MolPharm xPharm- The Comprehensive Pharmacology Reference

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
 QUICK SEARCH:   [advanced]


     


Molecular Pharmacology Fast Forward
First published on March 6, 2007; DOI: 10.1124/mol.106.031773


0026-895X/07/7106-1572-1581$20.00
Mol Pharmacol 71:1572-1581, 2007

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
mol.106.031773v1
71/6/1572    most recent
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jurgens, C. W. D.
Right arrow Articles by Doze, V. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jurgens, C. W. D.
Right arrow Articles by Doze, V. A.

{alpha}2A Adrenergic Receptor Activation Inhibits Epileptiform Activity in the Rat Hippocampal CA3 Region

Chris W. D. Jurgens, Hana M. Hammad1, Jessica A. Lichter, Sarah J. Boese, Brian W. Nelson, Brianna L. Goldenstein, Kylie L. Davis, Ke Xu, Kristin L. Hillman, James E. Porter, and Van A. Doze

Department of Pharmacology, Physiology and Therapeutics, University of North Dakota School of Medicine and Health Sciences, Grand Forks, North Dakota

Received October 13, 2006; accepted March 6, 2007


    Abstract
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Norepinephrine has potent antiepileptic properties, the pharmacology of which is unclear. Under conditions in which GABAergic inhibition is blocked, norepinephrine reduces hippocampal cornu ammonis 3 (CA3) epileptiform activity through {alpha}2 adrenergic receptor (AR) activation on pyramidal cells. In this study, we investigated which {alpha}2AR subtype(s) mediates this effect. First, {alpha}2AR genomic expression patterns of 25 rat CA3 pyramidal cells were determined using real-time single-cell reverse transcription-polymerase chain reaction, demonstrating that 12 cells expressed {alpha}2AAR transcript; 3 of the 12 cells additionally expressed mRNA for {alpha}2CAR subtype and no cells possessing {alpha}2BAR mRNA. Hippocampal CA3 epileptiform activity was then examined using field potential recordings in brain slices. The selective {alpha}AR agonist 6-fluoronorepinephrine caused a reduction of CA3 epileptiform activity, as measured by decreased frequency of spontaneous epileptiform bursts. In the presence of betaAR blockade, concentration-response curves for AR agonists suggest that an {alpha}2AR mediates this response, as the rank order of potency was 5-bromo-N-(4,5-dihydro-1H-imidazol-2-yl)-6-quinoxalinamine (UK-14304) ≥ epinephrine >6-fluoronorepinephrine > norepinephrine >>> phenylephrine. Finally, equilibrium dissociation constants (Kb) of selective {alpha}AR antagonists were functionally determined to confirm the specific {alpha}2AR subtype inhibiting CA3 epileptiform activity. Apparent Kb values calculated for atipamezole (1.7 nM), MK-912 (4.8 nM), BRL-44408 (15 nM), yohimbine (63 nM), ARC-239 (540 nM), prazosin (4900 nM), and terazosin (5000 nM) correlated best with affinities previously determined for the {alpha}2AAR subtype (r = 0.99, slope = 1.0). These results suggest that, under conditions of impaired GABAergic inhibition, activation of {alpha}2AARs is primarily responsible for the antiepileptic actions of norepinephrine in the rat hippocampal CA3 region.


The noradrenergic system is a key modulator of numerous physiological and pathological processes. Within the central nervous system (CNS), noradrenergic neurons innervate copious neural networks and regulate a number of essential neurological functions, including attention and arousal, sleep, and learning and memory (Pupo and Minneman, 2001Go). The CNS noradrenergic system also plays a significant role in attenuating epileptic phenomena (Giorgi et al., 2004Go) and is implicated in neurodegenerative diseases such as Alzheimer's and Parkinson's. The hippocampus, a limbic structure intricately involved in learning and memory, receives substantial adrenergic innervation in all subfields, including the cornu ammonis 3 (CA3) region. Numerous studies have indicated that the hippocampal CA3 region is essential for many cognitive processes including spatial pattern recognition, novelty detection, and short-term memory (Kesner et al., 2004Go). Characteristic of the CA3 region is a dense recurrent network among the excitatory pyramidal neurons, which is believed crucial for performing these cognitive functions (Traub et al., 1991Go). However, the immense connectivity of the CA3 axon collaterals makes this region extremely vulnerable to overexcitation (Schwartzkroin, 1986Go). Indeed, the CA3 region has one of the lowest seizure thresholds in the brain and is often involved in temporal lobe epilepsy, the most common human epileptic syndrome. Therefore, strict control over the inhibitory and excitatory aspects of this network is essential.

Norepinephrine (NE), the major neurotransmitter released by noradrenergic neurons, modulates several vital hippocampal CA3 processes. Long-term potentiation (LTP), a form of activity-dependent neuronal enhancement that is believed to underlie memory formation, is strongly facilitated by NE in the hippocampal CA3 region (Hopkins and Johnston, 1988Go). In addition, NE enhances certain memory processes (Murchison et al., 2004Go) some of which are believed to involve the CA3 region. NE also has documented antiepileptic properties (Giorgi et al., 2004Go). Reduced levels of endogenous NE are associated with an increased susceptibility to seizures (Weinshenker and Szot, 2002Go), whereas increased brain NE release inhibits seizure activity (Weiss et al., 1990Go). Furthermore, several clinically used antiepileptic therapies have been shown to either increase brain NE levels (Baf et al., 1994Go) or require intact NE innervation for their clinical efficacy (Krahl et al., 1998Go; Szot et al., 2001Go). Although the LTP- and memory-enhancing and antiepileptic actions of NE have been known for many years, the mechanism by which NE mediates these effects is still unclear. Based on the differential expression of adrenergic receptor mRNA observed in hippocampal interneurons and pyramidal cells (Hillman et al., 2005aGo), we believe that the ability of NE to both potentiate the excitatory processes underlying memory and to inhibit the aberrant overexcitation association with seizures is achieved through the distinct and diverse expression of postsynaptic receptors on these different cell types (Hillman et al., 2005bGo; Jurgens et al., 2005Go).

NE and its major congener, epinephrine (EPI), mediate their effects through the activation of adrenergic receptors (ARs). ARs have been divided into three major classes, each of which has a unique G-protein pairing resulting in diverse physiological actions (Pupo and Minneman, 2001Go). Several studies have suggested that betaARs mediate enhancement of LTP (Hopkins and Johnston, 1988Go) and memory (Devauges and Sara, 1991Go) by NE, whereas the antiepileptic actions of NE may involve {alpha}AR activation (Weinshenker and Szot, 2002Go). We recently found that NE inhibits rat hippocampal CA3 epileptiform burst discharges through {alpha}2AR activation (Jurgens et al., 2005Go). Pharmacological and molecular cloning studies have revealed the existence of three {alpha}2AR subtypes denoted {alpha}2A, {alpha}2B, and {alpha}2C (Bylund et al., 1994Go). Although gene expression studies have found transcripts for all three {alpha}2AR subtypes in rat brain (Nicholas et al., 1993Go; Scheinin et al., 1994Go), only {alpha}2A and {alpha}2CAR mRNA seem to be expressed in the rat hippocampus (Winzer-Serhan and Leslie, 1997Go; Winzer-Serhan et al., 1997aGo,bGo).

The goal of this study was to characterize the effect of {alpha}2AR subtype activation on rat hippocampal CA3 network synchronization under conditions of impaired synaptic inhibition. Genomic expression patterns of {alpha}2AR mRNA in single hippocampal CA3 pyramidal neurons, rank order of potencies for AR agonist-mediated responses, and functional determination of subtype-selective {alpha}2AR antagonist equilibrium dissociation constants were used to determine the specific {alpha}2AR subtype involved in reducing hippocampal CA3 network activity observed in this model. Delineating which {alpha}2AR subtype attenuates hippocampal overexcitation (i.e., epileptic phenomena) may provide clues to help elucidate the mechanism by which NE inhibits epileptogenesis.


    Materials and Methods
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Reagents
BAPTA tetrapotassium salt, desipramine hydrochloride, (–)-epinephrine bitartrate salt, 6-fluoronorepinephrine hydrochloride, MK-912, (–)-norepinephrine (+)-bitartrate salt hydrate, (R)-(–)-phenylephrine hydrochloride, picrotoxin, and timolol maleate salt were obtained from Sigma-Aldrich (St. Louis, MO). ARC-239, BRL-44408, prazosin hydrochloride, terazosin [1-(4-amino-6,7-dimethoxy-2-quinazolinyl)-4-[(tetrahydro-2-furanyl)carbonyl]-piperazine hydrochloride], UK-14304, and yohimbine hydrochloride were acquired from Tocris Cookson Inc. (Ellisville, MO). Atipamezole [(4-(2-ethyl-2,3-dihydro-1H-inden-2-yl)-1H-imidazole) was manufactured by Orion Corporation (Espoo, Finland). Isoflurane was ordered from Abbott Diagnostics (Chicago, IL). All chemical reagents used to make the artificial cerebrospinal fluid (ACSF) and the microelectrode solutions were of biological grade from J.T. Baker, Inc. (Phillipsburg, NJ), Fisher Scientific Co. (Fairlawn, NJ), or Sigma-Aldrich (St. Louis, MO). Unless otherwise noted, all molecular biology reagents used for single cell reverse transcription polymerase chain reaction (RT-PCR) were obtained from Promega (Madison, WI).

Animals
Sprague-Dawley rat pups were housed with their mothers in cages (16.5 x 8.5 inches) kept in rooms maintained at a temperature of ~22°C with a relative humidity of ~55%. Water and dried laboratory food (Teklad Global 18% Protein Rodent Diet; Harlan Teklad, Madison, WI) were provided ad libitum. Lighting was set to a 12-h light/dark cycle (lights on at 7:00 AM). Rats were allowed to acclimate for at least 2 days after arrival from Harlan (Indianapolis, IN) before their use. All protocols described have been approved by the Institutional Animal Care and Use Committee of the University of North Dakota in accordance with National Institutes of Health guidelines (Institute of Laboratory Animal Resources, 1996Go).

Slice Preparation
Hippocampal brain slices were prepared from young Sprague-Dawley rats (12–29 days old) weighing 25 to 90 g. Animals were deeply anesthetized with isoflurane and sacrificed by decapitation, and their brains were immediately removed. Hippocampi were quickly dissected from each hemisphere and placed into a 4°C Ringer's solution containing 110 mM choline chloride, 2.5 mM KCl, 7 mM MgSO4, 0.5 mM CaCl2, 1.25 mM NaH2PO4, 25 mM NaHCO3, 25 mM glucose, 11.6 mM sodium ascorbate, and 3.1 mM sodium pyruvate. Using a conventional tissue sectioning apparatus (Stoelting, Wood Dale, IL), the hippocampi were sectioned transversely into 500-µm slices (Fig. 1A) and transferred to ACSF consisting of 119 mM NaCl, 5 mM KCl, 1.3 mM MgSO4, 2.5 mM CaCl2, 1 mM NaH2PO4, 26.2 mM NaHCO3, and 11 mM glucose. The slices were incubated at 34 ± 1°C for 30 min, and then allowed to recover for at least an additional 30 min at room temperature (22 ± 1°C) before experimentation. All solutions were continually aerated with 95% O2:5% CO2.


Figure 1
View larger version (51K):
[in this window]
[in a new window]

 
Fig. 1. Hippocampal slice preparation and single cell cytoplasmic extraction. A, schematic diagrams of the rat brain and hippocampal formation. Illustrated are the location of hippocampus in the rat brain (bottom) and the basic neuronal organization of the rat hippocampal formation (top). Bottom, orientation used in preparing hippocampus slices from the rat brain. Hippocampi were carefully dissected from the brain, positioned on moistened filter paper, and cut into 500-µm slices. For these recordings, the slices were cut at a slight angle (approximately 15°) off the transverse. Top, details of the rat hippocampal slice formation and the placement of the extracellular recording electrode. The major regions of the rat hippocampus are the dentate gyrus (DG), area CA3, and area CA1. To record epileptiform burst discharges, the extracellular recording electrode was placed directly in the pyramidal neuron layer (stratum pyramidale) in the region of the area CA3. B, an IR/differential interference contrast image of a visually identified hippocampal CA3 pyramidal cell before cytoplasmic extraction. Arrow indicates cell soma. Note microelectrode touching the membrane of the candidate pyramidal cell.

 
Cytoplasm Collection
A single hippocampal slice was transferred to a perfusion chamber (Siskiyou, Grants Pass, OR) and visualized under IR/differential interference contrast microscopy using an Olympus BX-51WI microscope (Olympus, Melville, NY) while being constantly perfused with oxygenated ACSF at room temperature (22 ± 1°C). A candidate hippocampal CA3 pyramidal cell was visually identified and centered in the field. A micropipette tip loaded with 50 U of RNasin ribonuclease inhibitor and back-filled with 135 mM KMeSO4, 8 mM NaCl, 10 mM HEPES, 2 mM MgATP, 0.3 mM NaGTP, and 0.1 mM BAPTA-K4, was driven into the tissue while applying slight positive pressure to keep the tip clear of debris and placed flush with the membrane of the candidate pyramidal cell (Fig. 1B). Application of a slight negative pressure disrupted the membrane of the cell and the cytoplasmic contents of the candidate cell was gently aspirated; we were careful not to disrupt the nucleus. The sample was immediately prepared for RT-PCR.

Single Cell RT-PCR
Single-cell RT-PCR was performed as described previously (Hillman et al., 2005aGo) with a few small modifications. The cytoplasmic contents were expelled into a 10-µl total reaction volume containing, in final concentrations: 500 µM dNTPs, 10 mM dithiothreitol, 1x first strand buffer, 25 U of RNasin ribonuclease inhibitor, 200 U of Moloney murine leukemia virus reverse transcriptase (Invitrogen, Carlsbad, CA), and 0.5 ng of anchored RT primer mixture (5'->3': CTCTCAAGGATCTTACCGCT(17)(A,G,C)N, where N represents A, C, G, or T). The reaction was incubated at 37°C for 60 min. The resulting first strand was treated with 1 U of RNase H (Promega), and incubated at 37°C for 60 min to remove hybrid dimers. Four second-strand primer mixtures, 2.5 pg each, were annealed at 50°C for 10 min. Each primer contained the base sequence TGCATCTATCTAATGCTCCNNNNNXXXXX but had different 3' heel sequences (XXXXX): CGAGA, CGACA, CGTAC, and ATGCG. The second strand was then extended by adding 1 mM dNTPs, 0.5 U of PfuUltra Polymerase (Stratagene, La Jolla, CA), and 2x PfuUltra buffer and was then incubated at 72°C for 15 min.

PCR Amplification 1. 250 µM dNTPs, 0.25x PfuUltra Buffer, 1.25 U of PfuUltra Polymerase, 2.5 µl of DNase-free water, 1 ng of the anchored RT primer mixture, and 1 ng of each second-strand primer mixture were added to the reaction tube. Using a standard thermal cycler (Mastercycler; Eppendorf North America, Inc., Westbury, NY), the reaction was subjected to a hot start step of 95°C for 2 min, followed by 15 cycles of 92°C for 1 min, 60°C for 1 min, and 72°C for 1.5 min, with a final extension step of 72°C for 5 min.

PCR Amplification 2. The reaction was spiked with: 1x Ex Taq Buffer, 1 mM dNTPs, 2.5 U of Ex Taq HS Polymerase (Takara Bio Inc., Otsu, Japan), 8.5 µl of DNase-free water, 10 ng of the anchored RT primer mixture, and 10 ng of each second-strand primer mixture. The reaction was subjected to a hot start step of 95°C for 2 min, followed by 40 cycles of 92°C for 1 min, 60°C for 1 min, 72°C for 2 min, with a final extension step of 72°C for 5 min.

Controls. The above protocol was performed on three controls during each experimental run:


View this table:
[in this window]
[in a new window]

 
TABLE 1 Gene-specific primers used in RT-PCR

 

Gene-Specific Amplification Using Real Time PCR
Aliquots (3 µl) of the final cDNA template reaction were used to determine mRNA expression patterns for AR subtypes. 3 to 5 µl of cDNA template, 20 µM each of forward and reverse gene-specific primer (Table 1), 1.5x RT-PCR buffer, 1x additive reagent (0.004 mg of bovine serum albumin, 150 mM trehalose, and 0.2% Tween 20; Cepheid, Sunnyvale, CA), 250 µM dNTPs, 3 mM Mg2+, 0.25x SYBR green dye (Cambrex Bio Science Rockland, Inc., Rockland ME), and 2.5 U of Ex Taq HS polymerase were combined and brought to 25 µl with DNase-free water. Using the Cepheid SmartCycler System, the reactions were subjected to a hot start step of 95°C for 120 s; 42 cycles of 95°C for 15 s, 57°C for 30 s, and 72°C for 30 s; and a final extension of 72°C for 60 s. A melt curve analysis was performed on each run immediately after the extension step to determine product presence and purity (data not shown). AR characterization was only completed on samples that were positive for the housekeeping gene beta-actin and negative for the genomic marker STS ET3, indicating successful amplification of cytoplasmic mRNA. All gene-specific primer pairs were designed using Vector NTI Software (Invitrogen) and synthesized by Integrated DNA Technologies (Coralville, IA) or Sigma-Genosys (The Woodlands, TX). Gene-specific primer sequences were chosen based on minimal primer-dimer formation, high sequence specificity, and annealing temperatures within 55–60°C.

Electrophysiological Recordings
A single slice was transferred to the recording chamber, where it was submerged and superfused continuously at a rate of ~4 ml/min with ACSF at room temperature (22 ± 1°C). Glass microelectrodes were made using a two-stage puller (PP-830; Narishige, Tokyo, Japan). Extracellular field potentials were recorded using microelectrodes filled with 3 M NaCl placed in the stratum pyramidale of the CA3 region of the hippocampus (same general area where the cytoplasmic samples were taken; see Fig. 1A). Currents were detected using an Axoclamp 2B (Molecular Devices, Sunnyvale, CA), amplified at 10x or 100x using a Brownlee Precision model 440 instrumentation amplifier (Brownlee Precision, San Jose, CA), digitized at 1 kHz with a Digidata 1322A analog-to-digital converter (Molecular Devices), and recorded using Axoscope 9.0 software (Molecular Devices).

Generation of Epileptiform Activity
It has been established that hippocampal CA3 pyramidal neurons will fire spontaneous epileptiform burst discharges partly as a result of their extensive recurrent circuitry (Traub et al., 1991Go). This activity can be elicited by attenuating synaptic inhibition using a GABAA receptor antagonist such as picrotoxin. To elicit epileptiform bursts, slices were continually superfused with ACSF containing picrotoxin (100 µM) and any applicable AR antagonist. If no burst discharges were seen after 20 min of perfusion, the slices were determined to be unresponsive and discarded. Once burst discharges were evident, 30 min of baseline data were recorded before any exposure to an AR agonist. Preliminary experiments were conducted to assure that AR antagonists showed no independent effects and that each AR agonist concentration produced its maximum effect in the time allotted (data not shown).

Data Analysis
Burst discharge frequencies were visualized in real time (Fig. 2A) while being recorded for subsequent on-line analysis. Postexperiment analysis was completed using Mini Analysis 6.0 (Synaptosoft, Decatur, GA). The last interval correlating to each agonist concentration was noted, the baseline frequency was subtracted, and that value was used to plot a concentration-response expressed as percentage of maximal response. Frequency versus agonist concentration data were then entered into Prism 4.03 (GraphPad Software, San Diego, CA) and concentration-response curves were constructed using a nonlinear least-squares curve fitting method. Each curve was fit with a standard (slope = unity) or variable slope, and the best fit was determined using an F test with a value of p < 0.05. The calculated EC50 value was used as a measurement of agonist potency. Significance between groups was tested using an unpaired two-tailed Student's t test (p < 0.05).


Figure 2
View larger version (29K):
[in this window]
[in a new window]

 
Fig. 2. Effects of 6FNE on hippocampal CA3 epileptiform burst discharges. A, continuous 150 s-long chart recordings of burst discharges recorded in the hippocampal CA3 region of rat brain slices. Burst discharges were elicited by including 100 µM picrotoxin, a GABAA receptor blocker, in the perfusing ACSF containing 500 nM desipramine. Under these conditions, bath application of 6FNE reduced burst frequency in a concentration-dependent manner from 12 bursts (0.080 Hz) in control ringer to nine (0.060 Hz) in 30 nM, seven (0.047 Hz) in 100 nM, four (0.027 Hz) in 300 nM, two (0.013 Hz) in 1 µM, and one (0.007 Hz) in 3 µM 6FNE. The effect of 6FNE was completely reversible in that the frequency of events returned to baseline level after several washes with control ACSF (data not shown). B, frequency histogram of the number of epileptiform burst discharges versus time of 6FNE application. Each bin represents the frequency averaged over a 150-s epoch. Increasing concentrations of 6FNE were applied to the bath for the 8-min periods indicated. Inset, concentration-response curve derived from the frequency histogram in B. Data points were plotted as percentage of maximal inhibition (decrease in epileptiform burst frequency), and the curve constructed using a nonlinear least-squares curve-fitting method. For this experiment, the concentration-response curve was fit best by a nonvariable sigmoidal model with a calculated EC50 value for 6FNE of 110 nM. C, mean concentration-response curve for all of the 6FNE data (310 ± 86 nM; n = 20).

 
Equilibrium dissociation constant (Kb) values for the selective {alpha}AR antagonists were estimated using the method of Schild originally described by Arunlakshana and Schild (1959Go). For each experiment, cumulative concentration-response curves were performed in adjacent hippocampal slices of the same rat (one concentration-response curve per slice). Dose-ratios of EC50 values in the presence and absence of a selective AR antagonist were calculated and Schild plots constructed by graphing the log of the dose ratio – 1 versus the log of the AR antagonist concentration (Arunlakshana and Schild, 1959Go). Linear regression analysis of these plotted points was used to determine the slope and x intercept of the Schild regressions. Schild regression slopes are expressed as the mean ± S.E. and were considered different if the 95% confidence interval did not include the value of 1 (Kenakin, 1997Go). The Kb values of subtype-selective {alpha}AR antagonists causing competitive inhibition of agonist initiated burst discharge frequencies were calculated from Schild regression x intercepts. Differences in pKb values and Schild regression slopes were determined by analysis of covariance with a p < 0.05 level of probability accepted as significant. Calculated values (i.e., EC50 and Kb) are expressed as the mean ± S.E. for n experiments.


    Results
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Hippocampal CA3 Pyramidal Cell Characterization. It has been demonstrated that NE reduces epileptiform burst activity in the hippocampal CA3 region through AR activation on pyramidal cells (Jurgens et al., 2005Go). Therefore, we examined the RNA expression patterns for subtypes of {alpha}2ARs in CA3 pyramidal cells using a single-cell, real time RT-PCR method designed to allow simultaneous identification of transcriptional expression patterns for neuronal cell type markers and AR subtypes (Hillman et al., 2005aGo). Real-time PCR was employed for gene-specific amplification because its enhanced sensitivity (1-pg limit) allows the detection of multiple transcripts within a single cell sample. Listed in Table 1 are gene-specific primer pairs used to identify positive transcripts from single hippocampal CA3 pyramidal cells. Also listed in Table 1 are amplicon melt temperatures, which were subsequently used to identify positive transcripts from single cell samples. The criteria for confirming positive transcripts were: (1) the sample was free of genomic and cellular contamination; (2) the transcript product gave a fluorescence signal of at least 10 U of fluorescence over background; and (3) the gene-specific PCR melt temperature was within 1°C of positive control value (Hillman et al., 2005aGo). Based on these criteria, 25 cytoplasmic samples taken from individual hippocampal CA3 pyramidal cells, identified visually based on their location in the pyramidal cell layer and their characteristic pyramidal shape (Fig. 1B), were determined to have specific RT-PCR amplification products. These 25 samples were successfully amplified free of genomic contamination, as indicated by their expression of the house-keeping gene beta-actin and lack of the genomic marker for a polymorphic repeat STS ET3 (Hillman et al., 2005aGo). The pyramidal cell origin of these samples was confirmed by the presence of mRNA transcripts for calcium/calmodulin-dependent protein kinase-II, an enzyme specific to pyramidal cells and/or absence of mRNA for glial fibrillary acidic protein and glutamate decarboxylase, markers of astrocytes and interneurons, respectively. Of the three {alpha}2AR subtypes tested, the {alpha}2AAR subtype was transcriptionally expressed in 12 of the 25 samples, with three of these pyramidal cells additionally expressing {alpha}2CAR mRNA (Table 2). No mRNA for the {alpha}2BAR subtype was detected. Previous reports describe no {alpha}2AR mRNA expression in hippocampal CA1 pyramidal cells (Hillman et al., 2005aGo). These results, summarized in Table 2, demonstrate that {alpha}2AAR and/or {alpha}2CAR are transcriptionally expressed in CA3 pyramidal cells.


View this table:
[in this window]
[in a new window]

 
TABLE 2 Single-cell RT-PCR results for rat hippocampal pyramidal neurons

Data are from cell samples that were positive for the housekeeping gene beta-actin and negative for the genomic marker STS ET3, indicating successful amplification of cytoplasmic mRNA.

 

{alpha}-AR Effects on Hippocampal CA3 Epileptiform Activity. The highly selective {alpha}AR agonist 6-fluoronorepinephrine (6FNE), possesses an approximately 10- and 1000-fold selectivity for {alpha}1ARs and {alpha}2ARs, respectively, compared with betaARs (Lu et al., 2000Go). We first examined the effects of 6FNE on burst discharges to corroborate the type of {alpha}AR action on hippocampal activity observed in our previous studies (Jurgens et al., 2005Go). For these recordings, an extracellular electrode was placed in the hippocampal pyramidal cell layer in the area of the CA3 region where pyramidal cells expressing mRNA were found (Fig. 1A, top). As illustrated in Fig. 2A, picrotoxin-induced epileptiform burst discharges appear as sharp biphasic spikes. The depolarizing/hyperpolarizing wave form corresponds to a series of population spikes followed by an afterhyperpolarization in CA3 pyramidal neurons (Traub et al., 1991Go). Application of 6FNE caused a concentration-dependent decrease in the number of these events (Fig. 2A). Using a frequency histogram of the 6FNE-induced decrease in burst discharges (Fig. 2B), a concentration-response curve was constructed from a plot of maximal burst frequency versus 6FNE concentration (Fig. 2C). For this experiment, the EC50 value calculated from nonlinear regression analysis was 110 nM. The agonist concentration-response profile for different slices from a single animal was similar (data not shown). The mean EC50 value for 6FNE-induced decreased burst firing was 310 ± 86 nM, n = 20 (Fig. 2C). The high potency of 6FNE to reduce hippocampal CA3 network activity suggests that this effect is most likely mediated through activation of an {alpha}AR.

Effects of Endogenous Catecholamines and Other {alpha}AR agonists on Hippocampal CA3 Epileptiform Activity. Because NE and EPI are the endogenous agonists for {alpha}2AR-mediated responses in the rat hippocampus, we compared the effects of these nonselective AR agonists with those of the selective {alpha}AR agonist 6FNE, the selective {alpha}1AR agonist phenylephrine (PHE), and the selective {alpha}2AR agonist UK-14304 on hippocampal CA3 burst activity frequency in the presence of betaAR blockade. As illustrated in Fig. 3, after pretreatment of slices with 10 µM timolol to block betaARs and 0.5 µM desipramine to block catecholamine reuptake, application of UK-14304, EPI, 6FNE, NE, or PHE caused a concentration-dependent decrease in the frequency of hippocampal CA3 epileptiform burst discharges. The potency of 6FNE in the presence of timolol (300 ± 140 nM, n = 12; Fig. 3) was not significantly different from EC50 values for 6FNE calculated in the absence of betaAR blockage (310 ± 86 nM, n = 20; Fig. 2C). This illustrates that the 6FNE-mediated response on the hippocampus is caused by selective {alpha}AR activation and not by nonspecific AR effects. This also indicated that the 10 µM concentration of timolol used to block betaARs was not interfering with this {alpha}AR-mediated response. Conversely, the EC50 of 6FNE, NE (1000 ± 310 nM, n = 20), and PHE (140 ± 130 µM, n = 12) for reducing CA3 network activity were significantly less potent when evaluated against EPI (100 ± 12 nM, n = 120) or UK-14304 (76 ± 43 nM, n = 10) and were also significantly different compared with each other (Fig. 3). Although UK-14304 was slightly more potent than EPI, the difference was not significantly different. The potency of EPI did not differ significantly over the age of animals (12–29 days old) used in this study and was also not significantly different in adult rats versus juvenile animals (data not shown). This rank order of potency (UK-14304 ≥ EPI > 6FNE > NE >>> PHE) is consistent with noradrenergic responses caused by {alpha}2AR activation.


Figure 3
View larger version (22K):
[in this window]
[in a new window]

 
Fig. 3. Rank order of potency for EPI, 6FNE, NE, and PHE inhibiting hippocampal CA3 epileptiform burst activity. Extracellular field potentials were used to generate concentration-response curves using increasing amounts of UK-14304 (bullet), EPI ({circ}), 6-FNE ({blacksquare}),NE ({square}), and PHE ({blacktriangleup}) in the presence of 10 µM timolol and 0.5 µM desipramine. There was no significant difference between the calculated EC50 value for UK-14304 (76 ± 43 nM, n = 10) and EPI (100 ± 12 nM, n = 120). There was a significant difference in the potencies calculated for UK-14304 or EPI, compared with 6FNE (300 ± 140 nM, n = 12), NE (1.0 ± 0.31 µM, n = 20) or PHE (140 ± 130 µM, n = 12). There also was a significant difference between the EC50 for 6FNE versus NE, 6FNE versus PHE, and NE versus PHE. Concentration-response curves for each agonist were plotted as percent of maximal response (decrease in epileptiform burst frequency). Each individual experiment best fit to a nonvariable sigmoidal curve.

 

Effect of Selective {alpha}AR Competitive Antagonists on the EPI-Mediated Decrease in Discharge Frequencies. Functional determination of selective {alpha}AR antagonist equilibrium dissociation constants (pKb values) were used to characterize the type of {alpha}AR mediating decreased burst frequency in the hippocampal CA3 region ({alpha}1 or {alpha}2). Initially, CA3 field potential recordings generated by increasing amounts of EPI in the absence and presence of fixed concentrations of the highly selective {alpha}2AR antagonist atipamezole were used to shift the EPI concentration-response curve. Atipamezole possesses a greater than 1000-fold affinity for {alpha}2ARs compared with {alpha}1ARs (Pertovaara et al., 2005Go). Hippocampal slices that had been pretreated with 3, 10, 30, and 100 nM atipamezole produced 3-, 7-, 11-, and 31-fold parallel rightward shifts of the fitted EPI concentration-response curve (Fig. 4A1). Dose ratios calculated for individual runs were plotted against each atipamezole concentration to generate a straight line using linear regression analysis (Fig. 4A2). The Schild regression slope included the value of unity (1.0 ± 0.1) and the x intercept of the regression line represents the atipamezole equilibrium dissociation constant (pKb) for the {alpha}AR subtype mediating the decreased burst frequency. The apparent calculated affinity value of 1.7 ± 0.5 nM (n = 7) was similar to previously published binding Ki values where atipamezole was used to identify {alpha}2ARs (Table 3).


Figure 4
View larger version (31K):
[in this window]
[in a new window]

 
Fig. 4. Schild regression analysis using {alpha}AR antagonists. A1, consecutive EPI concentration-response curves demonstrate a concentration-dependent effect of the selective {alpha}2AR antagonist atipamezole. Pretreatment with 3 nM ({circ}), 10 nM ({blacksquare}), 30 nM ({square}), and 100 nM ({blacktriangleup}) of this AR antagonist produced consecutive parallel rightward shifts of the EPI curve that were significantly different from control (bullet) (EC50 = 330 ± 72, 780 ± 270, 1200 ± 430, and 3500 ± 4400, respectively, versus 110 ± 31 nM for control). A2, using dose ratios calculated from individual experiments illustrated in A1, a Schild plot was created generating a regression slope equaling 1.0 ± 0.1 and an x-intercept correlating to a Kb value of 1.7 ± 0.5 nM (n = 7). B1, pretreatment with 10 µM({circ}), 20 µM({blacksquare}), 50 µM({square}), and 100 µM ({blacktriangleup}) of the selective {alpha}1AR antagonist prazosin, produced consecutive parallel rightward shifts of the EPI curve that were significantly different from control ({blacksquare}) (EC50 = 150 ± 46, 230 ± 48, 520 ± 89, and 710 ± 140, respectively, versus 78 ± 24 nM for control). B2, using dose ratios calculated from individual experiments illustrated in B1, a Schild plot was created generating a regression slope equaling 1.1 ± 0.1 and an x intercept correlating to a Kb value of 4.9 ± 1.4 µM(n = 10).

 

View this table:
[in this window]
[in a new window]

 
TABLE 3 Comparisons of functional Kb values to previously published equilibrium dissociation constants (Ki) of selective {alpha}AR antagonists for rat {alpha}AR subtypes

Kb values are expressed as the mean ± S.E. Schild regression slopes are expressed as the mean slope ± S.E. and were determined in 7 to 10 separate experiments. Ki values are from binding studies using recombinant rat {alpha}AR clones expressed in cell lines.

 

Similar experiments were then used for determining the affinity of the selective {alpha}1AR antagonist prazosin to inhibit the EPI-mediated decrease in CA3 burst frequency. Hippocampal slices that had been pretreated with 10, 20, 50, and 100 µM prazosin produced 2-, 3-, 7-, and 9-fold parallel rightward shifts of the fitted EPI concentration-response curve (Fig. 4B1). Dose ratios were calculated, and the Schild regression slope for prazosin (Fig. 4B2) included the value of unity (1.0 ± 0.1) and the apparent calculated Kb was 4.9 ± 1.4 µM (n = 10). This affinity value correlates most closely with previously reported equilibrium dissociation constants where prazosin was used to identify {alpha}2ARs (Table 3). Together, these Kb values for selective {alpha}AR antagonists confirm that {alpha}2AR activation is mediating this particular antiepileptic effect in CA3.

Effect of Subtype-Selective {alpha}2AR Competitive Antagonists on the EPI-Mediated Decrease in Discharge Frequencies. To determine the specific subtype of {alpha}2AR involved in this response, apparent affinity values of subtype-selective {alpha}2AR competitive antagonists with different rank order of potencies for rat {alpha}2AR subtypes were determined using Schild regression analysis. Hippocampal slices pretreated with either ARC-239 ({alpha}2BAR-selective), BRL-44408 ({alpha}2AAR-selective), MK-912 ({alpha}2CAR-selective), terazosin ({alpha}2BAR-selective), or yohimbine ({alpha}2CAR-selective), produced parallel rightward shifts of the fitted EPI concentration-response curve in all instances (data not shown). For each of these {alpha}2AR competitive antagonists, the slope of the regression line calculated using Schild regression analysis included the value of unity. The equilibrium dissociation constants (Kb values) calculated for these subtype-selective {alpha}2AR competitive antagonists were as follows: MK-912 (4.8 ± 1.6 nM, n = 7; slope = 1.0 ± 0.2), BRL-44408 (15 ± 9.4 nM, n = 7; slope = 1.1 ± 0.1), yohimbine (63 ± 15 nM, n = 8; slope = 1.1 ± 0.1), ARC-239 (540 ± 150 nM, n = 8; slope = 1.1 ± 0.1), and terazosin (5.0 ± 1.1 µM, n = 9; slope = 1.1 ± 0.1). For each of these {alpha}2AR antagonists, the apparent calculated affinity value correlated most closely to published binding affinity value for the rat {alpha}2AAR subtype than either the {alpha}2BAR or {alpha}2CAR subtypes (Table 3). Together, these results suggest the {alpha}2AAR as the specific AR being activated by EPI to decrease hippocampal CA3 epileptiform burst frequency.

{alpha}2AR Antagonist Functional pKb Estimates Correlate to {alpha}2AAR Binding Affinity (pKi) Values. A method frequently used to compare equilibrium dissociation constants of many receptor antagonists for a specific receptor is to correlate experimental affinity values with those that have been published previously (Bylund, 1988Go). Both the correlation coefficient and slope of the correlation line should be similar to unity if the calculated experimental values correspond to published constants for a specific receptor. Illustrated in Fig. 5 are the correlations between the functional affinity estimates (pKb) determined for the selective {alpha}AR antagonists used in this study and the previously published equilibrium dissociation constants (pKi) of these AR antagonists for each rat {alpha}2AR subtype (see also Table 3). A poor correlation coefficient (r = 0.32) and line (slope = 0.21) was calculated comparing our experimental pKb values with previously published pKi values for the rat {alpha}2BAR (Fig. 5B, n = 7). Likewise, a poor correlation coefficient (r = 0.70) and a slope of 0.70 was calculated for the rat {alpha}2CAR (Fig. 5C, n = 6). In contrast, a very high correlation coefficient (0.99) along with a slope of 1.0 was calculated for our experimental pKb values compared with published binding affinity values of these selective {alpha}AR antagonists for the rat {alpha}2AAR subtype (Fig. 5A, n = 6). Either negative slope values or a poor correlation (r < 0.50) were calculated for the rat {alpha}1AAR, {alpha}1BAR, and {alpha}1DAR, respectively (data not shown). Together, these results indicate that, under conditions of impaired GABAergic inhibition, activation of {alpha}2AARs is primarily responsible for the antiepileptic actions of EPI in the rat hippocampal CA3 region.


Figure 5
View larger version (13K):
[in this window]
[in a new window]

 
Fig. 5. Correlation between functional pKb estimates and binding affinity (pKi) values for various selective {alpha}AR antagonists. Using the pKi values for rat {alpha}2ARs (see Table 3), correlation analyses were performed for the {alpha}2AAR (A), the {alpha}2BAR (B), and the {alpha}2CAR (C). The correlation coefficient and slope was 0.99 and 1.0 for the {alpha}2AAR, 0.32 and 0.21 for the {alpha}2BAR, and 0.70 and 0.70 for the {alpha}2CAR.

 


    Discussion
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
{alpha}2ARs expressed in the CNS have been implicated in the regulation of many critical brain processes; however, little is known about the mechanisms or involvement of specific {alpha}2AR subtypes. Building upon our previous findings (Jurgens et al., 2005Go), we confirmed that stimulation of an {alpha}2AR inhibits CA3 epileptiform activity induced by GABAergic inhibition. In this study, we also present molecular and functional evidence that this effect is primarily mediated through the {alpha}2AAR subtype. These findings not only further our understanding for the role of NE in the CNS but could have significant implications for the treatment of epilepsy.

Although in situ hybridization studies have shown the presence of transcripts for all three {alpha}2AR subtypes in the rat brain (Nicholas et al., 1993Go; Scheinin et al., 1994Go; Winzer-Serhan and Leslie, 1997Go; Winzer-Serhan et al., 1997aGo,bGo), these investigations were unable to resolve specific cell types expressing these receptors. Because previous pharmacological studies suggested that {alpha}2ARs mediate the inhibition of CA3 network burst activity and that this effect is most likely to result from activation of receptors located on hippocampal CA3 pyramidal cells (Jurgens et al., 2005Go), we used real-time, single-cell RT-PCR methods to examine the subtype expression of {alpha}2AR mRNA transcripts. Genomic expression profiles suggested that {alpha}2AAR and, to a lesser extent, {alpha}2CAR activation could be involved in the inhibitory action of EPI on CA3 network burst activity. In the present study, {alpha}2AAR transcripts were detected in 12 of 25 hippocampal CA3 pyramidal cells, three of which also coexpressed the {alpha}2cAR transcript. The {alpha}2BAR transcript was not detected in the cytoplasm harvested from the CA3 pyramidal cells. These results are in agreement with other studies indicating a greater expression of {alpha}2A than {alpha}2CAR mRNA in the rat hippocampal CA3 pyramidal layer and no {alpha}2BAR transcripts in the rat hippocampus (Scheinin et al., 1994Go; Winzer-Serhan and Leslie, 1997Go; Winzer-Serhan et al., 1997aGo,bGo). In contrast, Nicholas et al. (1993Go) found that there was more {alpha}2CAR than {alpha}2AAR mRNA in the rat hippocampal CA3 layer. It is possible that additional {alpha}2AR transcripts were present in our cytoplasmic samples with expression levels below our detection limits, because our RT-PCR primer pairs could only consistently amplify mRNA from >1 pg of total RNA (data not shown).

Functional studies exploiting the selective properties of several AR agonists and antagonists were used to conclusively identify the {alpha}2AR inhibiting CA3 network burst activity. Application of the selective {alpha}2AR agonist UK-14304, the selective {alpha}AR agonist 6FNE, or the nonselective AR agonists NE or EPI, in the presence of betaAR blockade, caused a concentration-dependent decrease in the frequency of hippocampal CA3 burst discharges. In contrast, the selective {alpha}1AR agonist PHE did not elicit a significant antiepileptic effect until concentrations >100 µM were tested. For this response, UK-14304 and EPI were found to have the highest potency of these tested AR agonists. The rank order of potency: UK-14304 ≥ EPI > 6FNE > NE >>> PHE implies that {alpha}2AR populations, potentially those identified from single cell RT-PCR analysis, may be responsible for inhibiting hippocampal CA3 hyperexcitability.

Schild regression analysis allowed for calculation of equilibrium dissociation constants (Kb) of subtype-selective {alpha}2AR antagonists to identify which {alpha}2AR subtype(s) modulate the inhibition of CA3 hyperexcitability. Increasing concentrations of subtype-selective {alpha}2AR antagonists were used to produce parallel rightward shifts in the EPI concentration-response curve. These shifts occurred without significantly reducing maximal effects, demonstrating the competitive property of these subtype-selective {alpha}2AR antagonists. Using EC50 dose-ratios in the presence or absence of a selective {alpha}AR antagonist, Schild plots were constructed to determine the slope and x intercept of the Schild regressions (Arunlakshana and Schild, 1959Go). Schild regression x intercepts represent the Kb values of the {alpha}AR antagonists causing competitive inhibition of the EPI-mediated decrease in epileptiform burst discharge frequency.

The low apparent equilibrium dissociation constants (Kb values) calculated for the selective {alpha}2AAR antagonist BRL-44408, coupled with the high apparent Kb values determined for the selective {alpha}2BAR antagonists (ARC-239, prazosin, and terazosin) and selective {alpha}2CAR antagonists (MK-912 and yohimbine), support our belief that {alpha}2AAR activation reduces CA3 hyperexcitability. Overall, the rank order of potency for these selective {alpha}AR antagonists (atipamezole > MK-912 > BRL-44408 > yohimbine > ARC-239 > prazosin ≥ terazosin) was consistent with {alpha}2AAR pharmacology described in other investigations (Table 3). Furthermore, our functionally determined pKb values for {alpha}2AR inhibition of CA3 epileptiform activity correlated very closely (r = 0.99; slope = 1.0) with radioligand binding pKi values determined for the {alpha}2AAR but not for the {alpha}2BAR or {alpha}2CAR (Fig. 5). Coupled with our single-cell RT-PCR results, which demonstrated that {alpha}2AAR mRNA was most frequently detected in CA3 pyramidal cells, these findings indicate that an {alpha}2AAR is responsible for EPI-mediated inhibition of CA3 epileptiform bursts under conditions of GABAergic blockade.

Inhibiting CA3 network bursts through stimulation of {alpha}2ARs may have profound effects on the generation and propagation of CA3 initiated seizures, such as in temporal lobe epilepsy. Noradrenergic activation has been shown to produce robust antiepileptic effects in a variety of seizure models (Giorgi et al., 2004Go). Conversely, reduced noradrenergic function increases seizure susceptibility. The {alpha}2AR is most often and consistently implicated in the antiepileptic effects of NE (Weinshenker and Szot, 2002Go). However, because of a lack of subtype-selective {alpha}2AR ligands, few studies have examined the specific {alpha}2AR subtype(s) involved. Recent studies using transgenic mice have suggested that {alpha}2AARs mediate the antiepileptic effects of NE; a point mutation of the {alpha}2AAR abolishes the antiepileptogenic action of NE (Janumpalli et al., 1998Go) and the antiepileptic effects of {alpha}2AR agonists are absent in {alpha}2AAR knockout mice (Szot et al., 2004Go). It is noteworthy that Szot et al. (2004Go) further concluded that the antiepileptic effects of NE were mediated by postsynaptic {alpha}2AARs. Our results provide evidence for a possible mechanism of postsynaptic {alpha}2AAR-mediated inhibition of epileptic activity through inhibition of a selective population of neurons in a specific region of the hippocampus (i.e., excitatory, glutamatergic CA3 pyramidal cells). We suspect that a similar postsynaptic {alpha}2AAR-mediated inhibition of epileptiform activity may occur in other cortical structures that are often involved in seizures. Nonetheless, this particular hippocampal CA3 mechanism could have profound effects on epilepsy in that it would probably inhibit the spread of seizures through the hippocampus to other cortical structures.

Previous studies have shown that not only does NE fail to inhibit the normal glutamatergic transmission through the hippocampal CA3 circuitry but it also enhances synaptic plasticity in the hippocampal CA3 region (Hopkins and Johnston, 1988Go). Conversely, in this study, we have shown that NE eliminates hippocampal CA3 epileptiform burst discharges. To account for this, we hypothesize that {alpha}2AAR activation reduces hippocampal CA3 epileptiform activity by decreasing the glutamate-mediated neurotransmission between pyramidal cells, but not the glutamatergic drive to or from the CA3 pyramidal cells (possibly by selectively inhibiting glutamate release from the recurrent collaterals). Additional experiments are currently being performed to confirm this hypothesis. If proven correct, this mechanism could explain in part how NE both enhances memory and maintains its antiepileptogenic effects.

This hypothesis, that the {alpha}2AAR-mediating the reduction in hippocampal CA3 epileptiform activity is located on the presynaptic glutamatergic terminals of the recurrent axon collaterals of the CA3 pyramidal neurons, could account for our failure to detect {alpha}2AR mRNA in CA1 pyramidal neurons (Table 2). If the role of the {alpha}2AR is to regulate (i.e., inhibit excessive) glutamate release from the recurrent collaterals, then we might expect no {alpha}2AR to be present in hippocampal CA1 pyramidal cells, because there is no recurrent network among the excitatory CA1 pyramidal neurons, as in CA3. Indeed, if {alpha}2ARs were inhibiting glutamate release either onto or from the CA1 pyramidal cells, then we would expect {alpha}2AR activation by NE to attenuate LTP and, consequently, learning and memory, which is opposite from what has been observed. It is nonetheless possible that {alpha}2AR transcripts were also present in the CA1 pyramidal cells but that their expression levels were below the detection limits for the technique employed.

The present findings suggest a potential new pharmacotherapeutic strategy for treating epilepsy. Two major problems plaguing current antiepileptic medications are intolerable side effects, such as attenuation of learning and memory and failure to adequately control seizures in a significant number of patients (Nadkarni et al., 2005Go). Evidence suggests, however, that unlike most current antiepileptic drugs, noradrenergic stimulation does not inhibit such cognitive functions as learning and memory (Devauges and Sara, 1991Go; Thomas and Palmiter, 1997Go) and may even facilitate certain types of memory processes (Murchison et al., 2004Go). In addition, indirect evidence suggests that a noradrenergic-based therapy could be effective against seizures that are refractory to current antiepileptic drugs. For example, vagus nerve stimulation, which is used to treat medically intractable epilepsies requires an intact NE system for its antiepileptic effects (Krahl et al., 1998Go), has also been shown to improve memory retention (Clark et al., 1999Go). Therefore, our results showing that an {alpha}2AAR expressed on excitatory glutamatergic pyramidal cells inhibits hippocampal CA3 epileptiform activity offers the possibility of developing a noradrenergic-based therapy, which prevents seizures without the adverse effect of interfering with learning and memory.


    Acknowledgements
 
We thank Kendell Graywater, Kristan Green, Elisha Lawrence, Jamie Johnson, Jacob King, Vanessa Nelson, Trisha Sickler, and Tiffany Stratton for help with the experiments and analyzing the data and Karen Cisek for assistance in editing the manuscript.


    Footnotes
 
This investigation was supported in part by North Dakota Experimental Program to Stimulate Competitive Research (ND EPSCoR) through the National Science Foundation (NSF) grants EPS-0132289 and EPS-0447679 (to V.A.D.), NSF Faculty Early Career Development (Career) Award 0347259 (to V.A.D.), National Institutes of Health grant 2P20-RR016471 from the Biomedical Research Infrastructure Networks (BRIN) program and National Institutes of Health grant 5P20-RR017699 from the Centers of Biomedical Research Excellence (COBRE) program (to V.A.D. and J.E.P.). Additional student support was provided by an Epilepsy Foundation Predoctoral Research Training Fellowship (to C.W.J.), an American Epilepsy Society Predoctoral Research Training Fellowship (to K.L.H.), a Doctoral Dissertation Assistantship from ND EPSCoR (to K.L.H.), an Advanced Undergraduate Research Award (AURA) from ND EPSCoR (to S.J.B), an Explorations in Biomedicine Under graduate Summer Research Fellowship for Native Americans from the American Physiological Society (to K.L.D.), and an Undergraduate Summer Research Training Fellowship from the University of North Dakota Office of the Associate Vice President for Medical Research (to B.L.G. and J.A.L.).

Article, publication date, and citation information can be found at http://molpharm.aspetjournals.org.

doi:10.1124/mol.106.031773.

A preliminary report of these findings was presented at the 2005 annual meeting of the Society for Neuroscience; November 12–16, 2005; Washington DC, and the 2006 annual meeting of the American Society for Pharmacology and Experimental Therapeutics, Neuropharmacology Session, April 1–5, San Francisco, CA.

J.E.P. and V.A.D contributed equally to this work.

ABBREVIATIONS: CNS, central nervous system; CA, cornu ammonis; NE, norepinephrine; LTP, long-term potentiation; EPI, epinephrine; AR, adrenergic receptor; BAPTA, 1,2-bis(2-aminophenoxy)ethane-N,N,N',N'-tetraacetic acid; MK-912, (2S-trans)-1,3,4,5',6,6',7,12b-octahydro-1',3'-dimethyl-spiro[2H-benzofuro[2,3-a]quinolizine-2,4'(1'H)-pyrimidin]-2'(3'H)-one hydrochloride; ARC-239, 2-[2-(4-(2-methoxyphenyl)piperazin-1-yl-)ethyl]-4,4-dimethyl-1,3-(2H,4H)-isoquinolindione dihydrochloride; BRL-44408, 2-[(4,5-dihydro-1H-imidazol-2-yl)methyl]-2,3-dihydro-1-methyl-1H-isoindole maleate; ACSF, artificial cerebrospinal fluid; RT-PCR, reverse transcription polymerase chain reaction; 6FNE, 6-fluoronorepinephrine; PHE, (R)-(–)-phenylephrine; UK-14304, 5-bromo-N-(4,5-dihydro-1H-imidazol-2-yl)-6-quinoxalinamine.

1 Current affiliation: Department of Pharmaceutical Sciences, School of Pharmacy, North Dakota State University, Fargo, North Dakota. Back

Address correspondence to: Van A. Doze, Department of Pharmacology, Physiology and Therapeutics, School of Medicine and Health Sciences, University of North Dakota, 501 North Columbia Road, Stop 9037, Grand Forks, ND 58202-9037. E-mail: vdoze{at}medicine.nodak.edu


    References
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Arunlakshana O and Schild HO (1959) Some quantitative uses of drug antagonists. Br J Pharmacol 14: 48–58.[Medline]

Baf MH, Subhash MN, Lakshmana KM, and Rao BS (1994) Alterations in monoamine levels in discrete regions of rat brain after chronic administration of carbamazepine. Neurochem Res 19: 1139–1143.[CrossRef][Medline]

Bylund DB (1988) Subtypes of {alpha}2-adrenoceptors: pharmacological and molecular biological evidence converge. Trends Pharmacol Sci 9: 356–361.[CrossRef][Medline]

Bylund DB, Eikenberg DC, Hieble JP, Langer SZ, Lefkowitz RJ, Minneman KP, Molinoff PB, Ruffolo RR Jr, and Trendelenburg U (1994) International Union of Pharmacology nomenclature of adrenoceptors. Pharmacol Rev 46: 121–136.[Medline]

Clark KB, Naritoku DK, Smitjh DC, Browning RA, and Jensen RA (1999) Enhanced recognition memory following vagus nerve stimulation in human subjects. Nat Neurosci 2: 94–98.[CrossRef][Medline]

Cleary L, Vandeputte C, and Docherty JR (2003) Investigation of postjunctional {alpha}1- and {alpha}2-adrenoceptor subtypes in vas deferens from wild-type and {alpha}2A/D-adrenoceptor knockout mice. Br J Pharmacol 138: 1069–1076.[CrossRef][Medline]

Devauges V and Sara SJ (1991) Memory retrieval enhancement by locus coeruleus stimulation: evidence for mediation by beta-receptors. Behav Brain Res 43: 93–97.[CrossRef][Medline]

Giorgi FS, Pizzanelli C, Biagioni F, Murri L, and Fornai F (2004) The role of norepinephrine in epilepsy: from the bench to the bedside. Neurosci Biobehav Rev 28: 507–524.[CrossRef][Medline]

Hancock AA, Buckner SA, Ireland LM, Knepper SM, and Kerwin JF Jr (1995) Actions of terazosin and its enantiomers at subtypes of {alpha}1- and {alpha}2-adrenoceptors in vitro. J Recept Signal Transduct Res 15: 863–885.[Medline]

Haapalinna A, Viitamaa T, MacDonald E, Savola J-M, Tuomisto L, Virtanen R, and Heinonen E (1997) Evaluation of the effects of a specific {alpha}2-adrenoceptor antagonist, atipamezole, on {alpha}1- and {alpha}2-adrenoceptor subtype binding, brain neurochemistry and behaviour in comparison with yohimbine. Naunyn-Schmiedeberg's Arch Pharmacol 356: 570–582.[CrossRef][Medline]

Harrison JK, D'Angelo DD, Zeng D, and Lynch KR (1991) Pharmacological characterization of rat {alpha}2-adrenergic receptors. Mol Pharmacol 40: 407–412.[Abstract]

Hillman KL, Doze VA, and Porter JE (2005a) Adrenergic receptor characterization of CA1 hippocampal neurons using real time single cell RT-PCR. Brain Res Mol Brain Res 139: 267–276.[Medline]

Hillman KL, Doze VA, and Porter JE (2005b) Functional characterization of the beta-adrenergic receptor subtypes expressed by CA1 pyramidal cells in the rat hippocampus. J Pharmacol Exp Ther 314: 561–567.[Abstract/Free Full Text]

Hopkins WF and Johnston D (1988) Noradrenergic enhancement of long-term potentiation at mossy fiber synapses in the hippocampus. J Neurophysiol 59: 667–687.[Abstract/Free Full Text]

Institute of Laboratory Animal Resources (1996) Guide for the Care and Use of Laboratory Animals, 7th ed. Institute of Laboratory Animal Resources, Commission on Life Sciences, National Research Council, Washington DC.

Janumpalli S, Butler LS, MacMillan LB, Limbird LE, and McNamara JO (1998) A point mutation (D79N) of the {alpha}2A-adrenergic receptor abolishes the antiepileptogenic action of endogenous norepinephrine. J Neurosci 18: 2004–2008.[Abstract/Free Full Text]

Jurgens CWD, Boese SJ, King JD, Pyle SJ, Porter JE, and Doze VA (2005) Adrenergic receptor modulation of hippocampal CA3 network activity. Epilepsy Res 66: 117–128.[CrossRef][Medline]

Kenakin T (1997) Competitive antagonism, in Pharmacologic Analysis of Drug-Receptor Interaction (Kenakin T ed), 3rd ed, pp 331–373, Lippincott-Raven, Philadelphia.

Kesner RP, Lee I, and Gilbert P (2004) A behavioral assessment of hippocampal function based on subregional analysis. Rev Neurosci 15: 333–351.[Medline]

Krahl SE, Clark KB, Smith DC, and Browning RA (1998) Locus coeruleus lesions suppress the seizure-attenuating effects of vagus nerve stimulation. Epilepsia 39: 709–714.[CrossRef][Medline]

Lu S-F, Herbert B, Haufe G, Laue KL, Padgett WL, Oshumleti O, Daly JW, and Kirk KL (2000) Syntheses of (R) - and (S)-2- and 6-fluoronorepinephrine and (R) - and (S)-2- and 6-fluoroepinephirne: effect of stereochemistry on fluorine-induced adrenergic selectivity's. J Med Chem 43: 1611–1619.[CrossRef][Medline]

Murchison CF, Zhang XY, Zhang WP, Ouyang M, Lee A, and Thomas SA (2004) A distinct role for norepinephrine in memory retrieval. Cell 117: 131–143.[CrossRef][Medline]

Nadkarni S, LaJoie J, and Devinsky O (2005). Current treatments of epilepsy. Neurology 64: S2–11.[Abstract/Free Full Text]

Nicholas AP, Pieribone V, and Hokfelt T (1993) Distributions of mRNAs for {alpha}-2 adrenergic receptor subtypes in rat brain: an in situ hybridization study. J Comp Neurol 328: 575–594.[CrossRef][Medline]

O'Rourke MF, Iversen LJ, Lomasney JW, and Bylund DB (1994) Species orthologs of the {alpha}2A adrenergic receptor: the pharmacological properties of the bovine and rat receptors differ from the human and porcine receptors. J Pharmacol Exp Ther 271: 735–740.[Abstract/Free Full Text]

Patane MA, Scott AL, Broten TP, Chang RSL, Ransom RW, DiSalvo J, Forray C, and Bock MG (1998) 4-Amino-2-[4-[1-(benzyloxycarbonyl)-2(S)-[[(1,1-dimethylethyl-)amino]carbonyl]-piperazinyl]-6,7-dimethoxyquinazoline (L-765,314): a potent and selective {alpha}1b adrenergic receptor antagonist. J Med Chem 41: 1205–1208.[CrossRef][Medline]

Pertovaara A, Haapalinna A, Sirviö J, and Virtanen R (2005) Pharmacological properties, central nervous effects, and potential therapeutic applications of atipamezole, a selective {alpha}2-adrenoceptor antagonist. CNS Drug Rev 11: 273–288.[Medline]

Pupo AS and Minneman KP (2001) Adrenergic pharmacology: focus on the central nervous system. CNS Spectr 6: 656–662.[Medline]

Schwartzkroin PA (1986) Hippocampal slices in experimental and human epilepsy. Adv Neurol 44: 991–1010.[Medline]

Scheinin M, Lomasney JW, Hayden-Hixson DM, Schambra UB, Caron MG, Lefkowitz RJ, and Fremeau RT Jr (1994) Distribution of {alpha}2