|
|
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Laboratory for Oncogenomic Research, Departments of Pediatrics (K.T., H.J., K.H., M.W., D.W.Y., A.L.S., S.E.D.), Experimental Medicine (Y.Z., C.L., S.E.D.), and Medical Genetics (J.W., S.E.D.), Child and Family Research Institute, University of British Columbia, Vancouver, British Columbia, Canada; Applied Medical Engineering, Helmholtz Institute, RWTH Aachen University, Aachen, Germany (U.K.); Departments of Nephrology and Clinical Immunology, University Hospital Aachen, RWTH Aachen, Aachen, Germany (P.R.M.); Division of Medical Chemistry and Pharmacognosy, the Ohio State University, Columbus, Ohio (C.S.C.); Department of Advanced Therapeutics, British Columbia Cancer Agency, Vancouver, British Columbia, Canada (M.B., D.Y.)
Received March 14, 2007; accepted June 26, 2007
| Abstract |
|---|
|
|
|---|
The epidermal growth factor receptor (EGFR, or Her-1) is a molecular marker for BLBC, in which it is highly expressed in more than half of the tumors in this subtype (Nielsen et al., 2004
). EGFR belongs to a family of tyrosine kinase receptors (Her-1, -2, -3, and -4) that are involved in tumor cell growth. It is noteworthy that EGFR is not only important in BLBC but also plays an essential role in mediating Her-2-driven breast cancer. In this breast cancer subtype, the significance of EGFR lies in the fact that Her-2 does not have its own ligand, which is required for its activation. Rather, Her-2 relies on forming a heterodimer with EGFR to trigger signal transduction (Yarden, 2001
). Thus, EGFR is integral for promoting the growth of BLBC and Her-2-expressing breast cancers.
YB-1 is overexpressed in various human cancers and has been consistently associated with their increased growth potential (Kuwano et al., 2003
). In the context of breast cancer, YB-1 is preferentially expressed in breast tumors over normal ductal epithelial cells (Bargou et al., 1997
). It stimulates the proliferation of preneoplastic breast cancer cells, and mice that express YB-1 in their mammary glands all develop invasive tumors (Bergmann et al., 2005
). We determined recently that YB-1 is associated with EGFR by screening primary breast tumor tissue microarrays (Wu et al., 2006
). YB-1 is also expressed in approximately 73% of BLBC (A. L. Stratford, G. Habibi, H. Jiang, K. Hu, A. Shadeo, T. P. H. Buys, W. Lam, T. Pugh, M. Marru, T. O. Nielsen, et al., submitted for publication). This builds on our previous work in breast cancer cell lines demonstrating that YB-1 must be phosphorylated to induce EGFR. Furthermore, we showed that YB-1 is a direct substrate of the serine/threonine kinase Akt. Upon growth factor stimulation, phosphoinositide dependent kinase-1 (PDK-1) activates Akt, thereby phosphorylating YB-1 at Ser102 within the DNA binding domain (Sutherland et al., 2005
). The loss of Ser102 by site-directed mutagenesis attenuates YB-1's ability to bind to the EGFR promoter (Wu et al., 2006
). Collectively, these data indicate that the Akt pathway is important for regulating the nuclear functions of YB-1. This prompted us to examine the ability to regulate BLBC EGFR overexpression through the disruption of YB-1 activation by the Akt kinase.
We reported previously that OSU-03012 inhibits the Akt pathway (Crowder and Ellis, 2005
; Kucab et al., 2005
). The OSU-03012 compound was derived from the cyclooxygenase-2 inhibitor celecoxib and was structurally optimized in PDK-1 inhibition (Zhu et al., 2004
). This compound blocks Akt but not the mitogen-activated protein kinase or p38 pathways (Kucab et al., 2005
). An attractive feature of the inhibitor is that it has demonstrated activity against a wide range of cancer cell lines. In a screen of 60 cancer cell lines conducted at the National Cancer Institute (Bethesda, MD), OSU-03012 inhibited tumor cell growth with an IC50 = 2 µM (Zhu et al., 2004
). OSU-03012 can also overcome Herceptin (Tseng et al., 2006
) and Gleevec (Tseng et al., 2005
) resistance, at least in part, by decreasing the Akt signaling pathway (Tseng et al., 2006
). We therefore embarked on the possibility that OSU-03012 could be used to control YB-1 action by addressing whether it could inhibit the expression of the YB-1-responsive gene EGFR.
| Materials and Methods |
|---|
|
|
|---|
Western Blotting. Cells were harvested at 80% confluence by trypsin-EDTA (Invitrogen), lysed in an egg lysis buffer as described previously (Wu et al., 2006
), and then lysates were sheared through a 21-gauge needle and quantified using the Bradford assay (Bradford, 1976
). Proteins extracts (50 µg/lane) were separated on a 12% SDS-polyacrylamide gel and transferred to a nitrocellulose membrane at 100 V for 2 h at room temperature. The membranes were blocked with 5% milk in PBS/0.1% Tween (PBST) for 1 h at room temperature before they were probed with primary antibodies overnight at 4°C. Primary antibodies were used at the following concentrations (all diluted in 5% BSA in PBST): anti-Her-2 (1:1000; Cell Signaling Technology, Danvers, MA), anti-ER (1:500; Santa Cruz Biotechnology, Santa Cruz, CA), anti-PR (1:1000; Santa Cruz Biotechnology), anti-CK5/6 (1:1000; Chemicon, Temecula, CA), rabbit polyclonal anti-phospho-YB-1(Ser102) [1:2000; designed against the serine 102 phosphorylation site of YB-1 protein (KYLRpSVGDGE-C); a generous gift from Dr. Peter Mertens, University Hospital Aachen, RWTH Aachen, Aachen, Germany], anti-total YB-1 (1:10,000; a C-terminal polyclonal antibody; a generous gift from Dr. Colleen Nelson, University of British Columbia, Vancouver, BC, Canada), anti-EGFR (1:275; StressGen, San Diego, CA), anti-phospho-PDK-1 (1:1000), anti-phospho-AktThr308 (1:200), anti-phospho-AktSer473 (1:1000), anti-total-Akt (1:1000), anti-phospho-S6 kinase, anti-phospho-S6 ribosomal protein (1:1000), anti-total-S6 ribosomal protein (1:500; all from Cell Signaling Technology), and anti-vinculin (1:1000; Sigma). After washing in PBST, the membranes were incubated in either a horseradish-peroxidase-conjugated mouse (1:5000) or rabbit (1:2000) IgG antibody (GE Healthcare, Chalfont St. Giles, Buckinghamshire, UK) in 5% milk in PBST for 1 h at room temperature. Images were visualized using the ECL Plus Western blotting detection reagents (GE Healthcare). Vinculin was used as the loading control.
Chromatin Immunoprecipitation. Cell lines MDA-MB-468 and SUM 149 were plated at a density of 1 x 107/150 mm dish and allowed to attach overnight. They were then incubated in the presence of OSU-03012 at 10 µM or DMSO vehicle control for 5 to 9 h and cross-linked with 1% formaldehyde for chromatin immunoprecipitation (ChIP). The YB-1 promoter complexes were isolated as described previously (Wu et al., 2006
). The primers to the "1b" and "2a" YB-1 binding sites in the EGFR promoter were also described previously (Wu et al., 2006
). Purified immunoprecipitated DNA was eluted in 40 µl of sterile, DNase/RNase-free deionized water, and 6 µl was used as template for PCR reaction as described previously (Wu et al., 2006
). Input DNA was diluted 10 times before PCR amplification. GAPDH forward 5'-ATGACATCAAGAAGGTGGTG-3' and reverse 5' CATACCAGGAAATGAGCTTG-3' primers were used to amplify a 177-base pair fragment spanning exons 8 and 9 of the GAPDH gene in the input DNA from the three different cell lines, 184htrt, MDA-MB-468, and SUM 149, to determine that equal cell numbers had been used in the ChIP experiments.
Electrophoretic Mobility Shift Assay. Nuclear and cytoplasmic protein was extracted from log-growing SUM 149 cells using the NE-PER nuclear and cytoplasmic extraction reagents (Pierce Biotechnology, Rockford, IL) following the manufacturer's protocol. In brief, cells were centrifuged to obtain a packed cell volume and lysed in ice-cold CER I with protease inhibitors. After incubation on ice for 5 min, ice-cold CER II was added, and samples were centrifuged at 13,000g for 10 min. Cytoplasmic protein was retained, and the pellet was resuspended in ice-cold NER with protease inhibitors. The sample was incubated on ice for 40 min with frequent mixes and then centrifuged at 13,000g for 10 min. The supernatant containing nuclear protein was stored. Proteins were quantified using the Bradford Assay. Electrophoretic mobility shift assays were carried out using the Lightshift Chemiluminescent electrophoretic mobility shift assay kit (Pierce Biotechnology), following the manufacturer's protocol. 5'-Biotin-labeled complementary oligonucleotides with the sequence TTCACACATTGGCTTCAAAGTACCCATGGCTGGTTGCAATAAACAT (–979 to –937), corresponding to the EGFR "2a" sequence, were annealed to form double-stranded DNA. Binding reactions consisted of 1x binding buffer, 50 ng/µl poly(dI-dC), 20 fmol biotin-labeled DNA, and 10 µg of nuclear protein in a 20-µl reaction. In the competition reaction, the protein was first incubated with 16 pmol concentration of the unlabeled oligonucleotide for 20 min. Samples were subsequently incubated in the binding reaction mix for 20 min at room temperature. For the supershift controls, anti-YB-1 (20 µg; anti-chicken antibody from Dr. Isabella Berquin, Wake Forest University, Winston-Salem, NC) or Creb (20 µg; Cell Signaling Technology) was incubated with 10 µg of nuclear extracts from DMSO-treated cells. The reaction mixture was run on a 6% nondenaturing polyacrylamide gel and transferred to positively charged nylon membrane (Amersham Biosciences). DNA was cross-linked to the membrane at 120 mJ/cm2 using the Stratalinker UV light cross-linker (Stratagene, La Jolla, CA) and detected using chemiluminescence (Pierce Biotechnology).
Real-Time Quantitative Reverse Transcription-PCR. RNA was isolated from SUM 149 cells grown in log phase using the QIAGEN RNeasy Mini kit (QIAGEN Canada, Inc., Mississauga, ON, Canada). The RNA was reverse-transcribed and amplified using EGFR, proliferating nuclear antigen (PCNA), or topoisomerase II (TOPO-II)-specific primers and probes (Applied Biosystems, Foster City, CA). TATA box binding protein mRNA was quantified as a housekeeping gene (Applied Biosystems). Each sample was analyzed in triplicate on three separate occasions.
PDK-1 siRNA Gene Knockdown. The siRNA transfection protocol closely followed the QIAGEN HiPerFect Transfection Reagent Handbook (http://www1.qiagen.com/HB/HiPerFectTransfectionReagent_EN) protocol for reverse transfection of adherent cells with siRNA in six-well plates (QIAGEN). We used the QIAGEN Negative Control siRNA and the QIAGEN Hs_PDPK1_8 HP and Hs_ PDPK1_9 HP validated siRNAs for PDK-1 gene knockdown. SUM 149 cells were seeded shortly before transfection at 6 x 105 cells/well of a six-well plate in 2.3 ml of SUM 149 cell media and incubated under normal growth conditions. PDK-1 and negative control siRNA (20 nM) were diluted in 100 µl of medium without serum, and 12 µl of HiPerFect transfection reagent was added subsequently. siRNA and the transfection reagent were mixed by vortexing, and samples were incubated at room temperature for 10 min. The siRNA complexes were then added drop-wise to the cells and incubated under normal growth conditions for 96 h. Cells were harvested for protein extraction 96 h later.
3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyl Tetrazolium Bromide in Vitro Cytotoxicity and Soft Agar Assays. MDA-MB-468 and SUM 149 cells were plated in 96-well plates at 1 x 104 and 5 x 103 cells/well, respectively, and incubated for 24 h at 37°C in their normal culture conditions. Cells were treated with OSU-03012 for 24 h at 0, 2.5, 5, and 10 µM in 96-well plates with six replicates per dose. DMSO was used as vehicle control. After 24 h, culture media were removed from the cells and replaced with 120 µl of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide complex solution (Promega, Madison, WI) and incubated at 37°C for 60 min. Plates were shaken and absorbance read at 490 nm for 0.1 s. For the soft agar assays, the MDA-MB-468 and SUM 149 cells were plated at a density of 3 x 105 and 1 x 105 cells/well, respectively, in 0.6% agar containing either DMSO or OSU-03012 (2.5, 5, or 10 µM) as described previously (Sutherland et al., 2005
). Colonies developed over 21 or 30 days for MDA-MB-468 and SUM 149, respectively, at which time they were measured using ImageQuant software (GE Healthcare, Chalfont St. Giles, Buckinghamshire, UK). We only considered colonies larger than 150 µm in diameter. Each experiment was performed in replicates of three and repeated twice.
Analysis of Apoptotic Induction in the SUM 149 Cells Using the ArrayScan Reader. To understand the fate of the SUM 149 cells after drug treatment, we established a multichannel high-content screening (HCS) protocol to simultaneously measure different aspects of apoptosis. Using the ArrayScan VTI (Cellomics, Pittsburgh, PA), we first established that PDK-1 was activated by developing a simple immunofluorescence method to detect phosphorylated PDK-1. SUM 149 cells were seeded in 96-well plates in Ham's F-12 medium (Invitrogen) supplemented with 5% fetal bovine serum and incubated (37°C, 5% CO2) for 48 h. Immediately after aspirating the medium, 100 µl of 2% paraformaldehyde in PBS was added, and the cells were kept at room temperature (RT) for 20 min. After washing with PBS three times, the cells were permeabilized in 0.1% Triton X-100 in PBS for 15 min followed by 1% BSA in PBS for 30 min. The cells were then incubated with rabbit anti-phospho-PDK-1 antibody diluted 100x (Cell Signaling Technology) overnight at 4°C followed by the secondary goat anti-rabbit antibody conjugated with Fluro488 diluted 200x (Invitrogen) for 1 h at room temperature. The nuclei of the cells were stained in Hoechst dye (100 µlat1 µg/ml) for 5 min. The cells were washed with PBS three times after each of the steps mentioned above. The images were taken on an ArrayScan VTI Reader (Cellomics). The control cells were treated as above; however, there was no primary antibody added. Once we established that PDK-1 was indeed activated under the culture conditions used, we established a screen for apoptosis indices after exposure to OSU-03012. SUM 149 cells were seeded in 96-well plates (Collagen I-coated; BD Biosciences, San Jose, CA) at 5000 cells/well in 100 µlof Ham's F-12 medium (Invitrogen) supplemented with 5% fetal bovine serum. We found that the Collagen I-coated plates provide two advantages. The first advantage was that this two-dimensional culture system was more representative of the epithelial-stromal environment that breast cancer cells would normally encounter. Collagen I was selected because it constitutes one of the most abundant extracellular matrix proteins in the breast (Provenzano et al., 2006
). Second, the cells attached to the plates better when plated on collagen I, which was a particular benefit because there are several wash steps in the protocol that otherwise caused significant variability because of cell detachment. The plates were incubated at 37°C with 5% CO2 for 24 h. OSU-03012, dissolved in DMSO, was diluted in the medium and added accordingly (100 µl/well) to each well to give final drug concentrations of 0 (DMSO only), 2.5, and 5 µM (total volume, 200 µl/well). There were three replicate wells for each treatment. Thirty minutes before each endpoint (2, 6, or 24 h), 20 µl of Hoechst and propidium iodide (PI) solutions were added to each well to give a final concentration of 1 µg/ml of each dye in the medium. After 30-min incubation, the medium was aspirated, and the cells were gently washed with PBS three times. The cells were then fixed in 2% paraformaldehyde in PBS for 20 min and permeabilized in 0.1% Triton X-100 in PBS for 15 min. After blocking in 1% BSA in PBS for 30 min, the cells were incubated with primary mouse anti-phospho-H2AX antibody (Abcam Inc., Cambridge, MA) diluted 100x for 1 h at RT followed by secondary donkey anti-mouse antibody (FITC; Jackson ImmunoResearch Laboratories Inc., West Grove, PA) diluted 200x for 1 h at RT. The cells were washed with PBS three times after each step mentioned above and were finally kept in PBS (100 µl/well) at 4°C. The plates were analyzed and the images taken on the ArrayScan Reader. Six hundred cells were analyzed for each replicate well, and the results were presented as a mean ± S.D. Repeated tests (n = 3) showed identical results.
OSU-03012 Dosing in Vivo. SCID/Rag2m mice (6–8 weeks old, female) were subcutaneously injected with 1 x 107 MDA-MB-435/LCC6 cells (gift from Dr. Robert Clark, Georgetown University, Washington, DC) stably transfected previously with HER-2/neu in our laboratories (Dragowska et al., 2004
). Each mouse was inoculated with the cells on the right and left sides of the lower back. A total of eight mice were injected, each harboring two tumors. After 6 weeks, the mice were randomly assigned into groups (vehicle, 0.5% methyl cellulose/0.1% Tween 80, or OSU-03012 at 200 mg/kg/day). Mice were dosed daily for 3 days with either the vehicle or OSU-03012 by oral gavage. On the fourth day, the study was terminated, mice were sacrificed, and the tumors were collected for ChIP and protein isolations. The proteins were isolated in ELB buffer using a Dounce homogenizer and then analyzed for EGFR. ChIP was performed on the tumors (25% of total tumor mass) by cross-linking the tissue in 1% formaldehyde for 20 min. The tissues were minced and homogenized using a Dounce homogenizer and subsequently processed for ChIP as described above using the chicken anti-human YB-1 antibody. Input DNA was normalized for differences in extraction. The relative amounts of DNA were determined by spectrophotometry. P-Akt was evaluated by immunohistochemistry as described previously by us (Sutherland et al., 2005
) using a contract service (Wax-it, Vancouver, BC, Canada). The tumors were considered positive if greater than or equal to 50% of the cells stained for P-Akt. The levels of glucose in mouse plasma was determined using the UltraSoft blood glucose monitoring system (OneTouch; LifeScan, Milpitas, CA); 5 µl of blood from the mouse was obtained from the tail vein of the animal (tail nick) and spotted onto test strips; glucose levels were determined by the meter. Before each set of readings, the meter was calibrated with control solutions provided by the manufacturer. The meter provides glucose levels as milligrams of glucose per deciliter and is calibrated for glucose concentrations within 20–600 mg/dl of blood plasma.
| Results |
|---|
|
|
|---|
|
|
PDK-1 Inhibitor OSU-03012 Disrupts Akt Signaling and Prevents YB-1 from Binding to the EGFR Promoter. After incubation with the compound at 10 µM for 6 h, both MDA-MB-468 and SUM 149 cell lines were exposed to OSU-03012 (10 µM) for 6 h, and as expected the drug decreased levels of phosphorylated Akt at threonine-308 (the PDK-1 phosphorylation site) and the serine 473 residue, whereas total Akt protein levels remained unchanged (Fig. 3A). Likewise, S6 ribosomal protein was inhibited. It is noteworthy that we found that OSU-03012 inhibited phosphorylation of YB-1 at Ser102 using a newly developed antibody (Fig. 3B). The specificity of the P-YB-1(Ser102) antibody was confirmed by showing an induction of phosphorylation in MDA-MB-231 cells after IGF-1 stimulation (Fig. 3B). This is consistent with our previous studies showing that IGF-1 stimulation in those cells caused Akt to bind to and phosphorylate YB-1 (Sutherland et al., 2005
). To further demonstrate the specificity of the antibody, MCF-7 Flag:YB-1 cell lysates were compared with MCF-7 Flag:YB-1(Ala102), in which the serine phosphorylation site was destroyed by site-directed mutagenesis (Wu et al., 2006
). As expected, the P-YB-1(Ser102) was detected in the MCF-7 Flag:YB-1 cells. Alternatively, the P-YB-1(Ser102) signal was attenuated in cells expressing the mutant Flag:YB-1(Ala102) (Fig. 3B). Thereafter, we demonstrated that YB-1 is phosphorylated at Ser102 in SUM 149 cells when it binds to the EGFR promoter using chromatin immunoprecipitation again using the YB-1(Ser102) antibody (A. L. Stratford, G. Habibi, H. Jiang, K. Hu, A. Shadeo, T. P. H. Buys, W. Lam, T. Pugh, M. Marru, T. O. Nielsen, et al., submitted for publication). Thus, we concluded that OSU-03012 attenuated signaling through the PDK-1/Akt/YB-1 pathway.
|
Consistent with these observations, inhibiting signaling through PDK-1 prevented YB-1 from binding to the EGFR promoter in the MDA-MB-468 and SUM 149 cells (Fig. 3C). More specifically, in the MDA-MB-468 cells, OSU-03012 reduced YB-1 binding to the EGFR promoter at the 1b site by 40% of the control (p = 0.036), whereas at the 2a site, binding was completely abolished (p = 0.024) (Fig. 3C). The immunoprecipitation with chicken IgY antibody negative controls and the sheared input DNA controls exclude the possibilities of nonspecific antibody binding and uneven DNA loading. In SUM 149 cells, OSU-03012 also inhibited YB-1 from binding to the "2a" loci on the EGFR promoter by 60% (Fig. 3D); however, there was no effect on the 1b site (data not shown). To further investigate the binding interactions between YB-1 and the regulatory region of EGFR flanked by primer set 2a, an electrophoretic mobility shift assay was performed using biotin-labeled EGFR 2a probes designed to coincide with the primer-flanked region detected in our ChIP assays (Fig. 3D, bottom right). Nuclear extracts of the SUM 149 cells after OSU-03012 treatment were incubated with the biotin-labeled oligonucleotides, and the binding interaction between YB-1 and the oligonucleotides was significantly hindered (Fig. 3D, lane 3) compared with the DMSO control (Fig. 3C, lane 1). To demonstrate specificity, an unlabeled EGFR 2a probe competed for binding (Fig. 3D, lane 2). An antibody to YB-1 was used to demonstrate the specificity of binding. In this case, the addition of YB-1 caused a supershift in binding, thereby demonstrating its involvement in EGFR promoter binding to the 2a site (Fig. 3D, lane 5). Conversely, using a Creb antibody did not cause a supershift (Fig. 3D, lane 4). In conclusion, OSU-03012 disrupts the Akt signaling pathway in BLBC cells such that the YB-1 binding pattern at the EGFR promoter sequence mirrored that of a normal cell line with low Akt signaling activity and minimal EGFR expression.
Targeted PDK-1 Gene Knockdown Disrupts the Akt Signaling Pathway and Down-Regulates the Expression of EGFR. To determine the specificity of the OSU-03012 compound, we attempted PDK-1 inhibition by targeted gene knockdown with siRNA in the SUM 149 cells. We were able to achieve greater than 90% knockdown of PDK-1 when the cells were treated with either of the siRNAs for 96 h (Fig. 4). Moreover, both of the siRNAs targeting PDK-1 caused a substantial loss of EGFR protein expression. This effect echoes that of the OSU-03012 on the YB-1/EGFR axis in the same cell line.
|
|
OSU-03012 Induces Apoptosis and Can Be Monitored Using a Newly Developed HCS Method. We noted that the longer the cells were treated with the drug, the less viable they were, suggesting that this drug could be used as an anticancer agent against BLBC. For example, if we exposed the cells to OSU-03012 for 9 h, the cells lifted and seemed to be dying. This prompted us to study the effect of the drug on cell viability in monolayer and in soft agar. We determined that OSU-03012 inhibited the growth of SUM 149 and MDA-MB-468 cells in a dose-dependent manner (Fig. 6A). The 184htrt cells, however, were not sensitive to the drug (Fig. 6A). OSU-03012 (2.5, 5.0, or 10 µM) also had a profound inhibitory effect on the ability of the SUM 149 cells to grow in soft agar (Fig. 6B). Likewise, the drug inhibited the anchorage-independent growth of MDA-MB-468 cells (Fig. 6B).
|
|
OSU-03012 Disrupts YB-1 Function and Down-Regulates the Expression of EGFR in Mice. In cancer cells, Her-2 is not able to signal unless it partners with other members of its family, such as EGFR. We therefore used a system in which Her-2 is overexpressed in MDA-MB-435/LCC6 cells. The MDA-MB-435/LCC6/Her-2 cells were used for in vivo studies in part because they are known to express EGFR (Warburton et al., 2004
) and they readily form tumors in mice (Dragowska et al., 2004
; Warburton et al., 2004
). We therefore questioned whether OSU-03012 could inhibit YB-1 function and therefore down-regulate EGFR in this preclinical model of breast cancer. To achieve this, we performed bilateral subcutaneous injections of the MDA-MB-435/LCC6/Her-2 cells into the rear flank of SCID/Rag2 mice (n = 8) and established tumors over 6 weeks. All of the mice developed two tumors and were therefore assigned to either the vehicle control or OSU-03012 (200 mg/kg) treatment group, which was given orally for 3 days. OSU-03012 remarkably decreased EGFR protein expression in the tumors by
48% compared with expression levels found in the tumors taken from mice that received the vehicle control (Fig. 8, A and B). OSU-03012 also prevented YB-1 from binding to the EGFR promoter at the 1b and 2a sites (Fig. 8C). After this, we immunostained the tumors from the mice for P-Akt. Overall, there was a reduction in the intensity of P-Akt staining in the OSU-03012-treated tumors compared with the vehicle control. There tended to be less P-Akt staining in the tumors taken from mice that were given OSU-03012 (Fig. 8A). Tumors were considered positive if at least 50% of the cells stained for P-Akt. The data from four tumors taken from each treatment group are shown. We did, however, examine all of the tumors for P-Akt. There were six (86%) of seven tumors in the vehicle control group that expressed P-Akt, whereas only three (37.5%) of eight were positive in the OSU-03012-treated group. One of the tumors from the vehicle control had to be omitted because of poor overall staining. Thus, OSU-03012 decreased P-Akt staining by approximately 44%, which is consistent with the degree to which EGFR was inhibited. Finally, we wanted to make sure that the mice were not adversely reacting to the drug because Akt was being inhibited. Therefore, we measured serum glucose levels after they received the drug for 72 h. It is noteworthy that the drug was well tolerated by the mice with no observed changes in serum glucose (Fig. 8D).
|
| Discussion |
|---|
|
|
|---|
It should be pointed out that although we (Wu et al., 2006
) and others (Berquin et al., 2005
) find that YB-1 regulates EGFR at the level of transcription, it is entirely possible that it could also influence the translation and/or turnover of the receptor through endocytosis. For example, YB-1 has been characterized previously for its ability to stabilize interleukin-2 mRNA by binding to AU-rich elements (ARE) on the 3'-untranslated region of interleukin-2 (Chen et al., 2000
). This was a rather novel finding because YB-1 is more commonly believed to regulate translation through cap-dependent binding (Soop et al., 2003
). Whereas the ability of YB-1 to regulate AREs is a relatively new concept, it is reminiscent of the way in which the widely characterized translation factor HuR stabilizes the mRNA of proto-oncogenes such as urokinase plasminogen activator (Tran et al., 2003
). It is interesting that EGFR has two ARE regions that are occupied by a protein that could potentially be YB-1 given that it is described as a cytoplasmic protein that is 50 to 80 kDa in size, which was initially isolated from the MDA-MB-468 cells (Balmer et al., 2001
). This excludes HuR because it is 36 kDa. Furthermore, the uncharacterized protein is similar to YB-1 in that it is expressed in a wide range of breast cancer cell lines (Balmer et al., 2001
). Although this is speculative, it does raise the possibility of other mechanisms whereby YB-1 could control the expression of EGFR. A similar argument can be mounted for YB-1 at the level of EGFR turnover. It is conceivable that YB-1 inhibits EGFR turnover by down-regulating the c-able proto-oncogene, which is known to mediate receptor cycling (Ettenberg et al., 1999
). This possibility is raised because we recently performed ChIP on Chip to profile the global promoter occupancy of YB-1 in the SUM 149 cells. Our preliminary data indicate that YB-1 potentially binds to c-Abl proto-oncogene based on two different ChIP on Chip hybridizations (data not shown), presenting yet another potential mode of regulation. Such avenues are additionally rationalized given that our data indicate that the overexpression of EGFR is not caused by gene amplification (A. L. Stratford, G. Habibi, H. Jiang, K. Hu, A. Shadeo, T. P. H. Buys, W. Lam, T. Pugh, M. Marru, T. O. Nielsen, et al., submitted for publication), suggesting that transcription/translation and receptor turnover events are probably the cause of enhanced expression.
The expression of YB-1 in aggressive types of cancer calls into question its potential as a therapeutic target for treatment. We took an indirect approach to inhibiting YB-1, but alternatively, one could consider inhibiting YB-1 directly. By knocking down YB-1, we find that the anchorage-independent growth of breast cancer cells is inhibited by approximately 50 to 70% as a single agent (C. Lee, G. Habibi, S. Leung, J. Dhillon, Z. Yang, K. To, M. Wang, L. Li, K. Gelmon, C. Steven, unpublished data). This is a promising result that could translate into the clinic by silencing YB-1 using either antisense or small interfering RNAs. Clinical trials are underway using antisense to inhibit BCL-2 (Chi et al., 2001
; Tolcher et al., 2005
) and clusterin (OGX-011) (Miyake et al., 2000
; Chi et al., 2005
; So et al., 2005
). By the same token, there are now many examples of how small interfering RNAs can be used to slow the growth of cancer cells in preclinical models, although the clinical development of this technology is still emerging. Short hairpin RNAs targeting survivin have been expressed in a lentiviral vector (Jiang et al., 2006
) and were tested in a model of oral squamous cell carcinoma in which this target is highly expressed. The loss of survivin sensitized the cells to chemotherapy in vitro and inhibited tumor growth in mice (Jiang et al., 2006
). The first clinical trials using siRNA have begun; however, they are not yet being applied in the field of oncology but to silence the vascular endothelial growth factor in age-related macular degeneration (Grünweller and Hartmann, 2005
). It is therefore within reach that shRNA could be used to treat other diseases such as cancer. Taking a completely different approach, one might consider using the expression of YB-1 to drive the replication of oncolytic viruses as a way of treating cancer. It has been known for some time that YB-1 facilitates the replication of adenoviruses (Holm et al., 2002
), which can then be used to kill tumor cells (Holm et al., 2004
; Glockzin et al., 2006
). The expression of YB-1 in basal-like and Her-2-overexpressing breast cancers provides an excellent opportunity for using oncolytic viruses for therapy. Although these gene-based approaches are promising, they are still limited by bioavailability, formulations, safety, and the expense of making the products. A small-molecule inhibitor would perhaps circumvent some of these issues. OSU-03012 is an indirect YB-1 inhibitor that is promising because it is orally available, well tolerated in mice, and kills a wide range of cancer cell types.
Although we have concentrated on the effect of OSU-03012 on the interface between YB-1 and EGFR, we are aware that blocking this transcription factor will inevitably inhibit other target genes that are important to the growth and survival of cancer cells. YB-1 is characteristically known to regulate genes such as the multidrug resistance-1, TOPO-II, cyclin A, cyclin B, DNA polymerase, and PCNA, to mention a few (Kohno et al., 2003
; Kuwano et al., 2003
). Considering this, we demonstrated that OSU-03012 also inhibited the expression of the YB-1 target genes PCNA and TOPO-II. It is noteworthy that PCNA and topoisomerase II
are expressed in BLBC (Perreard et al., 2006
), both of which are regulated by YB-1 (Kohno et al., 2003
). In colorectal carcinomas, YB-1 and topoisomerase II
are coordinately expressed (Shibao et al., 1999
). Likewise, similar expression patterns are reported in lung cancer (Gu et al., 2001
) and synovial sarcomas (Oda et al., 2003
). Additional direct evidence for the association comes from Shibao et al. (1999
), who reported that knocking down YB-1 with antisense attenuates topoisomerase II reporter activity. These YB-1 target genes have now been confirmed in BLBC. These data could now begin to explain why the expression of this transcription factor is clearly associated with poor survival based on the work done previously by our laboratory (Wu et al., 2006
) and by others (Bargou et al., 1997
). Arguably, inhibiting a protein such as YB-1 that has pleiotropic effects is desirable particularly in treating cancer, a disease that manifests from multiple cellular defects. Inhibiting just EGFR, for example, has proven to be surprisingly ineffective in the clinic. It is disappointing that the results of two clinical trials report that EGFR inhibitors do not have activity against breast cancer (Baselga et al., 2005
; von Minckwitz et al., 2005
). We therefore suggest that inhibiting YB-1 could be a better molecular target because it regulates so many genes involved in tumor cell growth and drug resistance (Kuwano et al., 2003
). In closing, we are recommending OSU-03012 as a potent small-molecule inhibitor that has the potential to block the function of YB-1 and therefore the expression of EGFR. These data provide novel mechanistic implications for the use of OSU-03012 to inhibit the growth of BLBC and Her-2 breast cancer subtypes.
| Acknowledgements |
|---|
| Footnotes |
|---|
Article, publication date, and citation information can be found at http://molpharm.aspetjournals.org.
ABBREVIATIONS: Her-2, human epidermal growth factor receptor-2; BLBC, basal-like breast cancer; ChIP, chromatin immunoprecipitation; EGFR, epidermal growth factor receptor; ER, estrogen receptor; PDK-1, phosphoinositide-dependent protein kinase-1; PR, progesterone receptor; PCNA, proliferating nuclear antigen; TOPO-II, topoisomerase II; YB-1, Y-box binding protein-1; PBS, phosphate-buffered saline; PBST, phosphate-buffered saline/Tween; siRNA, small interfering RNA; RT, room temperature; PI, propidium iodide; FITC, fluorescein isothiocyanate; ARE, AU-rich element; BSA, bovine serum albumin; kb, kilobase; DMSO, dimethyl sulfoxide; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; PCR, polymerase chain reaction; OSU-03012, 2-amino-N-[4-[5-(2-phenanthrenyl)-3-(trifluoromethyl)-1H-pyrazol-1-yl]phenyl]-acetamide; OGX-011, DNA, d(P-thio)((2'-O-(2-methoxyethyl))m5rC-(2'-O-(2-methoxyethyl))rA-(2'-O-(2-methoxyethyl))rG-(2'-O-(2-methoxyethyl))-m5rC-A-G-C-A-G-A-G-T-C-T-T-C-A-(2'-O-(2-methoxyethyl))m5rU-(2'-O-(2-methoxyethyl))m5rC-(2'-O-(2-methoxyethyl))rA-(2'-O-(2-methoxy-ethyl))m5rU); HCS, high-content screening.
Address correspondence to: Dr. Sandra E. Dunn, Departments of Pediatrics, Medical Genetics and Experimental Medicine, Child and Family Research Institute, University of British Columbia, 950 West 28th Avenue, Vancouver, BC, V5Z 4H4 Canada. E-mail: sedunn{at}interchange.ubc.ca
| References |
|---|
|
|
|---|
Bargou RC, Jurchott K, Wagener C, Bergmann S, Metzner S, Bommert K, Mapara MY, Winzer KJ, Dietel M, Dorken B, et al. (1997) Nuclear localization and increased levels of transcription factor YB-1 in primary human breast cancers are associated with intrinsic MDR1 gene expression. Nat Med 3: 447–450.[CrossRef][Medline]
Baselga J, Albanell J, Ruiz A, Lluch A, Gascon P, Guillem V, Gonzalez S, Sauleda S, Marimon I, Tabernero JM, et al. (2005) Phase II and tumor pharmacodynamic study of gefitinib in patients with advanced breast cancer. J Clin Oncol 23: 5323–5333.
Bergmann S, Royer-Pokora B, Fietze E, Jürchott K, Hildebrandt B, Trost D, Leenders F, Claude JC, Theuring F, Bargou R, et al. (2005) YB-1 provides breast cancer through the induction of chromosomal instability that emerges from mitotic failure and centrosome amplification. Cancer Res 65: 4078–4087.
Berquin IM, Pang B, Dziubinski ML, Scott LM, Chen YQ, Nolan GP, and Ethier SP (2005) Y-box binding protein 1 confers EGF independence to human mammary epithelial cells. Oncogene 24: 3177–3186.[CrossRef][Medline]
Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72: 248–254.[CrossRef][Medline]
Chen CY, Gherzi R, Andersen JS, Gaietta G, Jurchott K, Royer HD, Mann M, and Karin M (2000) Nucleolin and YB-1 are required for JNK-mediated interleukin-2 mRNA stabilization during T-cell activation. Genes Dev 14: 1236–1248.
Chi K, Gleave M, Klasa R, Murray N, Bryce C, Lopes de Menezes DE, D'Alessio A, and Tolcher AW (2001) A phase I dose-finding study of combined treatment with an antisense BCL-2 oligonucleotide (Genesense) and mitoxantrone in patients with metastatic hormone-refractory prostate cancer. Clin Cancer Res 7: 3920–3927.
Chi KN, Eisenhauer E, Fazli L, Jones EC, Goldberg SL, Powers J, Tu D, and Gleave M (2005) A phase I pharmacokinetic and pharmacodynamic study of OGX-011, a 2'-methylethyl antisense oligonucleotide to clusterin in patients with localized prostate cancer. J Natl Cancer Inst 97: 1287–1296.
Crowder RJ and Ellis MJ (2005) Treating breast cancer through novel inhibitors of the phosphatidylinositol 3'-kinase pathway. Breast Cancer Res 7: 212–214.[CrossRef][Medline]
Dragowska WH, Warburton C, Yapp DTT, Michinton AI, Hu Y, Waterhouse DN, Gelmon K, Knov K, Woo J, Masin D, et al. (2004) Her-2/neu overexpression increases the viable hypoxic cell population within solid tumors without causing changes in tumor vascularization. Mol Cancer Res 2: 606–619.
Ettenberg SA, Keen MM, Nau MM, Frankel M, Wang LM, Pierce JH, and Lipkowitz S (1999) Cbl-B inhibits epidermal growth factor receptor signaling. Oncogene 18: 1855–1866.[CrossRef][Medline]
Faury D, Nantel A, Dunn SE, Guiot M, Haque T, Hauser P, Garami M, Bognar L, Hanzely Z, Liberski PP, et al. (2007) Molecular profiling identifies prognostic subgroups of pediatric glioblastoma. J Clin Oncol 25: 1196–1208.
Filmus J, Pollack MN, Cailleau R, and Bick RN (1985) MDA-MB-468 a human breast cancer cell line with a high number of epidermal growth factor (EGF) receptors has an amplified EGFR receptor gene and is growth inhibited by EGF. Biochem Biophys Res Commun 128: 898–905.[CrossRef][Medline]
Giménez-Bonafé P, Fedoruk MN, Whitmore TG, Akbari M, Ralph JL, Gleave ME, and Nelson CC (2004) The transcription factor Yb-1 is upregulated during prostate cancer progression and increases P-glycoprotein expression. Prostate 59: 337–349.[CrossRef][Medline]
Glockzin G, Mantwill K, Jurchott K, Bernshausen A, Ladhoff A, Royer HD, Gansbacher B, and Holm PS (2006) Characterization of a recombinant adenovirus vector AdYB-1: Implications for oncolytic vector development. J Virol 80: 3904–3911.
Grünweller A and Hartmann RK (2005) RNA interference as a gene-specific approach for molecular medicine. Curr Med Chem 12: 3143–3161.[CrossRef][Medline]
Gu C, Oyama T, Osaki T, Kohno K, and Yasumoto K (2001) Expression of Y box-binding protein 1 correlates with DNA topoisomerase II alpha and proliferating cell nuclear antigen expression in lung cancer. Anticancer Res 21: 2357–2362.[Medline]
Holm PS, Bergmann S, Jurchott K, Lage H, Brand K, Landhoff A, Curiel DT, Dobblestein M, Gaensbacher B, and Royer HD (2002) YB-1 relocates to the nucleus in adenovirus infected cells and facilitates viral replication by inducing E2 gene expression through the E2 late promoter. J Biol Chem 277: 10427–10434.
Holm PS, Lage H, Bergmann S, Jürchott K, Glockzin G, Bernshausen A, Mantwill K, Ladhoff A, Wichert A, Mymryk JS, et al. (2004) Multidrug-resistant cancer cells facilitate E1-independent adenoviral replication: impact for cancer gene therapy. Cancer Res 64: 322–328.
Jiang G, Li J, Zeng Z, and Xian L (2006) Lentivirus-mediated gene therapy by suppressing survivin in BALB/cnude mice bearing oral squamous cell carcinoma. Cancer Biol Ther 5: 435–440.[Medline]
Kohno K, Izumi H, Uchiumi T, Ashizuka M, and Kuwano M (2003) The pleotropic function of the Y-box-binding protein, YB-1. Bioessays 25: 691–698.[CrossRef][Medline]
Kucab JE, Lee C, Chen CS, Zhu J, Gilks CB, Cheang M, Huntsman D, Yorida E, Emerman J, Pollack M, et al. (2005) Celecoxib analogues disrupt Akt signaling which is commonly activated in primary breast tumors. Breast Cancer Res 7: R796–R807.[CrossRef][Medline]
Kuwano M, Uchiumi T, Hayakawa H, Ono M, Wada M, Izumi H, and Kohno K (2003) The basic and clinical implication of ABC transporters, Y-box protein-1 (Yb-1) and angiogenesis related factors in human malignancies. Cancer Sci 94: 9–14.[CrossRef][Medline]
Miyake H, Rennie P, Nelson CC, and Gleave M (2000) Acquisition of chemoresistant phenotype by overexpression of the antiapoptotic gene, testosterone-repressed prostate message-2 (clusterin), in prostate cancer xenograft models. Cancer Res 60: 2547–2554.
Nielsen TO, Cheang MC, Hsu FD, Turbin D, Hu XJ, Norris BD, Speers CH, Olivotto IA, and Perou CM (2004) Epidermal growth factor receptor and basal breast cancer: prognosis on a large population based series. Clin Cancer Res 10: 5361–5367.
Oda Y, Ohishi Y, Saito T, Hinoshita E, Uchiumi T, Kinukawa N, Iwamoto Y, Kohno K, Kuwano M, and Tsuneyoshi M (2003) Nuclear expression of Y-box binding protein-1 correlates with P-glycoprotein and topoisomerase II alpha expression and with poor prognosis in synovial sarcoma. J Pathol 199: 251–258.[CrossRef][Medline]
Perou CM, Sorlle T, Eisen M, van de Rijn M, Jeffrey SS, Rees CA, Pollack JR, Ross DT, Johnson H, Akslen LA, et al. (2000) Molecular portraits of human breast tumors. Nature 406: 747–752.[CrossRef][Medline]
Perreard L, Fan C, Quackenbush JF, Mullins M, Gauthier NP, Nelson E, Mone M, Hansen H, Buys SS, Rasmussen KJ, et al. (2006) Classification and risk stratification of invasive breast carcinomas using real-time quantitative RT-PCR assay. Breast Cancer Res 8: R23.[CrossRef][Medline]
Provenzano PP, Eliceiri KW, Campbell JM, Inman DR, White JG, and Keely PJ (2006) Collagen reorganization at the tumor-stromal interface facilitates local invasion. BMC Med 4: 38.[CrossRef][Medline]
Shibahara K, Sugio K, Oshaki T, Uchiumi T, Maehara Y, Kohno K, Yasumoto K, Sugimachi K, and Kuwano M (2001) Nuclear expression of the Y-box binding protein, YB-1, as a novel marker of disease progression in non-small cell lung cancer. Clin Cancer Res 7: 3151–3155.
Shibao K, Takano H, Nakayama Y, Okazaki K, Nagata N, Izumi H, Uchiumi T, Kuwano M, Kohn K, and Itoh H (1999) Enhanced coexpression of YB-1 and DNA polymerase II genes in human colorectal carcinomas. Int J Cancer 83: 732–737.[CrossRef][Medline]
So A, Sinnemann S, Huntsman D, Fazli L, and Gleave M (2005) Knockdown of the cytoprotective chaperone, clusterin, chemosensitizes human breast cancer cells both in vitro and in vivo. Mol Cancer Ther 4: 1837–1849.
Soop T, Nashchekin D, Zhao J, Sun X, Alzhanova-Ericsson AT, Bjorkroth B, Ovchinnikov LP, and Daneholt B (2003) A p50 like Y-box protein with a putative translational role becomes associated with pre-mRNA concomitant with transcription. J Cell Sci 116: 1493–1503.
Sørlie T, Perou CM, Tibshirani R, Aas T, Geisler S, Johnson H, Hastie T, Eisen M, van de Rijn M, Jeffrey SS, et al. (2001) Gene expression patterns of breast carcinomas distinguish tumor subclasses with clinical implications. Proc Natl Acad Sci U S A 98: 10869–10874.
Sutherland BW, Kucab JE, Wu J, Lee C, Cheang MCU, Yorida E, Turbin D, Dedhar S, Nelson CC, Pollack M, et al. (2005) Akt phosphorylates the Y-box binding protein 1 at Ser102 located in the cold shock domain and affects the anchorage-independent growth of breast cancer cells. Oncogene 24: 4281–4292.[CrossRef][Medline]
Tolcher AW, Chi K, Kuhn J, Gleave M, Patnaik A, Takimoto C, Schwartz G, Thompson I, Berg K, D'Aloisio S, et al. (2005) A phase II, pharmacokinetic, and biological correlative study of oblimersen sodium and docetaxel in patients with hormone-refractory prostate cancer. Clin Cancer Res 11: 3854–3861.
Tran H, Maurer HM, and Nagamine Y (2003) Stabilization of urokinase and urokinase receptor mRNAs by HuR is linked to its cytoplasmic accumulation induced by activated mitogen-activated protein kinase activated protein kinase 2. Mol Cell Biol 23: 7177–7188.
Tseng PH, Lin HP, Zhu J, Chen K, Hade EM, Young DC, Byrd JC, Grever M, Johnson M, Druker B, et al. (2005) Synergistic interactions between Imatinib and the novel phosphoinositide-Dependent kinase-1 inhibitor OSU-03012 in overcoming Imatinib resistance. Blood 105: 4021–4027.
Tseng PH, Wang Y, Weng S, Weng J, Chen CS, Brueggemeirer RW, Shapiro CL, Chen CY, Dunn SE, Pollak M, et al. (2006) Overcoming trastuzumab resistance in Her-2 overexpressing breast cancer cells by using a novel celecoxib-derived phosphoinositide-dependent kinase-1 inhibitor. Mol Pharmacol 70: 1534–1541.
van't Veer LJ, Dia H, Van de Vijver JM, He YD, Hart AA, Mao M, Peterse L, Van der Kooy K, Marton MJ, Witteveen AT, et al. (2002) Gene expression profiling predicts clinical outcome of breast cancer. Nature 415: 530–536.[CrossRef][Medline]
Vivanco I and Sawyers CL (2002) The phosphatidylinositol 3-kinase Akt pathway in human cancer. Nat Rev Cancer 2: 489–501.[CrossRef][Medline]
von Minckwitz G, Jonat W, Fasching P, du Bois A, Kleeberg U, Luck HJ, Kettner E, Eiermann W, Torode J, and Schneeweiss A (2005) A multicenter phase II study of gefitinib in taxane and anthracycline-pretreated metastatic breast cancer. Breast Cancer Res Treat 89: 165–172.[CrossRef][Medline]
Warburton C, Dragowska WH, Gelmon K, Chia S, Yan H, Masin D, Denyssevych T, Wallis AE, and Bally MB (2004) Treatment of Her-2/neu overexpressing breast cancer xenograft models with trastuzumab (Herceptin) and gefitinib (ZD1839): Drug combination effects on tumor growth, Her-2/neu and epidermal growth factor receptor expression and viable hypoxic cell fraction. Clin Cancer Res 10: 2512–2524.
Wu J, Lee C, Yokom D, Jiang H, Cheang MCU, Yorida E, Turbin D, Berquin IM, Mertens PR, Iftner T, et al. (2006) Disruption of the Y-box binding protein-1 (YB-1) results in suppression of the epidermal growth factor receptor and Her-2. Cancer Res 66: 4872–4879.
Yahata H, Kobayashi H, Kamura T, Amada S, Hirakawa T, Kohno K, Kuwano M, and Nakano H (2002) Increased nuclear localization of transcription factor Yb-1 in acquired cisplatin-resistance ovarian cancer. J Cancer Res Clin Oncol 128: 621–626.[CrossRef][Medline]
Yarden Y (2001) Biology of Her-2 and its importance in breast cancer. Oncology 61 (Suppl 2): 1–13.[Medline]
Zhu J, Huang J, Tseng PH, Yang Y, Fowble J, Shiau C, Shaw Y, Kulp SK, and Chen CS (2004) From the cyclooxygenase-2 inhibitor Celecoxib to a novel class of 3-phosphoinositide-dependent protein kinase inhibitors. Cancer Res 64: 4309–4318.
This article has been cited by other articles:
![]() |
J. H. Law, G. Habibi, K. Hu, H. Masoudi, M. Y.C. Wang, A. L. Stratford, E. Park, J. M.W. Gee, P. Finlay, H. E. Jones, et al. Phosphorylated Insulin-Like Growth Factor-I/Insulin Receptor Is Present in All Breast Cancer Subtypes and Is Related to Poor Survival Cancer Res., December 15, 2008; 68(24): 10238 - 10246. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Lee, J. Dhillon, M. Y.C. Wang, Y. Gao, K. Hu, E. Park, A. Astanehe, M.-C. Hung, P. Eirew, C. J. Eaves, et al. Targeting YB-1 in HER-2 Overexpressing Breast Cancer Cells Induces Apoptosis via the mTOR/STAT3 Pathway and Suppresses Tumor Growth in Mice Cancer Res., November 1, 2008; 68(21): 8661 - 8666. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Park, A. Yacoub, M. Rahmani, G. Zhang, L. Hart, M. P. Hagan, S. K. Calderwood, M. Y. Sherman, C. Koumenis, S. Spiegel, et al. OSU-03012 Stimulates PKR-Like Endoplasmic Reticulum-Dependent Increases in 70-kDa Heat Shock Protein Expression, Attenuating Its Lethal Actions in Transformed Cells Mol. Pharmacol., April 1, 2008; 73(4): 1168 - 1184. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||