![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
|
|
|
|
|
||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Department of Clinical Pharmacology and Pharmacogenomics, Graduate School of Pharmaceutical Sciences, Osaka University, Suita, Osaka, Japan
Received December 15, 2006; accepted April 17, 2007
 |
Abstract |
|---|
 Top Abstract Materials and MethodsResultsDiscussionReferences |
|---|
, 2005). Within the P450 superfamily, the CYP1, CYP2, and CYP3 families in particular play an important role in metabolism of xenobiotics. It is well known that the genes of these enzymes are regulated by xenobiotics, hormones, and pathological conditions (Gonzalez, 1988), leading to changes in the catalytic capacity of drug metabolism. Whereas the mechanisms of the chemically induced transcriptional activation of P450 genes have been revealed, that of CYP2E1 is complex and not well understood. In addition to the regulation by xenobiotics, the level of CYP2E1 is influenced by pathophysiological conditions; e.g., CYP2E1 expression is induced under obesity, diabetes, alcoholic, and nonalcoholic steatohepatitis (Caro and Cederbaum, 2004). Furthermore, the increased CYP2E1 level was also observed even under normal physiological conditions, such as in overfed rats (Raucy et al., 1991), in rats fed a high-fat diet (Yoo et al., 1991), and in fasted rats (Hong et al., 1987; Johansson et al., 1988). Although several studies demonstrated that hormones, such as insulin (De Waziers et al., 1995), leptin (Leclercq et al., 2000) and thyroid (Peng and Coon, 1998) and growth hormones (Chen et al., 1999), could mediate the regulation of CYP2E1 expression, the molecular mechanisms governing the CYP2E1 expression have remained to be elucidated.
On the other hand, cellular osmolality can be changed by various physiological or pathophysiological conditions, such as food or water intake, nutrition state, various hormones, and oxidative stress (Haüssinger et al., 1993), suggesting the possibility that the activity of P450s may be influenced by osmotic conditions. Osmotic change in the tissues leads to disturbance of normal ion movement and cell swelling, resulting in cell injury and death (Dmitrieva et al., 2001). In addition, hypertonic stress activates some signaling pathways associated with the impairment of cell viability, such as c-Jun N-terminal kinase and CD95/epidermal growth factor receptor pathways (Reinehr et al., 2002, 2003). On the other hand, it activates the signaling molecules responsible for adapting against hypertonic environment, such as transcriptional factor TonEBP (tonicity-response element binding protein), also called NFAT5, which belongs to Rel/nuclear factor-
B/NFAT family (Woo et al., 2002a; Ho, 2006). TonEBP is activated under hypertonic environment and regulates osmoprotective genes, such as osmolyte transporters [e.g., taurine transporter (TauT) (Ito et al., 2004), sodium/myoinositol transporter, betaine/GABA transporter-1 (BGT-1) (Burg et al., 1997)] and molecular chaperones [e.g., 70-kDa heat shock protein (Hsp70) (Woo et al., 2002b) and osmotic stress protein (Osp94) (Kojima et al., 2004)], which confer the resistance to cells against hypertonic environments.
In the present study, we first screened the influence of hypertonicity on gene regulation of P450s and the other drug-metabolizing enzymes in human hepatocytes and found that the mRNA expression of CYP2E1 is induced under hypertonic environments. Furthermore, we demonstrated the molecular mechanism involved in the CYP2E1 up-regulation in response to hypertonic stimulation by analyzing promoter function. This article provides a new perspective: that osmotic environment controls the capacity of drug metabolism and chemical detoxification in the liver.
|
Materials and Methods |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
). To confirm that the experimental results did not depend on the reagents, we generated two kinds of hypertonic conditions by using both permeant (sodium chloride) and impermeant agents (sucrose). Human hepatocarcinoma cell line HepG2 cells were cultured in minimum essential medium containing 10% fetal bovine serum and were then exposed to hypertonic stress for 24 h, as described above.
Human embryonic kidney cell line, HEK293 cells, were cultured in Dulbecco's modified Eagle's medium containing 10% fetal bovine serum. Cells were transfected with the expression plasmids by using FuGene6 according to the manufacturer's protocol (Roche) and were then harvested for EMSA.
cDNA Microarray for Drug-Metabolic Enzymes. Total RNA was prepared from cells using QIAzol, according to the manufacture's instructions (QIAGEN, Hilden, Germany). Total RNA (10 µg) were reverse-transcribed in the presence of SuperScript II Reverse Transcriptase (Invitrogen, Carlsbad, CA), Cy3-dUTP (GE Healthcare, Chalfont St. Giles, Buckinghamshire, UK), oligo(dT)12-18primer (Invitrogen, Carlsbad, CA), and RNase Inhibitor (Toyobo, Osaka, Japan) in buffer consisting of 50 mM Tris-HCl, pH 8.3, 75 mM KCl, 3 mM MgCl2, 10 mM dithiothreitol, and deoxynucleoside 5'-triphosphates. Reactions were each carried out at 42°C for 80 min, with an addition of SuperScript II Reverse Transcriptase 40 min after start. The resulting Cy3-labeled cDNA probes were purified with MinElute PCR Purification Kit (QIAGEN) according to the manufacturer's protocol.
Kurabo Multiple Assay DNA array for Human (MAPH-01, Kurabo) was used in gene expression screening. The microarray slides were first pretreated with blocking solution consisting of 4x standard saline citrate (SSC), 0.5% SDS, and 1% bovine serum albumin at 42°C for 45 min. The labeled cDNA in hybridization buffer [consisting of 2x SSC, 4x Denhardt's solution (Sigma-Aldrich, St. Louis, MO), and salmon sperm DNA (Invitrogen)] were denatured at 95°C for 2 min and cooled to room temperature. Then, cDNA were applied to each individual array window and hybridized at 65°C for 16 h. After hybridization, the solutions of labeled cDNA on the microarray slides were flushed away by a solution containing 2x SSC and 0.1% SDS, and then the microarray slide was immediately washed in following solutions; 2x SSC and 0.1% SDS at room temperature for 5 min, 0.2x SSC and 0.1% SDS at room temperature for 5 min, 0.2x SSC and 0.1% SDS at 55°C for 5 min, 0.2x SSC at room temperature for 1 min, and 0.05x SSC at room temperature for 2 min.
The images for the hybridized array was captured by GenePix 4000B microarray scanner (Molecular Devices, Sunnyvale, CA), and quantified by using the Genepix Pro 6.0 software (Molecular Devices). The adjusted intensity equals the intensity of each gene minus the background value. The genes with an adjusted intensity of less than 2-fold the background value were not detected. The normalized intensity to GAPDH gene were calculated by the following formula and compared with other treatment: normalized intensity = (X - Z)/(Y - Z) x 103, where X is the adjusted intensity of target gene, Y is the adjusted intensity of GAPDH gene, and Z is the median of adjusted intensities of the negative controls.
Real-Time Quantitative Reverse Transcription-PCR. Total RNA (1 µg) was subjected to the reverse transcription with ReverTra Ace (Toyobo), using oligo(dT)12-18 primer (Invitrogen) at 42°C for 60 min, followed by PCR. Quantitative RT-PCR analyses were performed by using an ABI7700 (Applied Biosystems, Foster City, CA) with SYBR green and Taq-Gold DNA polymerase (Applied Biosystems). The PCR primers used are shown in Table 1. PCR parameters were as follows: initial denaturation at 95°C for 5 min to activate Tag DNA polymerase followed by 40 cycles of 15 s at 95°C and 1 min at 60°C. GAPDH was used as an internal control.
|
Western Blot Analyses. Western blot was performed as described previously (Ito et al., 2004). Anti-CYP2E1 (Calbiochem, San Diego, CA) and anti-GAPDH antibody (Chemicon, Temecula, CA) were used.
Measurement of CYP2E1 Activity. CYP2E1 activity was determined according to previous reports (Dicker et al., 1990; Rodríguez-Antona et al., 2002; Thasler et al., 2006). In brief, cultured primary hepatocytes were washed twice, incubated with 0.5 mM p-nitrophenol in Krebs-Henseleit buffer containing 200 mg/L glucose at 37°C for 60 min, and then the reaction was terminated by adding trichloroacetic acid to a final concentration of 5% (w/v). Cells were harvested and centrifuged at 10,000g for 10 min, and the supernatants were assayed for 4-nitrocatechol by adding 10 M NaOH (1:10) and immediately determining the absorbance at 546 nm.
Plasmids. A DNA fragment of CYP2E1 promoter region positioning from -1361 to +32 was amplified by PCR using human genomic DNA as a template and the PCR primers -1361F and +32R, which is conjugated with a HinDIII site (Table 2), and a XhoI/HinDIII fragment that contained CYP2E1 promoter region from positions -1342 to +32 was cloned into pGL3-basic (Promega, Madison, WI) (p2E1-1342). Then this fragment was used as the template for the preparation of different lengths of CYP2E1 promoter region. Primer sequences are shown in Table 2. Different lengths of CYP2E1 promoter region from positions -586 to +32 and -566 to +32 were prepared by PCR and inserted into firefly luciferase plasmids pGL3-basic (p2E1-586 and p2E1-566). Reporter plasmid containing -230 to +32 (p2E1-230) was generated by self-ligation of the NheI-cut fragment of p2E1-586. Mutation of the tonicity-responsive element (TonE) site was generated in p2E1-586 by PCR using the primer -586mutF shown in Table 2. This PCR product was inserted into pGL3 to create p2E1-586mut. The plasmids were verified by sequencing. The reporter plasmid p4 x 2E1TonE-SV40-Luc was generated by insertion of four copies of the double-stranded TonE motif of CYP2E1 promoter region, 5'-CTAGCGGATCCCATGGAATTTTCCAGTTCATGGAATTTTCCAGTTCATGGAATTTTCCAGTT-3' into the multicloning site pGL3-promoter vector containing SV40 promoter (Promega). The expression vectors carrying TonEBP (pCMV-TonEBP) and dominant-negative TonEBP (pCMV-dnTonEBP) were generated previously (Ko et al., 2000; Ito et al., 2004).
|
Luciferase Assay. Transient transfection into HepG2 cells was performed by using Fugene 6 transfection reagent (Roche Diagnostics, Basel, Switzerland) according to the manufacturer's protocol. Assay was performed using the Dual Luciferase assay system (Promega) as described previously (Ito et al., 2004). Control plasmid (pRL-TK; Promega) was cotransfected for used as an internal standard.
Immunofluorescence Microscopic Examination. Immunofluorescence microscopic examination was performed as described previously (Ito et al., 2007). Immunostaining was performed using anti-TonEBP(1439-1455) antibody (1:100; Chemicon International, Temecula, CA) and Alexa Fluor 488 secondary antibody (Invitrogen). Cells were examined with the use of an inverted tissue culture microscope (IX70; Olympus, Tokyo, Japan).
Electrophoretic Mobility Shift Assay. Nuclear extracts were prepared form HEK293 or HepG2 cells cells, and EMSA was performed as described previously (Ito et al., 2007). To prepare DNA probes for EMSA, single-strand oligonucleotides (2E1-TonE: sense, AACTGGAAAATTCCATG; antisense, CATGGAATTTTCCAGTT) were end-labeled by [
-32P]ATP and then were annealed at room temperature. Nuclear extracts were incubated with 32P-labeled DNA probe (10 nM) and poly(dI-dC) at 30°C for 20 min. To perform the competition assay, excess concentration (500 nM) of wild-type or mutant 2E1-TonE, wild TauT-TonE oligonucleotides (2E1-TonEmut: sense, AACTCGATCATTCCATG; antisense, CATGGAATGATCGAGTT; TauT-TonE: sense, AGCTGGTATTTTTCCACCCAG; antisense, CTGGGTGGAAAAATACCAGCT; underlining indicates mutated sites) (Ito et al., 2007) was preincubated for 5 min, followed by the incubation with radiolabeled probe. For supershift assay, 2 µg of antibodies [anti-TonEBP (NFAT5) antibody (Chemicon) or control IgG (Santa Cruz)] was added after 20 min from adding radiolabeled oligoprobe. The DNA-protein complex was fractionated by 4% polyacrylamide gel. The gels were dried and processed for autoradiography.
Statistical Analysis. Each value was expressed as the mean ± S.E. Statistical significance was determined by Student's t test. Differences were considered statistically significant when the calculated P value was less than 0.05.
|
Results |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
|
Quantitative RT-PCR validated the change of each gene in primary hepatocytes exposed to hypertonic conditions (Fig. 1A). In addition, TauT mRNA, which has been reported to be induced by hypertonicity in many type of cells (Uchida et al., 1992; Satsu et al., 1999; Ito et al., 2004), was also up-regulated in primary hepatocytes exposed to hypertonic conditions, also supporting the idea that the up-regulations of CYP2E1, CYP1A1, and UGT2B4 depend on osmotic changes. Furthermore, to confirm the effect of hypertonic stimulation to the other P450s, the levels of CYP2B6, -2C9, -2D6, and -3A4 mRNA were quantified by quantitative RT-PCR. Whereas the expression level of CYP2D6 mRNA was also significantly reduced by treatment with both NaCl and sucrose, CYP2B6 was decreased by sucrose but not NaCl (Fig. 1B). In addition, the levels of CYP2C9 and -3A4 were not changed.
|
|
) but is detectable at mRNA level (Sumida et al., 2000). We also ascertained that the ratio of CYP2E1 mRNA to GAPDH mRNA in HepG2 cells was less than 1000 times compared with that in primary hepatocytes (Data not shown). However, the up-regulation of CYP2E1 mRNA in response to hypertonic environments was observed in HepG2 cells (Fig. 3A), indicating that HepG2 cells conserve the signaling pathways governing the CYP2E1 up-regulation in response to hypertonic stimulations. Thus, HepG2 cells are available to analyze the molecular mechanisms for hypertonicity-induced CYP2E1 up-regulation. In addition, consistent with the data from primary hepatocytes, the increases of CYP1A1 and UGT2B4 and the decrease of CYP1A2 mRNA were also observed in HepG2 cells (Data not shown).
|
Furthermore, promoter activity driven by reporter plasmid containing four repeats of TonE motif (p4 x 2E1TonE-SV40) was activated by hypertonicity, whereas that driven by reporter plasmid containing no TonE motif was not (Fig. 4). These results indicate that this TonE-consensus motif is crucial for regulation of 2E1 promoter activity in response to hypertonicity.
|
; López-Rodríguez et al., 2001). Nuclear translocation of TonEBP was also ascertained in HepG2 cells cultured in hypertonic media for 24 h (Fig. 5A). We investigated whether TonE locating in 2E1 promoter region interacts with TonEBP protein. In nuclear extract from HEK293 cells transfected with expression vector carrying TonEBP, protein-DNA complex was detected, as assessed by EMSA (Fig. 5B). This complex was competed by unlabeled probe or unlabeled TauT-TonE oligonucleotides that correspond to the TonEBP consensus sequence in the TauT gene promoter but not by unlabeled oligonucleotides with the consensus sequence mutated. Furthermore, DNA-protein complex formation was shifted by anti-TonEBP antibody but not control IgG, indicating that this DNA-protein complex consists of TonEBP. DNA-TonEBP complex was also consistently detected in nuclear extracts obtained from HepG2 cells, and this complex was increased by hypertonic stimulation, as assessed by EMSA (Fig. 5C), indicating that hypertonic stimulations enhance TonEBP transactivation and binding to TonE motif in CYP2E1 promoter.
|
Next, we confirmed whether TonEBP regulated CYP2E1 promoter activity through TonE motif. Luciferase activity driven on TonE-containing promoter-reporter plasmids (p2E1-1342, p2E1-586), but not mutated plasmid (p2E1-586mut), was increased by cotransfection of TonEBP-expressing vector even under isotonic conditions (Fig. 6, A and B). TonEBP overexpression resulted in enhancement of hypertonicity-induced activation of CYP2E1 promoter. Furthermore, promoter activation driven on p2E1-1342 were suppressed by cotransfection of expression vector carrying dnTonEBP under both isotonic and hypertonic conditions (Fig. 6A). Thus, TonEBP is a crucial regulator of basal and hypertonicity-induced expression of CYP2E1.
|
|
Discussion |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
Previous reports show that there are some putative transcriptional factor-binding motifs, such as signal transducer and activator of transcription, activator protein-1, NFAT, NFB, CCAAT/enhancer-binding protein, at -671 to -544 of CYP2E1 5'-flanking region (Abdel-Razzak et al., 2004), whereas TonE motif is found at -578 to -568. Our results presented here revealed that this region is necessary for hypertonicity-induced activation of CYP2E1 promoter. Because putative binding sequences of other NFAT family proteins and NFB are overlapped with TonE at -578 to -568, not only TonEBP but also other NFAT family proteins and NFB were predicted to be involved in the regulation of CYP2E1 promoter in response to hypertonicity. However, other NFATs and NFB have been demonstrated to be not activated by hypertonic stimulation, whereas TonEBP is activated (López-Rodríguez et al., 2001). Although TonEBP (NFAT5) is a member of NFAT family of proteins, only TonEBP is distinct from other NFATs (NFAT1-4), because it has no calcineurin-regulated domains and is not regulated by Ca2+/calcineurin pathway, suggesting its particular function (Ho, 2003). Thus, it makes no sense that either NFAT1-4 or NFB is involved in the up-regulation of CYP2E1 in response to hypertonic condition. We consistently demonstrated that dnTonEBP overexpression suppressed hypertonicity-induced activation of CYP2E1 promoter. It has been reported that this deletion mutant does not influence the transcriptional activity of the other NFAT, NFB despite interfering TonEBP dimerization (López-Rodríguez et al., 1999; Trama et al., 2002), indicating that the regulation of CYP2E1 promoter under hypertonic environment is associated with TonEBP transactivation.
In the present study, whereas the reporter activity driven by p4 x 2E1TonE-SV40, which contains four repeats of TonE motif, increases only 2- to 2.5-fold in response to hypertonicity; the 2E1-586 construct, which contained only one of the TonEBP sites, showed increased activity of more than 4-fold. These results suggest that other promoter regions of CYP2E1, in addition to the TonE motif, may be necessary for full activation of CYP2E1 transcription in response to hypertonic stress. Although molecular mechanisms of TonEBP transactivation remain to be elucidated, recent studies demonstrated that TonEBP interacts with some proteins, including the 90-kDa heat shock protein and poly(ADP-ribose) polymerase-1, and these proteins modulate TonEBP activity (Chen et al., 2007), indicating that interaction with some proteins regulates TonEBP function. Thus, some proteins may interact with TonEBP, which bind to DNA in the 5'-flanking region of CYP2E1 and cooperate TonEBP transactivation.
CYP2E1 catalyzes the metabolism of a wide range of exogenous and endogenous low-molecular-weight toxicants, such as alcohol, acetaminophen, and lipids (Caro and Cederbaum, 2004). CYP2E1, as well as the other P450 family proteins, is critical for body's defense against xenobiotics exposure. This study demonstrated CYP2E1 is involved in adaptive response against hypertonic environment via TonEBP activation. Although an essential role of TonEBP is not well understood, a number of evidences support that TonEBP plays cytoprotective roles against hypertonic stimulation in mammalian tissues. For example, inhibition of TonEBP by dominant-negative TonEBP resulted in the impairment of cell viability and the increase in the susceptibility against hypertonic stress (Trama et al., 2002; Wang et al., 2005; Ito et al., 2007). The present study provides a new insight that TonEBP regulates the metabolism of pharmaceutical drugs and exogenous toxicants in the liver. On the other hand, previous reports illustrated that the oxidative stress caused by CYP2E1 is likely to be involved in hepatic pathogenesis, such as alcohol- or acetaminophen-induced hepatic toxicity (Lee et al., 1996; Zaher et al., 1998; Cederbaum et al., 2001; Caro and Cederbaum, 2004; Gonzalez, 2005), implying that TonEBP might contribute to hepatic pathogenesis through CYP2E1 up-regulation.
Our investigation revealed novel evidence that CYP1A1 and UGT2B4 are also up-regulated by hypertonic stimulations in human hepatocytes. The motif-search analyses failed to detect any TonE consensus sequences within 5000 base pairs of 5'-flanking region of each gene in human genome sequence [CYP1A1 (GenBank accession no NT_010194 [GenBank] ) and UGT2B4 (GenBank accession no. NT_077444 [GenBank] )]. Because the genome structures of drug-metabolizing enzymes, including P450 and UGT superfamilies, are commonly complex, the regulation of these genes may be involved with cis-elements far from each transcript start site or controlled by other TonEBP-independent pathways.
In addition, we identified the reduction of CYP1A2 and CYP2D6 mRNAs in response to hypertonic environments. Although the regulatory mechanisms of the transcription of these enzymes are well investigated, we did not find any putative transcript factors involved in the down-regulation of CYP1A2 and CYP2D6 by hypertonic stress. On the other hand, hypertonic stress has been reported to enhance mRNA decay (Teixeira et al., 2005). Thus, it is also possible that the mRNA decay pathway may target these genes, leading to lower stability of these mRNAs. Furthermore, CYP2B6 mRNA was down-regulated by the exposure to sucrose, but not NaCl, indicating that the induction of CYP2B6 is independent of the effect of hypertonic stress. Because these P450s are responsible for the metabolism of a large number of drugs and changes and may have clinical consequences, further studies will be required to clarify the molecular mechanism and the clinical significance of these findings.
In the present study, we performed cDNA microarray for only 2 lines (lots) of primary hepatocytes. Based on the results obtained from DNA microarray, the levels of no other genes were altered by hypertonicity among the P450, UGT, NAT, and SULT families. It is well known that the expression levels of these genes are widely different among individuals, so the data of each gene widely differ among different lines of hepatocytes. Furthermore, we could not determine the change of the genes expressed at low level because of the scattered data and/or the limitation of detection. Taken together, it can be barely concluded that we detected all of genes susceptible for hypertonic environments by using microarray. Indeed, further experiments by quantitative RT-PCR analysis have identified reduction in CYP2B6 and CYP2D6 mRNAs despite their being undetectable by DNA microarray technique.
In summary, we demonstrated that the level of CYP2E1 was up-regulated under hypertonic conditions via TonEBP transactivation. Because tissue and plasma osmolality is altered even by common events in human life, such as nutrients, hormones, and dehydration (Haüssinger et al., 1993), the metabolizing capacity of CYP2E1 is likely to be changed in daily life. In addition, pathophysiological changes of osmolality may affect to the activity and expression of CYP2E1 in the liver; e.g., the up-regulation of CYP2E1 in diabetes could be associated with an increase in osmolality caused by acidosis (Owens et al., 1998). This unique response of CYP2E1 to hypertonicity may contribute to the wide variety of individual responses to drug therapy, and further studies will be required to determine the clinical importance of TonEBP/CYP2E1 pathway in drug metabolism.
|
Acknowledgements |
|---|
|
Footnotes |
|---|
ABBREVIATIONS: P450, cytochrome P450; TonEBP, tonicity-response element binding protein; EMSA, electrophoretic mobility shift assay; PCR, polymerase chain reaction; SSC, standard saline citrate; RT, reverse transcription; TonE, tonicity-response element; SV40, simian virus 40; CMV, cytomegalovirus; dnTonEBP, dominant-negative TonEBP; HEK, human embryonic kidney; UGT, UDP glucuronosyltransferase; NAT, N-acetyl-transferase; SULT, sulfotransferase; GST, glutathione transferase; NFB, nuclear factor B; NFAT, nuclear factor of activated T cells; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; RT-PCR, reverse transcription-polymerase chain reaction; EMSA, electrophoretic mobility shift assay; TauT, taurine transporter.
Address correspondence to: Junichi Azuma, Department of Clinical Pharmacology and Pharmacogenomics, Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka, 565-0871, Japan. E-mail: azuma{at}phs.osaka-u.ac.jp
|
References |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
Burg MB, Kwon ED, and Kultz D (1997) Regulation of gene [expression by hypertonicity. Annu Rev Physiol 59: 437-455.[CrossRef][Medline]
Caro AA, and Cederbaum AI (2004) Oxidative stress, toxicology, and pharmacology of CYP2E1. Annu Rev Pharmacol Toxicol 44: 27-42.[CrossRef][Medline]
Cederbaum AI, Wu D, Mari M, and Bai J (2001) CYP2E1-dependent toxicity and oxidative stress in HepG2 cells. Free Radic Biol Med 31: 1539-1543.[CrossRef][Medline]
Chen GF, Ronis MJ, Ingelman-Sundberg M, and Badger TM (1999) Hormonal regulation of microsomal cytochrome P4502E1 and P450 reductase in rat liver and kidney. Xenobiotica 29: 437-451.[CrossRef][Medline]
Chen Y, Schnetz MP, Irarrazabal CE, Shen RF, Williams CK, Burg MB, and Ferraris JD (2007) Proteomic identification of proteins associated with the osmoregulatory transcription factor TonEBP/OREBP: functional effects of Hsp90 and PARP-1. Am J Physiol Renal Physiol 292: F981-F992.
De Waziers I, Garlatti M, Bouguet J, Beaune PH, and Barouki R (1995) Insulin down-regulates cytochrome P450 2B and 2E expression at the post-transcriptional level in the rat hepatoma cell line. Mol Pharmacol 47: 474-479.[Abstract]
Dicker E, McHugh T, and Cederbaum AI (1990) Increased oxidation of p-nitrophenol and aniline by intact hepatocytes isolated from pyrazole-treated rats. Biochim Biophys Acta 1035: 249-256.[Medline]
Dmitrieva NI, Michea LF, Rocha GM, and Burg MB (2001) Cell cycle delay and apoptosis in response to osmotic stress. Comp Biochem Physiol A Mol Integr Physiol 130: 411-420.[CrossRef][Medline]
Gonzalez FJ (1988) The molecular biology of cytochrome P450s. Pharmacol Rev 40: 243-288.[Medline]
Gonzalez FJ (2005) Role of cytochromes P450 in chemical toxicity and oxidative stress: studies with CYP2E1. Mutat Res 569: 101-110.[Medline]
Häussinger D, Roth E, Lang F, and Gerok W (1993) Cellular hydration state: an important determinant of protein catabolism in health and disease. Lancet 341: 1330-1332.[CrossRef][Medline]
Ho SN (2003) The role of NFAT5/TonEBP in establishing an optimal intracellular environment. Arch Biochem Biophys 413: 151-157.[CrossRef][Medline]
Ho SN (2006) Intracellular water homeostasis and the mammalian cellular osmotic stress response. J Cell Physiol 206: 9-15.[CrossRef][Medline]
Hong JY, Pan JM, Gonzalez FJ, Gelboin HV, and Yang CS (1987) The induction of a specific form of cytochrome P-450 (P-450j) by fasting. Biochem Biophys Res Commun 142: 1077-1083.[CrossRef][Medline]
Ito T, Fujio Y, Hirata M, Takatani T, Matsuda T, Muraoka S, Takahashi K, and Azuma J (2004) Expression of taurine transporter is regulated through the TonE (tonicity-responsive element)/TonEBP (TonE-binding protein) pathway and contributes to cytoprotection in HepG2 cells. Biochem J 382: 177-182.[CrossRef][Medline]
Ito T, Fujio Y, Takahashi K, and Azuma J (2007) Degradation of NFAT5, a transcriptional regulator of osmotic stress-related genes is a critical event for doxorubicin-induced cytotoxicity in cardiac myocytes. J Biol Chem 282: 1152-1160.
Johansson I, Ekstrom G, Scholte B, Puzycki D, Jornvall H, and Ingelman-Sundberg M (1988) Ethanol-, fasting-, and acetone-inducible cytochromes P-450 in rat liver: regulation and characteristics of enzymes belonging to the IIB and IIE gene subfamilies. Biochemistry 27: 1925-1934.[CrossRef][Medline]
Ko BC, Turck CW, Lee KW, Yang Y, and Chung SS (2000) Purification, identification, and characterization of an osmotic response element binding protein. Biochem Biophys Res Commun 270: 52-61.[CrossRef][Medline]
Kojima R, Randall JD, Ito E, Manshio H, Suzuki Y, and Gullans SR (2004) Regulation of expression of the stress response gene, Osp94: identification of the tonicity response element and intracellular signalling pathways. Biochem J 380: 783-794.[CrossRef][Medline]
Leclercq IA, Field J, Enriquez A, Farrell GC, and Robertson GR (2000) Constitutive and inducible expression of hepatic CYP2E1 in leptin-deficient ob/ob mice. Biochem Biophys Res Commun 268: 337-344.[CrossRef][Medline]
Lee SS, Buters JT, Pineau T, Fernandez-Salguero P, and Gonzalez FJ (1996) Role of CYP2E1 in the hepatotoxicity of acetaminophen. J Biol Chem 271: 12063-12067.
López-Rodríguez C, Aramburu J, Rakeman AS, and Rao A (1999) NFAT5, a constitutively nuclear NFAT protein that does not cooperate with Fos and Jun. Proc Natl Acad Sci U S A 96: 7214-7219.
López-Rodríguez C, Aramburu J, Jin L, Rakeman AS, Michino M, and Rao A (2001) Bridging the NFAT and NF-kappaB families: NFAT5 dimerization regulates cytokine gene transcription in response to osmotic stress. Immunity 15: 47-58.[CrossRef][Medline]
Owens FN, Secrist DS, Hill WJ, and Gill DR (1998) Acidosis in cattle: a review. J Anim Sci 76: 275-286.
Peng HM, and Coon MJ (1998) Regulation of rabbit cytochrome P450 2E1 expression in HepG2 cells by insulin and thyroid hormone. Mol Pharmacol 54: 740-747.
Raucy JL, Lasker JM, Kraner JC, Salazar DE, Lieber CS, and Corcoran GB (1991) Induction of cytochrome P450IIE1 in the obese overfed rat. Mol Pharmacol 39: 275-280.[Abstract]
Reinehr R, Graf D, Fischer R, Schliess F, and Häussinger D (2002) Hyperosmolarity triggers CD95 membrane trafficking and sensitizes rat hepatocytes toward CD95L-induced apoptosis. Hepatology 36: 602-614.[CrossRef][Medline]
Reinehr R, Schliess F, and Häussinger D (2003) Hyperosmolarity and CD95L trigger CD95/EGF receptor association and tyrosine phosphorylation of CD95 as prerequisites for CD95 membrane trafficking and DISC formation. Faseb J 17: 731-733.
Rodríguez-Antona C, Donato MT, Boobis A, Edwards RJ, Watts PS, Castell JV, and Gomez-Lechon MJ (2002) Cytochrome P450 expression in human hepatocytes and hepatoma cell lines: molecular mechanisms that determine lower expression in cultured cells. Xenobiotica 32: 505-520.[CrossRef][Medline]
Satsu H, Miyamoto Y, and Shimizu M (1999) Hypertonicity stimulates taurine uptake and transporter gene expression in Caco-2 cells. Biochim Biophys Acta 1419: 89-96.[Medline]
Sumida A, Fukuen S, Yamamoto I, Matsuda H, Naohara M, and Azuma J (2000) Quantitative analysis of constitutive and inducible CYPs mRNA expression in the HepG2 cell line using reverse transcription-competitive PCR. Biochem Biophys Res Commun 267: 756-760.[CrossRef][Medline]
Teixeira D, Sheth U, Valencia-Sanchez MA, Brengues M, and Parker R (2005) Processing bodies require RNA for assembly and contain nontranslating mRNAs. RNA 11: 371-382.
Thasler WE, Dayoub R, Muhlbauer M, Hellerbrand C, Singer T, Grabe A, Jauch KW, Schlitt HJ, and Weiss TS (2006) Repression of cytochrome P450 activity in human hepatocytes in vitro by a novel hepatotrophic factor, augmenter of liver regeneration. J Pharmacol Exp Ther 316: 822-829.
Trama J, Go WY, and Ho SN (2002) The osmoprotective function of the NFAT5 transcription factor in T cell development and activation. J Immunol 169: 5477-5488.
Uchida S, Kwon HM, Yamauchi A, Preston AS, Marumo F, and Handler JS (1992) Molecular cloning of the cDNA for an MDCK cell Na+- and Cl--dependent taurine transporter that is regulated by hypertonicity. Proc Natl Acad Sci U S A 89: 8230-8234.
Wang Y, Ko BC, Yang JY, Lam TT, Jiang Z, Zhang J, Chung SK, and Chung SS (2005) Transgenic mice expressing dominant-negative osmotic-response element-binding protein (OREBP) in lens exhibit fiber cell elongation defect associated with increased DNA breaks. J Biol Chem 280: 19986-19991.
Woo SK, Lee SD, and Kwon HM (2002a) TonEBP transcriptional activator in the cellular response to increased osmolality. Pflugers Arch 444: 579-585.[CrossRef][Medline]
Woo SK, Lee SD, Na KY, Park WK, and Kwon HM (2002b) TonEBP/NFAT5 stimulates transcription of HSP70 in response to hypertonicity. Mol Cell Biol 22: 5753-5760.
Yoo JS, Ning SM, Pantuck CB, Pantuck EJ, and Yang CS (1991) Regulation of hepatic microsomal cytochrome P450IIE1 level by dietary lipids and carbohydrates in rats. J Nutr 121: 959-965.
Zaher H, Buters JT, Ward JM, Bruno MK, Lucas AM, Stern ST, Cohen SD, and Gonzalez FJ (1998) Protection against acetaminophen toxicity in CYP1A2 and CYP2E1 double-null mice. Toxicol Appl Pharmacol 152: 193-199.[CrossRef][Medline]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|
 |
 |
 |
