|
|
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Department of Pharmacology, Johannes Gutenberg University, Mainz, Germany (R.K., K.L., A.P., U.F., H.K.); and the Immunopharmacology Research Group, University of Tampere, and Research Unit, Tampere University Hospital, Tampere, Finland (R.K., E.M.)
Received December 14, 2006; accepted February 22, 2007
| Abstract |
|---|
|
|
|---|
Proteins shown to regulate the stability of such inherently unstable mRNAs include members of the embryonic lethal abnormal vision protein family (most important HuR), the KH-type splicing regulatory protein (KSRP), tristetraprolin (TTP), the polypyrimidine tract binding protein (PTB, also known as hnRNP I), and the ARE/poly-(U)-binding protein/degradation factor 1 (also known as hnRNP D) (Wilusz and Wilusz, 2004
; Barreau et al., 2006
). One important signaling pathway involved in the post-transcriptional regulation of inherently unstable mRNAs is the p38 mitogen-activated protein kinase (MAPK) pathway (Clark et al., 2003
). The importance of mRNA stability in the regulation of inflammatory process has also been shown in vivo (Carballo et al., 1998
; Katsanou et al., 2005
).
Jun N-terminal kinase (JNK) is a subfamily of MAPKs. There are three different JNKs, namely JNK1, JNK2, and JNK3, all encoded by different genes. JNK1 and JNK2 are expressed ubiquitously, whereas the expression of JNK3 is restricted to heart, brain, and testis. All JNKs are involved in the regulation of immune responses and apoptosis (Pearson et al., 2001
). Although p38 MAPK is considered to be the major factor that mediates mRNA stabilization, there are reports showing that JNK is also involved in post-transcriptional gene regulation. Using dominant-negative isoforms or over-expressing JNK it has been shown that JNK regulates the stability of IL-3 mRNA and vascular endothelial growth factor mRNA by a 3'-UTR-dependent mechanism (Ming et al., 1998
; Pages et al., 2000
). In Jurkat T-cells, JNK has been shown to stabilize IL-2 mRNA via binding of nucleolin and Y box-binding protein to the 5'-UTR of IL-2 mRNA (Chen et al., 2000
).
Inducible nitric-oxide synthase (iNOS) is an important enzyme regulating physiological and pathophysiological processes in mammalian cells, and its expression is associated with several inflammatory diseases (Bogdan, 2001
; Korhonen et al., 2005
). Post-transcriptional mechanisms have been shown to play an important role in the regulation of iNOS expression in response to inflammatory stimuli (cytokines, etc.). The 3'-UTR of the human iNOS mRNA contains five AREs, which are centrally involved in the regulation of iNOS mRNA stability (Kleinert et al., 2004
). HuR, KSRP, and PTB have been shown to modulate human iNOS mRNA stability by binding to this 3'-UTR (Rodriguez-Pascual et al., 2000
; Linker et al., 2005
; Pautz et al., 2006
). In addition, TTP has been shown to play an important role in the regulation of iNOS mRNA stability and thereby in the overall iNOS expression (Fechir et al., 2005a
). In murine macrophages, pharmacological inhibition of JNK by SP600125 destabilized iNOS mRNA and consequently down-regulated iNOS expression (Lahti et al., 2003
). Because human iNOS expression is pivotally regulated post-transcriptionally and there are data showing that JNK is involved in the regulation of mRNA stability, we hypothesized that JNK may regulate human iNOS expression at the post-transcriptional level. In the present study, we provide data showing that JNK is involved in the induction of human iNOS expression by stabilizing iNOS mRNA, and the results suggest that the effect may be mediated through the regulation of TTP expression.
| Materials and Methods |
|---|
|
|
|---|
-D-ribofuranoside (DRB), and horseradish peroxidase-coupled anti-rabbit and anti-mouse IgG were purchased from Sigma (Deisenhofen, Germany). Monoclonal anti-iNOS antibody was obtained from R&D systems (Wiesbaden, Germany). The monoclonal anti-GAPDH antibody was obtained from Santa Cruz Biotechnology (Heidelberg, Germany). Complete EDTA-free protease inhibitor cocktail tablets were obtained from Roche Diagnostics (Mannheim, Germany). The QuantiTect Probe reverse transcription-polymerase chain reaction kit and the HiPerFect transfection reagent were from QIAGEN (Hilden, Germany). All oligonucleotides and dual-labeled probes were from MWG Biotech (Ebersberg, Germany). MessageMuter shRNAi Production Kit and AmpliScribe T7-Flash transcription kit were purchased from Epicenter Biotechnologies (Madison, WI). Quick Spin Columns for RNA purification were purchased from Roche Applied Systems (Mannheim, Germany). dNTPs were purchased from GE Healthcare (Freiburg, Germany). Human interferon-
, IL-1
, and TNF-
were obtained from Strathmann (Hannover, Germany). Fetal calf serum, DMEM, and RPMI 1640 medium were purchased from PAN Systems (Nürnberg, Germany). SP600125 was purchased from Calbiochem (Bad Soden, Germany). The Bradford reagent mix for determination of protein concentration was obtained from Bio-Rad Laboratories (Munich, Germany). JNK1, p38, and phospho-p38 antibodies were purchased from Cell Signaling Technology (Danvers, MA). The polyclonal antitristetraprolin antibody was a kind gift of Dr. William Rigby (Department of Medicine, Dartmouth Medical School, Lebanon, NH).
Cell Culture, Cytokine Treatment, and Nitrite Measurement. A549/8 human alveolar epithelial cells were grown in DMEM with 2 mM L-glutamine, penicillin/streptomycin, and 5% heat-inactivated fetal bovine serum to
80% confluence. Eighteen hours before cytokine stimulation, cells were washed with phosphate-buffered saline and incubated with DMEM containing 2 mM L-glutamine in the absence of serum and phenol red. iNOS expression was induced with a cytokine mixture (CM) containing 100 U/ml interferon-
, 50 U/ml IL-1
, and 10 ng/ml TNF-
for the corresponding time periods depending on the experiment. In all experiments in which SP600125 was used, cells were treated with SP600125 (110 µM) or vehicle (DMSO 1:1000) 30 min before and during cytokine incubation. Afterward, the supernatant of the cells (500 µl) was used to measure nitrite (
) by the Griess reaction or the Sievers Nitric Oxide Analyzer (ADInstruments, Spechbach, Germany).
Analysis of Human iNOS Promoter Activity in Stably Transfected Cells. To investigate the effect of JNK inhibitor SP600125 and siRNA-mediated down-regulation of JNK on iNOS promoter activity and iNOS mRNA expression, pools of stably transfected A549/8 cells containing a 16-kb fragment of the human iNOS promoter (GenBank accession number AC005697
[GenBank]
) cloned in front of a luciferase reporter gene were used (Hausding et al., 2000
). These A549/8-pNOS2(16)Luc cells were grown in DMEM with 2 mM L-glutamine, penicillin/streptomycin, and 5% heat-inactivated fetal bovine serum to
80% confluence. Serum starvation and preincubations with SP600125 and cytokine treatment were carried out as described above.
RNA Isolation and Quantitative Reverse Transcription/Polymerase Chain Reaction. A549/8 cells and A549/8-pNOS2(16)Luc cells were washed twice with phosphate-buffered saline, and total cellular RNA was isolated by guanidinium thiocyanate/phenol/chloroform extraction as described previously (Rodriguez-Pascual et al., 2000
). One-Step reverse transcription-polymerase chain reaction was performed in 25-µl reactions in a 96-well spectrofluorometric thermal cycler (iCycler; Bio-Rad Laboratories). The following oligonucleotides were purchased from MWG-Biotech: iNOS: sense, TGCAGACACGTGCGTTACTCC; antisense, GGTAGCCAGCATAGCGGATG; probe, TGGCAAGCACGACTTCCGGGTG; GAPDH: sense, CCCATGTTCGTCATGGGTGT; antisense, TGGTCATGAGTCCTTCCACGATA; probe, CTGCACCACCAACTGCTTAGCACCC; TTP: sense, TTCGCCCACTGCAACCTC; antisense, CGCCCACTCTCTGAGAAGGTC; probe, CCCCTCGCGCTACAAGACTGAGCTATG; luciferase: sense, AAAAAGTTGCGCGGAGGAG; antisense, TTTTTCTTGCGTCGAGTTTTCC; probe, TGTGTTTGTGGACGAAGTACCGAAAGGTCTTAC; JNK1: sense, CCACCAAAGATCCCTGACAAG; antisense, TGGATGCTGAGAGCCATTG; probe, ACGGGGGCAGCCCTCTCCTTTAG; and JNK2: sense, TGGATTGGGAAGAAAGAAGC; antisense, CGTCGAGGCATCAAGACTG; probe, TTCCACTGAGCAGACGCTGGCC.
Each experimental reaction was performed in triplicate. All primer/probes sets had efficiencies of 100% (±10%). To calculate the relative expression of iNOS, luciferase, TTP, JNK1, or JNK2 mRNA in A549/8 cells, the 2(
CT) method (Livak and Schmittgen, 2001
) was used. According to this method, the CT values for iNOS, luciferase, TTP, JNK1, or JNK2 mRNA expression in each sample were normalized to the CT values of GAPDH mRNA in the same sample.
DRB Assay. To investigate the stability of iNOS mRNA, A549/8 cells were cultured as described previously, and iNOS expression was induced with cytokines for 4 h. An inhibitor of transcription (5,6-dichlorobenzimidazole 1-
-D-ribofuranoside, DRB; final concentration, 25 µg/ml) was then added. The cells were further incubated for the time periods indicated, and total RNA was extracted. Relative amounts of iNOS and GAPDH mRNA were analyzed with quantitative reverse transcriptase/real-time PCR (qRT-PCR). iNOS mRNA was normalized to GAPDH mRNA, and time point 0 h (DRB addition) was set as 100%.
Western Blot. To study protein expression, A549/8 cells were lysed. Total cellular proteins (1020 µg) were separated in 7.5% SDS polyacrylamide gel and transferred to nitrocellulose membrane by semidry electroblotting. Further steps were performed as described previously (Rodriguez-Pascual et al., 2000
). iNOS and GAPDH were detected with monoclonal anti-iNOS and anti-GAPDH antibodies, respectively. JNK1, p38, phospho-p38, and TTP were detected with rabbit polyclonal JNK1 antibody, rabbit polyclonal anti-p38 antibody, rabbit polyclonal anti-phospho-p38 antibody, and rabbit polyclonal anti-TTP antibody (Brooks et al., 2002
), respectively. Immune complexes were detected by using anti-mouse and anti-rabbit horse-radish peroxidase-conjugated immunoglobulin. The immunoreactive proteins were visualized by the enhanced chemiluminescence detection system (Amersham Biosciences).
Down-Regulation of JNK1 and JNK2 Expression by siRNA. Small hairpin RNAs (shRNAs) were produced in vitro using chemically synthesized DNA oligonucleotide templates and the Message-Muter shRNA Production Kit as described by the manufacturer. Transcription templates were designed such that they contained T7 promoter sequences at the 3'-end. The target sequence for the down-regulation of both JNK isoforms was GAAAGAATGTCCTACCTTCT, which is found in both JNK1 mRNA (nucleotides 393412) and JNK2 mRNA (nucleotides 425444) (Gururajan et al., 2005
). As a control, shRNAs with target sequence against GFP (GGGCAAGCTGACCCTGAAGTT) were synthesized. shRNAs were purified with phenol/chloroform and precipitated with ethanol and then further purified with Quick Spin Columns. A549/8-pNOS2(16)Luc cells were grown to
80% confluence, and then cells were transiently transfected with shRNAs using HiPerFect Transfection Reagent according to the manufacturer's instructions. Cells were incubated for 6 h, medium was replaced with fresh culture medium with serum to remove the transfection reagent, and cells were further incubated for 24 h. The culture medium was then replaced with medium without serum and phenol red, and cells were further incubated for 18 h. Then cells were stimulated with cytokines as described above.
Statistics. Data represent means ± S.E.M. Statistical differences were determined by factorial analysis of variance followed by Fisher's protected least-significant-difference test for comparison of multiple means. Statistical probability is expressed as *, p < 0.05; **, p < 0.01; and ***, p < 0.001.
| Results |
|---|
|
|
|---|
|
|
|
|
SP600125 and Anti-JNK siRNA Reduced Protein Expression of TTP. TTP has been shown to positively regulate iNOS expression in human cells (Fechir et al., 2005a
). Therefore, a possible effect of JNK1 and JNK2 inhibition on TTP expression was investigated. Both pharmacological inhibition of JNK and down-regulation of JNK by siRNA resulted in a reduction of TTP protein expression (Fig. 5, B and E) but had no effect on TTP mRNA expression (Fig. 5, A and D). Because TTP-expression is regulated by p38 MAPK (Fechir et al., 2005a
), we further analyzed the effect of JNK inhibition/down-regulation on p38 MAPK activity. Neither SP600125 nor siRNA against JNK affected p38 MAPK expression or phosphorylation in response to CM (Fig. 5, C and F). Therefore JNK seems to regulate TTP expression independent of p38 MAPK by a mechanism modulating the translation of the TTP mRNA or the stability of the TTP protein.
|
| Discussion |
|---|
|
|
|---|
To examine a possible effect of JNK on human iNOS expression we used the JNK inhibitor SP600125 at concentrations between 1 and 10 µM. SP600125 in these concentrations dose-dependently inhibited both iNOS mRNA and protein expression and NO production (Fig. 1). Performing in vitro inhibition assays with isolated kinases, SP600125 has been shown previously to inhibit JNK1 and JNK2. However, with higher concentrations, SP600125 inhibits several other signaling proteins also (Bennett et al., 2001
). In the present study, the finding that inhibition of JNK by SP600125 resulted in the inhibition of iNOS expression was tested also with siRNA approach. In experiments with siRNA targeted at JNK1 and JNK2, human iNOS expression was inhibited confirming that JNK is involved in the regulation of iNOS expression (Fig. 4). In addition, using JNK inhibitor SP600125, we did not detect any change in the cytokine-induced expression or phosphorylation of p38 MAPK (Fig. 5C). Taken together, the inhibition of iNOS expression and destabilization of iNOS mRNA by SP600125 (Figs. 1 and 2) are due to inhibition of JNK activity and not to other effects of the pharmacological compound used.
JNK has been shown to regulate mRNA stability of IL-3 mRNA in a mast cell line (Ming et al., 1998
) and IL-2 mRNA in Jurkat T-cells (Chen et al., 2000
). It is interesting that the stabilization of IL-2 mRNA in Jurkat T-cells was mediated by binding of nucleolin and Y box-binding protein to the 5'-UTR of IL-2 mRNA. In addition, the JNK inhibitor SP600125 has also been suggested to destabilize murine iNOS and cyclooxygenase-2 mRNAs (Lahti et al., 2003
; Nieminen et al., 2006
). In the present study, we used A549/8 cells stably transfected with a luciferase construct under control of the 16-kb human iNOS promoter. Using this cell line, it is possible to differentiate the promoter activity and mRNA stability in the mRNA expression in the same cell in response to cytokine stimulation. Cytokine stimulation increased iNOS promoter activity only weakly (maximal 10-fold; Figs. 2A and 4A), whereas iNOS mRNA expression was markedly enhanced (at least 100-fold), indicating that iNOS mRNA expression in response to cytokines is critically dependent on the stabilization of iNOS mRNA, as shown in previous reports (Linn et al., 1997
; Rodriguez-Pascual et al., 2000
). By incubation of these A549/8-pNOS2(16)Luc cells, we were able to show that SP600125-mediated inhibition of JNK activity and siRNA-mediated knockdown of JNK1 and JNK2 expression resulted in marked inhibition of cytokine-induced human iNOS mRNA expression. However these treatments do not significantly modify human iNOS promoter activity (Figs. 2A and 4A). In addition, DRB experiments directly analyzing mRNA stability showed that incubation of A549/8 cells with SP600125 destabilized cytokine-induced iNOS mRNA (Fig. 2B). Taken together, these results suggest that JNK positively regulates cytokine-induced iNOS expression and NO production in A549/8 human alveolar epithelial cells by enhancing iNOS mRNA stability.
The 3'-UTR of the human iNOS mRNA contains five AREs, which are known to be central cis-acting elements in the regulation of the stability of unstable mRNAs. We have shown that HuR, a member of embryonic lethal abnormal vision protein family, KSRP, the T-cell intracellular antigen-1-related protein, and PTB regulate human iNOS mRNA stability by binding to the iNOS 3'-UTR (Rodriguez-Pascual et al., 2000
; Fechir et al., 2005b
; Linker et al., 2005
; Pautz et al., 2006
). Another important protein in the regulation of mRNA turnover is TTP. Its importance for the mRNA stability and consequently protein expression of TNF-
and granulocyte/macrophage-colony stimulating factor has been demonstrated in vivo (Carballo et al., 1998
, 2000
). We have shown recently that TTP is involved in the cytokine-induced stabilization of human iNOS mRNA. TTP does not directly bind to the iNOS 3'-UTR; rather, it acts by governing the interaction of the destabilizing protein KSRP and the iNOS mRNA (Fechir et al., 2005a
; Linker et al., 2005
). Therefore, we analyzed the effects of SP600125-mediated inhibition of JNK activity and siRNA-mediated knockdown of JNK1 and JNK2 expression on TTP expression. It is interesting that inhibition of JNK by SP600125 or down-regulation of JNK1 and JNK2 expression by siRNA did not affect cytokine-induced TTP mRNA expression (Fig. 5, A and D) but significantly reduced cytokine-induced TTP protein expression (Fig. 5, B and E). These data suggest that JNK may be involved in the control of the translation of TTP or the stability of the TTP protein. JNK-mediated regulation of translation or protein stability has been published previously for other proteins. According to recent findings in cardiomyocytes from JNK1/ and JNK2/ mice, microsomal prostaglandin E2 synthase expression is dependent on the mRNA stabilization by JNK, and JNK also controls its translation (Degousee et al., 2006
). The stability of c-Myc protein is also regulated (at least partially) by JNK (Alarcon-Vargas and Ronai, 2004
). TTP expression has been shown to be regulated by the p38 MAPK-mitogen-activated protein kinase-activated protein kinase 2 pathway through a post-transcriptional mechanism in the murine cells (Tchen et al., 2004
; Hitti et al., 2006
). In addition, in a recent publication, TTP subcellular localization and protein stability was reported to be regulated by p38 MAPK and extracellular signal-regulated kinase (Brook et al., 2006
). Both JNK inhibition by SP600125 and siRNA-mediated down-regulation of JNK inhibited the TTP protein expression without affecting the phosphorylation status or expression of p38 MAPK. This suggests that JNK regulates TTP expression independently of p38 MAPK and probably by regulation of TTP mRNA translatability and/or TTP protein stability.
In conclusion, cytokine stimulation leads to the stabilization of human iNOS mRNA. This stabilization is, at least partially, dependent on JNK suggesting that JNK is a positive regulator of iNOS expression in human cells. Furthermore, our results suggest that JNK regulates TTP protein expression and that TTP may be involved in the JNK-mediated stabilization of iNOS mRNA.
| Acknowledgements |
|---|
| Footnotes |
|---|
Article, publication date, and citation information can be found at http://molpharm.aspetjournals.org.
ABBREVIATIONS: ARE, AU-rich element; CT, cycle threshold; DMEM, Dulbecco's modified Eagle's medium; DRB, 5,6-dichlorobenzimidazole-1-
-D-ribofuranoside; CM, cytokine mixture containing interferon-
, interleukin-1
, and tumor necrosis factor-
; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GFP, green fluorescent protein; IL, interleukin; iNOS, inducible nitric-oxide synthase; JNK, Jun N-terminal kinase; MAPK, mitogen-activated protein kinase; PTB, polypyrimidine tract binding protein; siRNA, small interfering RNA; shRNA, short hairpin RNA; SP600125, anthra[1,9-cd]pyrazol-6(2H)-one-1,9-pyrazoloanthrone; TNF-
, tumor necrosis factor
; TTP, tristetraprolin; UTR, untranslated region; kb, kilobase(s); qRT-PCR, quantitative reverse transcriptase/real-time polymerase chain reaction; DMSO, dimethyl sulfoxide; KSRP, KH-type splicing regulatory protein.
Address correspondence to: Dr. Hartmut Kleinert, Department of Pharmacology, Johannes Gutenberg University, Obere Zahlbacher Str. 67, D-55101 Mainz, Germany. E-mail: kleinert{at}mail.uni-mainz.de
| References |
|---|
|
|
|---|
Barreau C, Paillard L, and Osborne HB (2006) AU-rich elements and associated factors: are there unifying principles? Nucleic Acids Res 33: 71387150.
Bennett BL, Sasaki DT, Murray BW, O'Leary EC, Sakata ST, Xu W, Leisten JC, Motiwala A, Pierce S, Satoh Y, et al. (2001) SP600125, an anthrapyrazolone inhibitor of Jun N-terminal kinase. Proc Natl Acad Sci USA 98: 1368113686.
Bogdan C (2001) Nitric oxide and the immune response. Nat Immunol 2: 907916.[CrossRef][Medline]
Brook M, Tchen CR, Santalucia T, McIlrath J, Arthur JS, Saklatvala J, and Clark AR (2006) Posttranslational regulation of tristetraprolin subcellular localization and protein stability by p38 mitogen-activated protein kinase and extracellular signal-regulated kinase pathways. Mol Cell Biol 26: 24082418.
Brooks SA, Connolly JE, Diegel RJ, Fava RA, and Rigby WF (2002) Analysis of the function, expression, and subcellular distribution of human tristetraprolin. Arthritis Rheum 46: 13621370.[CrossRef][Medline]
Carballo E, Lai WS, and Blackshear PJ (1998) Feedback inhibition of macrophage tumor necrosis factor-alpha production by tristetraprolin. Science (Wash DC) 281: 10011005.
Carballo E, Lai WS, and Blackshear PJ (2000) Evidence that tristetraprolin is a physiological regulator of granulocyte-macrophage colony-stimulating factor messenger RNA deadenylation and stability. Blood 95: 18911899.
Chen CY, Gherzi R, Andersen JS, Gaietta G, Jurchott K, Royer HD, Mann M, and Karin M (2000) Nucleolin and YB-1 are required for JNK-mediated interleukin-2 mRNA stabilization during T-cell activation. Genes Dev 14: 12361248.
Chen CY, Gherzi R, Ong SE, Chan EL, Raijmakers R, Pruijn GJ, Stoecklin G, Moroni C, Mann M, and Karin M (2001) AU binding proteins recruit the exosome to degrade ARE-containing mRNAs. Cell 107: 451464.[CrossRef][Medline]
Clark AR, Dean JL, and Saklatvala J (2003) Post-transcriptional regulation of gene expression by mitogen-activated protein kinase p38. FEBS Lett 546: 3744.[CrossRef][Medline]
Degousee N, Angoulvant D, Fazel S, Stefanski E, Saha S, Iliescu K, Lindsay TF, Fish JE, Marsden PA, Li RK, et al. (2006) c-Jun N-terminal kinase-mediated stabilization of microsomal prostaglandin E2 synthase-1 mRNA regulates delayed microsomal prostaglandin E2 synthase-1 expression and prostaglandin E2 biosynthesis by cardiomyocytes. J Biol Chem 281: 1644316452.
Fechir M, Linker K, Pautz A, Hubrich T, Forstermann U, Rodriguez-Pascual F, and Kleinert H (2005a) Tristetraprolin regulates the expression of the human inducible nitric-oxide synthase gene. Mol Pharmacol 67: 21482161.
Fechir M, Linker K, Pautz A, Hubrich T, and Kleinert H (2005b) The RNA binding protein TIAR is involved in the regulation of human iNOS expression. Cell Mol Biol (Noisy-le-grand) 51: 299305.[Medline]
Gururajan M, Chui R, Karuppannan AK, Ke J, Jennings CD, and Bondada S (2005) c-Jun N-terminal kinase (JNK) is required for survival and proliferation of B-lymphoma cells. Blood 106: 13821391.
Hausding M, Witteck A, Rodriguez-Pascual F, von Eichel-Streiber C, Forstermann U, and Kleinert H (2000) Inhibition of small G proteins of the Rho family by statins or Clostridium difficile toxin B enhances cytokine-mediated induction of NO synthase II. Br J Pharmacol 131: 553561.[CrossRef][Medline]
Hitti E, Iakovleva T, Brook M, Deppenmeier S, Gruber AD, Radzioch D, Clark AR, Blackshear PJ, Kotlyarov A, and Gaestel M (2006) Mitogen-activated protein kinase-activated protein kinase 2 regulates tumor necrosis factor mRNA stability and translation mainly by altering tristetraprolin expression, stability, and binding to adenine/uridine-rich element. Mol Cell Biol 26: 23992407.
Katsanou V, Papadaki O, Milatos S, Blackshear PJ, Anderson P, Kollias G, and Kontoyiannis DL (2005) HuR as a negative posttranscriptional modulator in inflammation. Mol Cell 19: 777789.[CrossRef][Medline]
Kleinert H, Euchenhofer C, Ihrig-Biedert I, and Forstermann U (1996) Glucocorticoids inhibit the induction of nitric oxide synthase II by down-regulating cytokine-induced activity of transcription factor nuclear factor-
B. Mol Pharmacol 49: 1521.[Abstract]
Kleinert H, Pautz A, Linker K, and Schwarz PM (2004) Regulation of the expression of inducible nitric oxide synthase. Eur J Pharmacol 500: 255266.[CrossRef][Medline]
Korhonen R, Lahti A, Kankaanranta H, and Moilanen E (2005) Nitric oxide production and signaling in inflammation. Curr Drug Targets Inflamm Allergy 4: 471479.[CrossRef][Medline]
Lahti A, Jalonen U, Kankaanranta H, and Moilanen E (2003) c-Jun NH2-terminal kinase inhibitor anthra(1,9-cd)pyrazol-6(2H)-one reduces inducible nitric-oxide synthase expression by destabilizing mRNA in activated macrophages. Mol Pharmacol 64: 308315.
Linker K, Pautz A, Fechir M, Hubrich T, Greeve J, and Kleinert H (2005) Involvement of KSRP in the post-transcriptional regulation of human iNOS expression-complex interplay of KSRP with TTP and HuR. Nucleic Acids Res 33: 48134827.
Linn SC, Morelli PJ, Edry I, Cottongim SE, Szabo C, and Salzman AL (1997) Transcriptional regulation of human inducible nitric oxide synthase gene in an intestinal epithelial cell line. Am J Physiol 272: G1499G1508.[Medline]
Livak KJ and Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2-
CT method. Methods 25: 402408.[CrossRef][Medline]
Ming XF, Kaiser M, and Moroni C (1998) c-Jun N-terminal kinase is involved in AUUUA-mediated interleukin-3 mRNA turnover in mast cells. EMBO (Eur Mol Biol Organ) J 17: 60396048.[CrossRef][Medline]
Mukherjee D, Gao M, O'Connor JP, Raijmakers R, Pruijn G, Lutz CS, and Wilusz J (2002) The mammalian exosome mediates the efficient degradation of mRNAs that contain AU-rich elements. EMBO (Eur Mol Biol Organ) J 21: 165174.[CrossRef][Medline]
Nieminen R, Lahti A, Jalonen U, Kankaanranta H, and Moilanen E (2006) JNK inhibitor SP600125 reduces COX-2 expression by attenuating mRNA in activated murine J774 macrophages. Int Immunopharmacol 6: 987996.[CrossRef][Medline]
Pages G, Berra E, Milanini J, Levy AP, and Pouyssegur J (2000) Stress-activated protein kinases (JNK and p38/HOG) are essential for vascular endothelial growth factor mRNA stability. J Biol Chem 275: 2648426491.
Pautz A, Linker K, Hubrich T, Korhonen R, Altenhofer S, and Kleinert H (2006) The polypyrimidine tract-binding protein (PTB) is involved in the post-transcriptional regulation of human inducible nitric oxide synthase expression. J Biol Chem 281: 3229432302.
Pearson G, Robinson F, Beers GT, Xu BE, Karandikar M, Berman K, and Cobb MH (2001) Mitogen-activated protein (MAP) kinase pathways: regulation and physiological functions. Endocr Rev 22: 153183.
Rodriguez-Pascual F, Hausding M, Ihrig-Biedert I, Furneaux H, Levy AP, Forstermann U, and Kleinert H (2000) Complex contribution of the 3'-untranslated region to the expressional regulation of the human inducible nitric-oxide synthase gene. Involvement of the RNA-binding protein HuR. J Biol Chem 275: 2604026049.
Tchen CR, Brook M, Saklatvala J, and Clark AR (2004) The stability of tristetraprolin mRNA is regulated by mitogen-activated protein kinase p38 and by tristetraprolin itself. J Biol Chem 279: 3239332400.
Wilusz CJ and Wilusz J (2004) Bringing the role of mRNA decay in the control of gene expression into focus. Trends Genet 20: 491497.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
N. B. Vargas, B. Y. Brewer, T. B. Rogers, and G. M. Wilson Protein kinase C activation stabilizes LDL receptor mRNA via the JNK pathway in HepG2 cells J. Lipid Res., March 1, 2009; 50(3): 386 - 397. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Engels, S. K. Knauer, S. Loibl, V. Fetz, P. Harter, A. Schweitzer, A. Fisseler-Eckhoff, F. Kommoss, L. Hanker, V. Nekljudova, et al. NO Signaling Confers Cytoprotectivity through the Survivin Network in Ovarian Carcinomas Cancer Res., July 1, 2008; 68(13): 5159 - 5166. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||