005) From birth to death: the complex lives of eukaryotic mRNAs. Science (Wash DC) 309: 1514-1518.
Nimjee SM, Rusconi CP, and Sullenger BA (2005) Aptamers: an emerging class of therapeutics. Annu Rev Med 56: 555-583.[CrossRef][Medline]
Raijmakers R, Schilders G, and Pruijin GJ (2004) The exosome, a molecular machine for controlled RNA degradation in both nucleus and cytoplasm. Eur J Cell Biol 83: 175-183.[CrossRef][Medline]
Riddihough G (2005) In the forests of RNA dark matter. Science (Wash DC) 309: 1507.
Schiavone N, Rosini P, Quattrone A, Donnini M, Lapucci A, Citti L, Bevilacqua A, Nicolin A, and Capaccioli S (2000) A conserved AU-rich element in the 3' untranslated region of bcl-2 mRNA is endowed with a destabilizing function that is involved in bcl-2 down-regulation during apoptosis. FASEB J 14: 174-184.
Shim J and Karin M (2002) The control of mRNA stability in response to extracellular stimuli. Mol Cells 14: 323-331.[Medline]
Si K, Lindquist S, and Kandel ER (2004) A possible epigenetic mechanism for the persistence of memory. Cold Spring Harb Symp Quant Biol 69: 497-498.[CrossRef][Medline]
Stoecklin G, Mayo T, and Anderson P (2006) ARE-mRNA degradation requires the 5'-3' decay pathway. EMBO (Eur Mol Biol Organ) Rep 7: 72-77.
Tomita N, Morishita R, Tomita T, and Ogihara T (2002) Potential therapeutic applications of decoy oligonucleotides. Curr Opin Mol Ther 4: 166-170.[Medline]
Wagner E and Lykke-Andersen J (2002) mRNA surveillance: the perfect persist. J Cell Sci 115: 3033-3038.
Winzen R, Gowrishankar G, Bollig F, Redich N, Resch K, and Holtmann H (2004) Distinct domains of AU-rich elements exert different functions in mRNA destabilization and stabilization by p38 mitogen-activated protein kinase or HuR. Mol Cell Biol 11: 4835-4847.
Yoon S and De Micheli G (2005) Prediction of regulatory modules comprising microRNAs and target genes. Bioinformatics 21 (Suppl 2): 93-100.
This article has been cited by other articles:
![]() |
L. Papucci, E. Witort, A. M. Bevilacqua, M. Donnini, M. Lulli, E. Borchi, K. S. A. Khabar, A. Tempestini, A. Lapucci, N. Schiavone, et al. Impact of Targeting the Adenine- and Uracil-Rich Element of bcl-2 mRNA with Oligoribonucleotides on Apoptosis, Cell Cycle, and Neuronal Differentiation in SHSY-5Y Cells Mol. Pharmacol., February 1, 2008; 73(2): 498 - 508. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||