|
|
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Department of Pharmacology, Yale University School of Medicine, New Haven, Connecticut
Received December 14, 2006; accepted June 12, 2007
| Abstract |
|---|
|
|
|---|
-L-Dioxolane-cytidine (L-OddC, Troxacitabine, BCH-4556), a novel L-configuration deoxycytidine analog, is under clinical trials for treating cancer. The cytotoxicity of L-OddC is dependent on the amount of the triphosphate form (L-OddCTP) in nuclear DNA. Phosphoglycerate kinase (PGK), a downstream protein of hypoxia-inducible-factor-1
(HIF-1
), is responsible for the phosphorylation of the diphosphate to the triphosphate of L-OddC. In this study, we studied the impact of hypoxia on the metabolism and the cytotoxicity of L-OddC and
-D-2',2'-difluorodeoxycytidine (dFdC) in several human tumor cell lines including HepG2, Hep3B, A673, Panc-1, and RKO. Hypoxic treatment induced the protein expression of PGK 3-fold but had no effect on the protein expression of APE-1, dCK, CMPK, and nM23 H1. Hypoxic treatment increased L-OddCTP formation and incorporation of L-OddC into DNA, but it decreased the uptake and incorporation of dFdC, which correlated with the reduction of hENT1, hENT2, and hCNT2 expression. Using a clonogenic assay, hypoxic treatment of cells made them 2- to 3-fold more susceptible to L-OddC but not to dFdC after exposure to drugs for one generation. Dimethyloxallyl glycine enhanced the cytotoxicity of L-OddC but not dFdC in Panc-1 cells under normoxic conditions. Overexpression or down-regulation of PGK using transient transfection of pcDNA5-PGK or inducible shRNA in RKO cells affected the cytotoxicity of L-OddC but not that of dFdC. The knockdown of HIF-1
in inducible shRNA in RKO cells reduced the cytotoxicity of L-OddC but not dFdC under hypoxic conditions. In conclusion, hypoxia is an important factor that may potentiate the activity of L-OddC.
-L-Dioxolane-cytidine (L-OddC, BCH-4556, Troxacitabine) is a novel L-configuration deoxycytidine analog with anticancer and antiviral (hepatitis B virus and human immunodeficiency virus) activity (Kim et al., 1992
In previous studies, we demonstrated that L-OddC can be phosphorylated by deoxycytidine kinase (dCK) to its monophosphate metabolite, which is further phosphorylated to the di- and triphosphate metabolites by cellular kinases (Grove and Cheng, 1996
). The triphosphate metabolite of L-OddC can be incorporated into DNA in vitro by DNA polymerases
,
,
,
, and
(Kukhanova et al., 1995
). Because L-OddC lacks a hydroxyl group at the 3'-position, once incorporated into DNA, it causes premature termination of DNA replication and eventually leads to cell death. Therefore, the cytotoxicity of L-OddC is dependent on the steady-state level of the incorporated L-OddC in nuclear DNA. This level is affected by the amount of L-OddCTP formed by phosphoglycerate kinase (PGK) (Krishnan et al., 2002a
,b
, 2003
) as well as the removal of L-OddCMP from the 3' termini of DNA by APE-1 (Chou and Cheng, 2000; Lam et al., 2006
).
The primary function of PGK, a 46-kDa glycolytic protein, is to use 1,3-biphosphoglycerate as a phosphate donor to generate one molecule of ATP during glycolysis. In hypoxic conditions, ATP synthesis depends on glycolysis in the cytoplasm instead of occurring via oxidative phosphorylation in mitochondria. The up-regulation of glycolytic enzymes such as PGK under hypoxic conditions has been postulated to be one of the compensatory mechanisms for ensuring enough ATP generation. PGK was identified as one of the HIF-1
target genes based on the presence of hypoxia response elements (HRE) (acgtg or gcgtg) in the promoter region (Kress et al., 1998
; Okino et al., 1998
).
Because hypoxic conditions (oxygen partial pressure 5–10 mm Hg; 0.7%–1.4% oxygen in gas phase) are commonly detected in solid tumors (Brown and Wilson, 2004
) and hypoxia has been shown to enhance only PGK expression and not PGK excretion in tumor cells (Daly et al., 2004
). We hypothesize that hypoxic conditions in tumors may facilitate the synthesis of the triphosphate metabolite of L-OddC through the action of PGK activated by HIF-1
. L-OddC is therefore a potential drug for preferential inhibition of hypoxic tumor growth.
We report here the effect of hypoxic treatment (1% O2, 5% CO2, 94% N2) on the expression of PGK and APE-1, and the cytotoxicity of L-OddC and dFdC in human tumor cell lines, including HepG2, Hep3B, A673, Panc-1, and RKO, and the metabolism of L-OddC and dFdC in Panc-1 cells.
| Materials and Methods |
|---|
|
|
|---|
Western Blotting. Cells were lysed in 2x SDS sample buffer (62.5 mM Tris-HCl, 2% SDS, 10% glycerol, 50 mM dithiothreitol, and 0.05% bromphenol blue) and sonicated for 10 s to shear DNA. The whole-cell extracts were then electrophoresed through 12% SDS-polyacrylamide gels and transferred to nitrocellulose membranes (Bio-Rad Laboratories, Hercules, CA) with a Mini Trans-Blot cell (Bio-Rad). The membranes were blocked and probed in 1x PBS buffer with 0.2% Tween 20 containing 5% nonfat milk. Monoclonal anti-HIF-1
(1:2000), polyclonal anti-PGK (1:5000), polyclonal anti-APE-1 (1:7500; Santa Cruz Biotechnology, Santa Cruz, CA), polyclonal anti-nM23 H1 (1:1000; Santa Cruz Biotechnology), polyclonal anti-CMPK (1:2000; Liou et al., 2002
), and polyclonal anti-dCK (1: 2000; Hatzis et al., 1998
) were used to detect the corresponding proteins.
-Actin was used as an internal control to ensure equal protein loading and detected with a monoclonal actin antibody diluted 1:2500 (Sigma, St. Louis, MO). The membranes were then further incubated with horseradish peroxidase-conjugated anti-mouse IgG and anti-rabbit IgG (1:5000; Sigma), The immunoreactive bands were visualized by enhanced chemiluminescence reagents (PerkinElmer Life and Analytical Sciences, Waltham, MA), and densitometry scanning was performed with the densitometer (GE Healthcare, Chalfont St. Giles, Buckinghamshire, UK).
Confocal Microscopy. Cells with or without hypoxia pretreatment were fixed with 4% paraformaldehyde in PBS and then permeabilized with 0.5% Triton X-100 in PBS. Bovine serum albumin (1%) in PBS was used to block nonspecific binding. Cells were then exposed to monoclonal anti-HIF-1
, polyclonal anti-PGK, or monoclonal anti-APE-1 (1:3000; Novus, Littleton, CO) at room temperature for 1 h, followed by fluorescein isothiocyanate-conjugated anti-mouse/rabbit IgG at 1:200 dilution. Cytoplasmic actin was counter-stained with 0.25 µg/ml rhodamine phalloidin (Invitrogen, Carlsbad, CA). The cells were then sealed in antifade reagent (Invitrogen). Confocal micrographs were scanned by a laser scanning confocal microscope (LSM 510; Carl Zeiss, Inc., Thornwood, NY).
Clonogenic Assay. Cells (1 x 103) were plated in six-well plates and pretreated with or without hypoxic conditions for 24 h. Cells were treated with L-OddC or dFdC for one generation followed by an exchange with fresh culture medium. The colonies were counted after incubating 7 days and then stained with methylene blue. The results include the means and S.D. obtained from three independent experiments.
Metabolism of Nucleoside Analogs. The cells were treated with [3H]L-OddC at 500 nM (2 Ci/mmol) for 20 h and [3H]dFdC at 500 nM (2 Ci/mmol) for 2 h. For up-regulation of PGK, the open reading frame of PGK was cloned into pcDNA5/TO vector to form pcDNA5-PGK. The pcDNA5-PGK was transfected into RKO cells (5 µgof DNA/106 cells) using Lipofectamine 2000 (Invitrogen) for 48 h before hypoxic treatment. For down-regulation of PGK and HIF-1
, inducible shRNA cell lines were established as described previously (Lam et al., 2006
). The DNA targeting sequences for PGK was 5'GCTTCTGGGAACAAGGTTAAA3' and for HIF-1
, 5'TACGTTGTGAGTGGTATTATT3'. The cells were harvested in ice-cold phosphate-buffered saline containing 20 µM dipyridamole (Sigma) and extracted with 15% trichloroacetic acid for 10 min on ice. The supernatant containing the nucleoside and its phosphorylated forms was extracted with a 45:55 ratio of trioctylamine/1,1,2-trichlorotrifluoroethane. The trichloroacetic acid-insoluble pellet representing the nucleotide incorporated into the DNA was washed twice and resolubilized in dimethyl sulfoxide before evaluation using a scintillation counter (LS5000TD; Beckman Coulter, Fullerton, CA). The nucleoside analog metabolites were analyzed by high-pressure liquid chromatography (Shimadzu, Braintree, MA) connected to a detector (Radiomatic 150TR Flow Scintillation Analyzer; PerkinElmer Life and Analytical Sciences) using a Partisil SAX column (Whatman, Clifton, NJ). All results are means and standard deviations obtained from at least three experiments.
Chromatin Immunoprecipitation (ChIP) Assay to Study the Interaction of HIF-1
and PGK Promoter. The cells cultured under either normoxic or hypoxic conditions for 24 h were incubated with 1% formaldehyde at 37°C for 15 min. Cells were washed with ice-cold PBS and lysed in ChIP buffer (1% Triton X-100, 0.1% deoxycholate, 50 mM Tris 8.1, 150 mM NaCl, and 5 mM EDTA) followed by sonication to produce approximately 1 kilobase of DNA fragments. The samples were precleared with salmon sperm DNA-saturated protein A/G-agarose (Calbiochem, San Diego, CA) before a 24-h incubation with anti-HIF-1
antibody (BD Bioscience Pharmingen, Franklin Lakes, NJ) at 4°C. Salmon sperm DNA-saturated protein A/G-agarose was added to precipitate the protein-DNA complexes. The complexes were sequentially washed once with ChIP buffer, ChIP buffer containing 500 mM NaCl, and then LiCl wash buffer. The beads were washed twice with Tris-EDTA buffer before elution at 65°C in 1% SDS and Tris-EDTA buffer. Supernatants were incubated overnight at 65°C to reverse cross-links, and the DNA was purified using a gel extraction kit (QIAGEN, Valencia, CA). The presence of the PGK promoter DNA was determined by PCR. APE-1 promoter was used as the control. The sequences of PGK primer pairs were 5'-gaaggttccttgcggttc-3' (forward) and 5'-ctagtgagacgtgcggctt-3' (reverse), and the sequences of APE-1 primer pairs were 5'-gtctccgtcacgtggtgtcag-3' (forward) and 5'-ggttaggaggagctaggctg-3'(reverse).
Luciferase Reporter Assay. The DNA fragment with PGKHREx5 [(gccggacgtgacaaacgg)x5agatctagcggagactatagagggtatataagggcctcggcggcc] or controlx5 [(gccggaattgacaaacgg)x5agatctagcggagactatagagggtatataagggcctcggcggcc] was cloned into pGL4.20 vector (Promega, Madison, WI) via the NheI and HindIII restriction sites. The cells were transiently transfected for 24 h using the control-pGL4.20 vector or the PGK-HREx5-pGL4.20 vector with FuGENE6 transfection reagent (Roche, Indianapolis, IN). The cells were then incubated under normoxic and hypoxic conditions for 24 h. Transcriptional activity was determined by measuring the activity of firefly luciferase in a multiwell plate luminometer (Tecan, Durham, NC) using Luciferase Reporter Assay (Promega) according to the manufacturer's instructions.
Quantitative Real-Time PCR. Total RNA was isolated from HepG2 cells, Hep3B cells, Panc-1, and A673 using a high-pure RNA purification kit that includes a step of DNase treatment (Roche). The purified RNA was used as a negative control for indicating the absence of genomic DNA in the PCR reaction. The reverse-transcriptase reaction was performed using Platinum Quantitative RT-PCR ThermoScript One-Step System (Invitrogen), according to the manufacturer's instructions. Assays were performed using the iCycler iQ RealTime thermocycler detection system (Bio-Rad Laboratories). The primers and probes used for the quantitative real-time PCR are shown in Table 1.
|
Statistical Analysis. Data were analyzed by two-way analysis of variance (Prism 4 software; GraphPad Software, San Diego, CA), Student's t test (Microsoft Excel; Microsoft Corp., Redmond, WA), and one-way analysis of variance (GraphPad Prism 4). The difference was considered statistically significant at P < 0.05.
| Results |
|---|
|
|
|---|
Induction of HIF-1
in Tumor Cell Lines under Hypoxic Conditions (1% O2, 5% CO2, 94% N2). HIF-1
is the key isoform of the hypoxia-inducible factors for activating the transcription of most hypoxia-inducible genes, including PGK. We tested whether hypoxic conditions (1% O2, 5% CO2, 94% N2) could induce HIF-1
expression. As shown in Fig. 1A, HIF-1
was induced in different tumor cell lines after 24 and 48 h of hypoxic treatment. The basal levels of HIF-1
in different cell lines are very low under normoxic conditions. The induced HIF-1
was translocated into nuclei in different cell lines as shown in the immunofluorescence micrographs (Fig. 1B).
|
protein and the promoter region of PGK gene (–352 to – 264 base pairs, where two HRE sites could be identified), under hypoxic conditions (1% O2, 5% CO2, 94% N2) as determined by chromatin immunoprecipitation assay (Fig. 2B). Results from luciferase reporter assays indicated that the HRE of the PGK promoter mediates the transcriptional response to hypoxia (Fig. 2C). The results of the chromatin immunoprecipitation assay and the luciferase reporter assay suggest that the induction of PGK mRNA could be due to increased binding activity between the HIF-1
transcription factors and the HRE of the PGK promoter under hypoxic conditions. The effect of hypoxia on the levels and the subcellular distributions of PGK protein and APE-1 protein in different cell lines were also studied. Results from Western blotting indicated that the protein levels of only PGK and not APE-1 were induced approximately 2- to 3-fold in different cell lines (Fig. 2D). Immunofluorescence micrographs showed that hypoxia had no effect on the subcellular distributions of PGK protein, which was present mostly in cytoplasm, and the APE-1 protein, which was present in nuclei (Fig. 2E).
|
|
under normoxic conditions. The induction of HIF-1
by addition of 500 µM DMOG increased the PGK expression under normoxic conditions (Fig. 4E). DMOG also increased the level of L-OddCTP and the incorporation of L-OddC into DNA significantly (P < 0.05) (Fig. 4, F and G). The addition of DMOG under hypoxic conditions did not affect the level of L-OddCTP and the incorporation of L-OddC into DNA.
|
The Effect of Hypoxic Treatment on the mRNA Expression of Nucleoside Transporters hCNT1, hCNT2 hENT1, hENT2, and MRP5. Because hypoxic treatment decreased the uptake of dFdC that is dependent on nucleoside transporters, but not L-OddC, uptake of which is not dependent on nucleoside transporters (Gourdeau et al., 2001
), we examined whether hypoxic treatment affected the mRNA expression of nucleoside transporters, which can reflect the protein level to some extent. RT-PCR results indicated that the mRNA expression of hENT1, hENT2, and hCNT2 was repressed to different extents in different cell lines after hypoxic treatment from 24 to 48 h (Fig. 5A). The mRNA expression of hENT1 decreased approximately 50% in different cell lines under hypoxic conditions. The mRNA expression of hENT2 decreased by 50% in Hep3B cells and only 20% in the other three cell lines. The mRNA expression of hCNT2 decreased by 70% in HepG2 and Hep3B and 50 to 60% in Panc-1 and A673 cells under hypoxic conditions (Fig. 5B). The mRNA expression of hCNT1 and MRP5 was not affected by hypoxic treatment. Under hypoxic conditions, the underexpression of hENT1, hENT2, and hCNT2 decreased on thymidine uptake and incorporation in Panc-1 cells (Supplemental Fig. 2).
|
|
DMOG (500 µM; showing no cytotoxicity up to 2 mM) induced expression of HIF-1
and PGK, and increased the level of L-OddCTP and the incorporation of L-OddC into DNA (Fig. 4, E–G), and also sensitized Panc-1 cells to L-OddC approximately 2.8-fold under normoxic conditions (Table 2). The importance of PGK and HIF-1
in L-OddC cytotoxicity under normoxic and hypoxic conditions was further demonstrated in RKO cells. First, overexpression of PGK using transient transfection increased the level of L-OddCTP and the incorporation of L-OddC into DNA but not dFdC under normoxic conditions (Supplemental Figs. 5–7). The overexpression of PGK also sensitized RKO cells to L-OddC approximately 1.6-fold but not dFdC under normoxic conditions (Table 2). The transient transfection of PGK did not further increase the cytotoxicity of L-OddC under hypoxic conditions; perhaps the level of PGK had reached the maximum level under hypoxic conditions. Second, down-regulation of HIF-1
using shRNA by adding doxycycline decreased the levels of PGK and L-OddCTP and the incorporation of L-OddC into DNA but not that of dFdC under hypoxic conditions (Supplemental Figs. 5–7). The knockdown of HIF-1
reduced the cytotoxicity of L-OddC approximately 1.6-fold but not that of dFdC under hypoxic conditions (Table 2). Third, down-regulation of PGK using shRNA by adding doxycycline decreased the PGK level and L-OddCTP and incorporation of L-OddC into DNA but not that of dFdC under normoxic and hypoxic conditions, respectively (Supplemental Figs. 5–7). The knockdown of PGK reduced the cytotoxicity of L-OddC approximately 1.4- and 1.8-fold under normoxic and hypoxic conditions, respectively (Table 2).
| Discussion |
|---|
|
|
|---|
We showed that the induction of PGK in different solid tumor cell lines, including HepG2, Hep3B, A673, Panc-1, RKO, KB, and HeLa (results not shown) under hypoxic conditions are under the control of HIF-1
. Along with other reports, the induction of PGK under hypoxic conditions is a common phenomenon. When we compared the cytotoxicity of L-OddC and dFdC in HepG2, Hep3B, A673, Panc-1, and RKO cells under normoxic and hypoxic conditions, we found that the tumor cells were sensitized to L-OddC to different extents depending on the different cell types under hypoxic conditions but not to dFdC. The results from the metabolism of L-OddC demonstrated that the increase in sensitivity to L-OddC was due to the increase of L-OddCTP formation and L-OddC incorporation into DNA under hypoxic conditions. Our results also indicate that hypoxic conditions in culture do not alter the expression of APE-1, which preferentially excises L-OddCMP and misincorporated nucleotides from the 3'-termini of DNA in all of these cell types. Under normoxic conditions, DMOG induced PGK through the stabilization of HIF-1
and sensitized Panc-1 cells to L-OddC. This result suggests that the change in the cellular redox status under hypoxic conditions is not the primary factor in the cytotoxicity of L-OddC. Furthermore, the cytotoxicity of L-OddC in RKO cells correlates with the expression level of PGK in both normoxic and hypoxic conditions and to the level of HIF-1
under hypoxic conditions. Collectively, our results demonstrate that hypoxia can induce PGK expression through the control of HIF-1
and causes sensitization of tumor cells to L-OddC in culture. These findings provide a rationale for clinical development of L-OddC as a treatment for solid tumors, because clinical reports indicate that the development of hypoxia resulting in the expression of HIF-1
in solid tumors is common (Brown and Wilson, 2004
). Hypoxia may be the reason for the overexpression of PGK in some solid tumors [e.g., pancreatic ductal adenocarcinoma (Hwang et al., 2006
), HER-2/neu-positive breast tumors (Zhang et al., 2005
) and lung adenocarcinoma (Chen et al., 2003
)]. Because most renal cell carcinomas have defects in the von Hippel-Lindau gene and HIF-1
and its downstream proteins are continuously overexpressing (Patel et al., 2006
), testing of the sensitivity of L-OddC in renal cell carcinomas is under investigation.
It is noteworthy that dFdC uptake was severely reduced under hypoxic conditions, but not L-OddC uptake, which is not dependent upon the nucleoside transporters (Gourdeau et al., 2001
). We studied the effect of hypoxia on the mRNA expression of the nucleoside transporters. Our results indicate that mRNA expression of hENT1, hENT2, and hCNT2 in different cell lines can be repressed to different extents. The expression of hCNT1 and MRP5, however, were not repressed. These results could partially explain the decrease in dFdC uptake in Panc-1 cells. This is consistent with recent reports stating that hypoxia can repress the expression of hENT1 and/or hENT2 in different cell lines [i.e., human microvascular endothelial cells (Eltzschig et al., 2005
) and human umbilical vein endothelial cells (Casanello et al., 2005
)]. Clinical reports indicate that decreased expression of hENT1 can be correlated with treatment failure of dFdC in cancers, including mantle cell lymphoma (Marcé et al., 2006
), pancreatic cancer (Spratlin et al., 2004
; Giovannetti et al., 2006
), and non–small-cell lung cancer (Achiwa et al., 2004
). Because hENT1, hENT2, and hCNT2 are also involved in the uptake of many other anti-cancer nucleoside analogs [i.e., arabinofuranosyladenine, arabinosylcytosine, 5'-deoxy-5-fluorouridine (Kong et al., 2004
and Podgorska et al., 2005
; Hubeek et al., 2005
), and clofarabine (King et al., 2006
)], hypoxia is likely to be a key factor contributing to the anti-cancer nucleoside analog resistance via the down-regulation of nucleoside transporters. Currently, the combined use of anticancer nucleosides and antiangiogenic compounds that are likely to increase the hypoxic status in tumors are being tried in the clinic. Based on our findings, we suggest that anticancer nucleosides in which uptake is dependent on the nucleoside transporters should be applied before antiangiogenic compounds. The retention of these nucleosides may be increased because antiangiogenic compounds may induce hypoxia and reduce the expression of nucleoside transporters. However, in the clinical trials of L-OddC, the antiangiogenic compounds should be applied before L-OddC to create more hypoxic conditions and thereby induce the expression of PGK. In conclusion, hypoxia is an important factor that may potentiate the activity of L-OddC.
| Acknowledgements |
|---|
| Footnotes |
|---|
Y.-C.C. is one of the inventors of L-OddC (troxacitabine) which was licensed to SGX Pharm by Yale University for the treatment of cancer. Y.-C.C. could have a financial stake in this compound.
Article, publication date, and citation information can be found at http://molpharm.aspetjournals.org.
ABBREVIATIONS: L-OddC,
-L-dioxolane-cytidine (troxacitabine); dFdC,
-D-2',2'-difluorodeoxycytidine (gemcitabine); PGK, phosphoglycerate kinase; APE-1, apurinic/apyrimidinic endonuclease; dCK, deoxycytidine kinase; hENT, human equilibrative nucleoside transporter; hCNT, human concentrative nucleoside transporter; HRE, hypoxia response element; DMOG, dimethyloxallyl glycine; shRNA, short hairpin RNA; PBS, phosphate-buffered saline; HIF-1
, hypoxia-inducible factor-1
; ChIP, chromatin immunoprecipitation; RT-PCR, reverse transcription-polymerase chain reaction.
The online version of this article (available at http://molpharm.aspetjournals.org) contains supplemental material. ![]()
Address correspondence to: Dr. Yung-Chi Cheng, Department of Pharmacology, Yale University School of Medicine, New Haven, CT 06520. E-mail: yccheng{at}yale.edu
| References |
|---|
|
|
|---|
Brown JM and Wilson WR (2004) Exploiting tumour hypoxia in cancer treatment. Nat Rev Cancer 4: 437–447.[CrossRef][Medline]
Casanello P, Torres A, Sanhueza F, Gonzalez M, Farias M, Gallardo V, Pastor-Anglada M, San Martin R and Sobrevia L (2005) Equilibrative nucleoside transporter 1 expression is downregulated by hypoxia in human umbilical vein endothelium. Circ Res 97: 16–24.
Chen G, Gharib TG, Wang H, Huang CC, Kuick R, Thomas DG, Shedden KA, Misek DE, Taylor JM, Giordano TJ, Kardia SL, Iannettoni MD, Yee J, Hogg PJ, Orringer MB, Hanash SM, and Beer DG (2003) Protein profiles associated with survival in lung adenocarcinoma Proc Natl Acad Sci U S A 100: 13537–13542.
Chou KM, Kukhanova M, and Cheng YC (2000) A novel action of human apurinic/apyrimidinic endonuclease: excision of L-configuration deoxyribonucleoside analogs from the 3' termini of DNA. J Biol Chem 275: 31009–31015.
Daly EB, Wind T, Jiang XM, Sun L, and Hogg PJ (2004) Secretion of phosphoglycerate kinase from tumour cells is controlled by oxygen-sensing hydroxylases. Biochim Biophys Acta 1691: 17–22.[Medline]
Eltzschig HK, Abdulla P, Hoffman E, Hamilton KE, Daniels D, Schonfeld C, Loffler M, Reyes G, Duszenko M, Karhausen J, Robinson A, Westerman KA, Coe IR, and Colgan SP (2005) HIF-1-dependent repression of equilibrative nucleoside transporter (ENT) in hypoxia. J Exp Med 202: 1493–1505.
Giles FJ, Garcia-Manero G, Cortes JE, Baker SD, Miller CB, O'Brien SM, Thomas DA, Andreeff M, Bivins C, Jolivet J, and Kantarjian HM (2002) Phase II study of troxacitabine, a novel dioxolane nucleoside analog, in patients with refractory leukemia. J Clin Oncol 20: 656–664.
Giovannetti E, Del Tacca M, Mey V, Funel N, Nannizzi S, Ricci S, Orlandini C, Boggi U, Campani D, Del Chiaro M, Iannopollo M, Bevilacqua G, Mosca F, and Danesi R (2006) Transcription analysis of human equilibrative nucleoside transporter-1 predicts survival in pancreas cancer patients treated with gemcitabine. Cancer Res 66: 3928–3935.
Gourdeau H, Clarke ML, Ouellet F, Mowles D, Selner M, Richard A, Lee N, Mackey JR, Young JD, Jolivet J, Lafreniere RG, and Cass CE (2001) Mechanisms of uptake and resistance to troxacitabine, a novel deoxycytidine nucleoside analogue, in human leukemic and solid tumor cell lines. Cancer Res 61: 7217–7224.
Gourdeau H, Leblond L, Hamelin B, Dong K, Ouellet F, Boudreau C, Custeau D, Richard A, Gilbert MJ, and Jolivet J (2004) Species differences in troxacitabine pharmacokinetics and pharmacodynamics: implications for clinical development. Clin Cancer Res 10: 7692–7702.
Grove KL and Cheng YC (1996) Uptake and metabolism of the new anticancer compound beta-L-(-)-dioxolane-cytidine in human prostate carcinoma DU-145 cells. Cancer Res 56: 4187–4191.
Grove KL, Guo X, Liu SH, Gao Z, Chu CK, and Cheng YC (1995) Anticancer activity of beta-L-dioxolane-cytidine, a novel nucleoside analogue with the unnatural L configuration. Cancer Res 55: 3008–3011.
Hatzis P, Al-Madhoon AS, Jullig M, Petrakis TG, Eriksson S, and Talianidis I (1998) The intracellular localization of deoxycytidine kinase. J Biol Chem 273: 30239–30243.
Hubeek I, Stam RW, Peters GJ, Broekhuizen R, Meijerink JP, van Wering ER, Gibson BE, Creutzig U, Zwaan CM, Cloos J, Kuik DJ, Pieters R, and Kaspers GJ (2005) The human equilibrative nucleoside transporter 1 mediates in vitro cytarabine sensitivity in childhood acute myeloid leukaemia. Br J Cancer 93: 1388–1394.[CrossRef][Medline]
Hwang TL, Liang Y, Chien KY, and Yu JS (2006) Overexpression and elevated serum levels of phosphoglycerate kinase 1 in pancreatic ductal adenocarcinoma. Proteomics 6: 2259–2272.[CrossRef][Medline]
Kim HO, Shanmiganathan K, Alves AJ, Jeong LS, Beach JW, Schinazi RF, Chang CN, Cheng YC, and Chu CK (1992) Potent anti-HIV and anti-HBV activities of (–)-L-
-dioxolane-C and (+)-D-
-dioxolane-T and their asymmetric syntheses. Tetrahedron Lett 33: 6899–6902.[CrossRef]
King KM, Damaraju VL, Vickers MF, Yao SY, Lang T, Tackaberry TE, Mowles DA, Ng AM, Young JD, and Cass CE (2006) A comparison of the transportability, and its role in cytotoxicity, of clofarabine, cladribine, and fludarabine by recombinant human nucleoside transporters produced in three model expression systems. Mol Pharmacol 69: 346–353.
Kong W, Engel K, and Wang J (2004) Mammalian nucleoside transporters. Curr Drug Metab 5: 63–84.[CrossRef][Medline]
Kress S, Stein A, Maurer P, Weber B, Reichert J, Buchmann A, Huppert P, and Schwarz M (1998) Expression of hypoxia-inducible genes in tumor cells. J Cancer Res Clin Oncol 124: 315–320.[CrossRef][Medline]
Krishnan P, Fu Q, Lam W, Liou JY, Dutschman G, and Cheng YC (2002a) Phosphorylation of pyrimidine deoxynucleoside analog diphosphates: selective phosphorylation of L-nucleoside analog diphosphates by 3-phosphoglycerate kinase. J Biol Chem 277: 5453–5459.
Krishnan P, Liou JY, and Cheng YC (2002b) Phosphorylation of pyrimidine L-deoxynucleoside analog diphosphates. Kinetics of phosphorylation and dephosphorylation of nucleoside analog diphosphates and triphosphates by 3-phosphoglycerate kinase. J Biol Chem 277: 31593–31600.
Krishnan P, Gullen EA, Lam W, Dutschman GE, Grill SP, and Cheng YC (2003) Novel role of 3-phosphoglycerate kinase, a glycolytic enzyme, in the activation of L-nucleoside analogs, a new class of anticancer and antiviral agents. J Biol Chem 278: 36726–36732.
Kukhanova M, Liu SH, Mozzherin D, Lin TS, Chu CK, and Cheng YC (1995) L- and D-enantiomers of 2',3'-dideoxycytidine 5'-triphosphate analogs as substrates for human DNA polymerases. Implications for the mechanism of toxicity. J Biol Chem 270: 23055–23059.
Lam W, Park SY, Leung CH, and Cheng YC (2006) Apurinic/apyrimidinic endonuclease-1 protein level is associated with the cytotoxicity of L-configuration deoxycytidine analogs (troxacitabine and
-L-2',3'-dideoxy-2',3'-didehydro-5-fluorocytidine) but not D-configuration deoxycytidine analogs (gemcitabine and
-D-arabinofuranosylcytosine). Mol Pharmacol 69: 1607–1614.
Lapointe R, Letourneau R, Steward W, Hawkins RE, Batist G, Vincent M, Whittom R, Eatock M, Jolivet J, and Moore M (2005) Phase II study of troxacitabine in chemotherapy-naive patients with advanced cancer of the pancreas: gastrointestinal tumors. Ann Oncol 16: 289–293.
Liou JY, Dutschman GE, Lam W, Jiang Z, and Cheng YC (2002) Characterization of human UMP/CMP kinase and its phosphorylation of D- and L-form deoxycytidine analogue monophosphates. Cancer Res 62: 1624–1631.
Marcé S, Molina-Arcas M, Villamor N, Casado FJ, Campo E, Pastor-Anglada M, and Colomer D (2006) Expression of human equilibrative nucleoside transporter 1 (hENT1) and its correlation with gemcitabine uptake and cytotoxicity in mantle cell lymphoma. Haematologica 91: 895–902.
Okino ST, Chichester CH, and Whitlock JP Jr. (1998) Hypoxia-inducible mammalian gene expression analyzed in vivo at a TATA-driven promoter and at an initiator-driven promoter. J Biol Chem 273: 23837–23843.
Patel PH, Chadalavada RS, Chaganti RS, and Motzer RJ (2006) Targeting von Hippel-Lindau pathway in renal cell carcinoma. Clin Cancer Res 12: 7215–7220.
Podgorska M, Kocbuch K, and Pawelczyk T (2005) Recent advances in studies on biochemical and structural properties of equilibrative and concentrative nucleoside transporters. Acta Biochim Pol 52: 749–758.[Medline]
Spratlin J, Sangha R, Glubrecht D, Dabbagh L, Young JD, Dumontet C, Cass C, Lai R, and Mackey JR (2004) The absence of human equilibrative nucleoside transporter 1 is associated with reduced survival in patients with gemcitabine-treated pancreas adenocarcinoma. Clin Cancer Res 10: 6956–6961.
Zhang D, Tai LK, Wong LL, Chiu LL, Sethi SK, and Koay ES (2005) Proteomic study reveals that proteins involved in metabolic and detoxification pathways are highly expressed in HER-2/neu-positive breast cancer. Mol Cell Proteomics 4: 1686-1696.
This article has been cited by other articles:
![]() |
W. Lam, S. Bussom, and Y.-C. Cheng Effect of hypoxia on the expression of phosphoglycerate kinase and antitumor activity of troxacitabine and gemcitabine in non-small cell lung carcinoma Mol. Cancer Ther., February 1, 2009; 8(2): 415 - 423. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||