QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) All Versions of this Article: mol.107.039354v1 73/2/451    most recent Submit a response Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Onica, T. Articles by Kirby, G. M. Search for Related Content PubMed PubMed Citation Articles by Onica, T. Articles by Kirby, G. M.

Dexamethasone-Mediated Up-Regulation of Human CYP2A6 Involves the Glucocorticoid Receptor and Increased Binding of Hepatic Nuclear Factor 4 to the Proximal Promoter

Department of Biomedical Sciences, University of Guelph, Guelph, Ontario, Canada (T.O., K.N., M.L., L.N., A.M., G.M.K.); Institut National de la Santé et de la Recherche Médicale U632, Montpellier, France, and Univ Montpellier1, Montpellier, France (J.-M.P., M.-J.V., P.M.); and Institute of Medical Chemistry and Biochemistry, Faculty of Medicine, Palacky University, Olomouc, Czech Republic (Z.D.)

Received July 12, 2007; accepted October 31, 2007

	Abstract

Top Abstract Materials and Methods Results Discussion References

 
Human cytochrome P450 2A6 (CYP2A6) metabolizes various clinically relevant compounds, including nicotine- and tobacco-specific procarcinogens; however, transcriptional regulation of this gene is poorly understood. We investigated the role of the glucocorticoid receptor (GR) in transcriptional regulation of CYP2A6. Dexamethasone (DEX) increased CYP2A6 mRNA and protein levels in human hepatocytes in primary culture. This effect was attenuated by the GR receptor antagonist mifepristone (RU486; 17β-hydroxy-11β-[4-dimethylamino phenyl]-17-[1-propynyl]estra-4,9-dien-3-one), suggesting that induction of CYP2A6 by DEX was mediated by the GR. In gene reporter assays, DEX caused dose-dependent increases in luciferase activity that was also prevented by RU486 and progressive truncations of the CYP2A6 promoter delineated DEX-responsiveness to a -95 to +12 region containing an hepatic nuclear factor 4 (HNF4) response element (HNF4-RE). Mutation of the HNF4-RE abrogated HNF4- and DEX-mediated transactivation of CYP2A6. In addition, overexpression of HNF4 increased CYP2A6 transcriptional activity by 3-fold. DEX increased HNF4 mRNA levels by 4-fold; however, the amount of HNF4 nuclear protein was unaltered. Electrophoretic mobility shift, chromatin immunoprecipitation (ChIP), and streptavidin DNA binding assays revealed that DEX increased binding of HNF4 to the HNF4-RE and that an interaction of GR and HNF4 occurred at this site. Moreover, ChIP assays indicated that histone H4 acetylation of the CYP2A6 proximal promoter chromatin was increased by DEX that may allow for increased binding of HNF4 to the HNF4-RE in human hepatocytes. These findings indicate that increased expression of CYP2A6 by DEX is mediated by the GR via a nonconventional transcriptional mechanism involving interaction of HNF4 with an HNF4-RE rather than a glucocorticoid response element.

In smokers, CYP2A6 is responsible for approximately 80% of the hepatic metabolism of nicotine to cotinine via C-oxidation (Tutka et al., 2005). Nicotine is the major determinant for establishing and maintaining smoking dependence, because smoking behavior is adjusted to maintain plasma and brain nicotine levels in a constant range (Sellers et al., 2003). In addition, it has been shown that CYP2A6 has the capacity to bioactivate several procarcinogens, such as tobacco-specific nitrosamines. Indeed, interindividual variation in CYP2A6 expression results in altered nicotine inactivation rates and smoking patterns (Pianezza et al., 1998), increasing the propensity for addiction to tobacco products, which ultimately affects the incidence of tobacco-related cancers (Kamataki et al., 2005). Thus, CYP2A6 is pivotal in influencing smoking initiation and tobacco dependence, the number of cigarettes smoked, and the risk of tobacco-related cancers (Raunio et al., 2001; Sellers et al., 2003). For example, it is hypothesized that CYP2A6-poor metabolizers differ in their smoking habits from extensive metabolizers and that they may be protected from developing cancer at the target sites of these carcinogens, mainly the lung and the liver (Raunio et al., 2001; Nakajima et al., 2002; Malaiyandi et al., 2005).

Although the wide variation in CYP2A6 activity and levels has been largely attributed to polymorphisms within the coding region of the gene, recent studies have identified single-nucleotide polymorphisms within the 5'- and 3'-flanking regions, affecting gene expression and activity (Pitarque et al., 2001; Wang et al., 2006). Moreover, response elements for HNF-1, CCAAT/enhancer-binding protein , CCAAT/enhancer-binding protein β, and Oct-1 transcription factors in the proximal promoter are involved in CYP2A6 transcriptional regulation (Pitarque et al., 2005). Characterization of the CYP2A6 promoter conducted in this study examines the mechanisms of glucocorticoid-mediated induction. Glucocorticoids have been previously shown to regulate several P450 genes, including CYP2C8 (Ferguson et al., 2005), CYP2C9 (Gerbal-Chaloin et al., 2002), and CYP2C19 (Chen et al., 2003). Computer analysis of a 2.5-kilobase section of the CYP2A6 promoter region revealed numerous putative glucocorticoid response elements (GREs), which suggests that CYP2A6 may be regulated in part by the GR. The frequency of clinical use of glucocorticoids underscores the importance of determining how treatment affects CYP2A6 transcriptional activity because any potential changes in gene regulation will alter metabolism of CYP2A6 substrates, particularly nicotine- and tobacco-related carcinogens. The results of this study demonstrate that DEX induces CYP2A6 expression via GR-mediated transcriptional activation by increasing HNF4 binding to an HNF4-RE in the proximal promoter.

	Materials and Methods

Top Abstract Materials and Methods Results Discussion References

 
Materials. Cell culture media and supplements were purchased from Invitrogen Canada Inc. (Burlington, ON, Canada). Dexamethasone, mifepristone (RU486), and dimethyl-3,3-dithiobispropionimidate-2HCl (DTBP) were purchased from Sigma-Aldrich (Oakville, ON, Canada). Antibodies against human HNF4 were obtained from Santa Cruz Biotechnology Inc. (Santa Cruz, CA). [-³²P]ATP (3000 mCi/mmol) was purchased from GE Healthcare (Piscataway, NJ). All other compounds were readily available commercially.

Cell Culture. Hepatocytes were prepared from lobectomy segments resected from adult patients for medical reasons unrelated to our research program. Tissue encompassing the liver tumors was removed surgically and assessed by histopathology, whereas the remaining tissue was used for hepatocyte isolation. Apart from age, sex, and the reason for surgery, no further patient information was available for this study. It is noteworthy that pathological examination of the surgical specimen was in no way hindered by the procedure used to obtain primary hepatocytes; otherwise, the tissues used for this study would have been immediately discarded. In all patients, serologic analysis for hepatitis B virus, hepatitis C virus, and human immunodeficiency virus was negative. Primary human hepatocytes were prepared and cultured as described previously (Pichard-Garcia et al., 2002). Cells were plated onto collagen-coated dishes at 1.7 x 10⁵ cells/cm² in a hormonally and chemically defined medium consisting of a mixture of William's E and Ham's F-12 media (1:1 in volume). Forty-eight hours after plating, cells were cultured for 16 h in glucocorticoid-free media before exposure to DEX for 24 h.

HeLa cells were cultured in a humidified incubator infused with 5% CO₂ at 37°C in Dulbecco's modified Eagle's medium (Sigma-Aldrich) supplemented with 10% fetal bovine serum, and 1% penicillin and streptomycin.

RNA Isolation and Comparative Real-Time Reverse Transcription-Polymerase Chain Reaction Analysis. Total RNA was extracted from cells following the TRIzol reagent method (Invitrogen Canada Inc.). Messenger RNA analysis was conducted by comparative real-time reverse transcription-polymerase chain reaction (RT-PCR) using a Roche Diagnostics (Indianapolis, IN) LightCycler instrument and the DNA Master SYBR Green I kit (Roche Diagnostics, Mississauga, ON, Canada). RNA (1 µg) was first treated with 1 unit of DNase (RQ1 RNase-free DNase; Promega, Madison, WI). Complementary DNA was synthesized from RNA using 0.1 µg of random primers, 20 units of RNase inhibitor (RNasin; Promega), and 200 units of murine Moloney leukemia virus reverse transcriptase (Invitrogen Canada Inc.). PCR was performed in a 10-µl volume containing 1 µl of SYBR Green I and 5 µM concentrations of each primer. The final Mg⁺ concentration was 2 mM and the PCR parameters were as follows: an initial step at 95°C for 10 min followed by 45 cycles of 95°C, 15 s; 70°C, 5 s; 70°C, 15 s). The gene-specific primers are listed in Table 1.

Plasmid Construction. The pTAT-TK-GRE-LUC (containing one copy of the consensus GRE upstream of a minimal herpes simplex thymidine kinase promoter and a luciferase reporter gene) and HNF4 expression plasmid (pHNF4) were kindly provided by Dr. L. Poellinger (Karolinska Institute, Stockholm, Sweden). A LUC reporter gene plasmid construct containing 2469 base pairs of the 5'-flanking region of the CYP2A6 promoter and deletion plasmids consisting of sequential truncations of this region were prepared by PCR with primers listed in Table 2. The antisense primer was the same for all the constructs.

PCR was performed using genomic DNA extracted from human whole blood as a template. The amplified fragment was cloned into the pCR-TOPO cloning vector (Invitrogen Canada Inc.) following manufacturer's instructions, and then it was restriction digested with KpnI and XhoI to facilitate subcloning into the pGL3 luciferase vector (Promega) for reporter gene assays. DNA was precipitated and transformed into competent XL1 blue cells, and plasmid DNA was then harvested and purified using a Plasmid Maxi kit (QIAGEN Inc., Mississauga, ON, Canada). The CYP2A6 promoter sequences were confirmed by direct sequencing and the resultant plasmids were designated as p2A6-2469-LUC, p2A6-2065-LUC, p2A6-1551-LUC, p2A6-1038-LUC, p2A6-472-LUC, p2A6-239-LUC, and p2A6-95-LUC according to the length of the 5'-UTR insert.

Site-Directed Mutagenesis. The HNF4-RE(GCCAAAGTCCA, -69 to -79) within the proximal promoter region was mutated within p2A6-2469-LUC using the QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA). Oligonucleotide primers were designed to anneal to the same sequence on opposite strands of the plasmid flanking the HNF4 site and to carry a two-base pair CCAA mutation. The primer sequences are as follows: sense: GGTAATTATGTAATCAGCCAAAGTAAATCCCTCTTTTTCAGGCAG; and antisense: CCA TTAATACATTAGTCGGTTTCATTTAGGGAGAAAAAGTCCGTC.

The response element is indicated by bold letters, and the mutated bases are underlined. The presence of the mutation was confirmed by direct sequencing and the resultant plasmid was designated as p2A6-2469-HNF4-LUC.

Transfection and Dual-Luciferase Reporter Assays. HeLa cells were transfected in suspension with a density of 1.5 x 10⁵ cells/well in a 24-well plate. A DNA mixture containing 800 ng/µl of p2A6-2469-LUC reporter plasmid, 10 ng/µl pRL-TK plasmid (Renilla reniformis, luciferase plasmid), and increasing concentrations of the pHNF4 were transfected using LipofectAMINE (Invitrogen Canada Inc.) according to the manufacturer's recommendations. As a positive control, cells were transfected with the pGL3-control plasmid (Promega), which constitutively expresses the luciferase gene through a simian virus-40 promoter. As a negative control, cells were transfected with the promoter-less pGL3-basic. After 24 h, medium containing 10 nM DEX was added. Twenty-four hours later, cells were harvested and washed twice with phosphate-buffered saline, cell extracts were prepared, and aliquots of the lysates were assayed for luciferase enzyme activities as described by the dual-luciferase reporter assay system (Promega). Luciferase activities were normalized to Renilla luciferase activity to correct for differences in transfection efficiency and cell numbers. All transfection studies were repeated at least three times.

Preparation of Nuclear Extracts. Nuclear extracts were prepared from HeLa cells (5.0 x 10⁶ cells) as described by Dignam et al. (1983). In brief, cells were harvested, washed, and resuspended in 200 µl of buffer A (10 mM HEPES, pH 7.9, 1.5 mM MgCl₂, 10 mM KCl, 2 µg/ml pepstatin, 10 µg/ml aprotinin, 0.5 M DTT, 0.575 mM PMSF, and 2 µg/ml leupeptin). Cell lysis was facilitated by passing the cells repeatedly through a 1-ml syringe fitted with a 25-gauge needle. Nuclei were recovered by centrifugation at 14,000g for 3 min at 4°C, resuspended in 60 µl of buffer C (20 mM HEPES, pH 7.9, 25% glycerol, 420 mM KCl, 1.5 mM MgCl₂, 2 mM EDTA, 2 µg/ml pepstatin, 10 µg/ml aprotinin, 0.5 M DTT, 0.575 mM PMSF, and 2 µg/ml leupeptin), and incubated on ice for 15 min. The samples were then centrifuged at 14,000g for 3 min at 4°C to obtain supernatants containing the nuclear fractions. Nuclear extracts were resuspended in 60 µl of buffer D (20 mM HEPES, pH 7.9, 25% glycerol, 0.2 mM EDTA, 2 µg/ml pepstatin, 10 µg/ml aprotinin, 0.5 M DTT, 0.575 mM PMSF, and 2 µg/ml leupeptin). Extracts were stored at -70°C until further analysis. Protein concentrations of nuclear extracts were determined by the Bradford assay using the Bio-Rad protein assay kit (Bio-Rad, Mississauga, ON, Canada).

Western Blot Analysis and Immunoprecipitation. CYP2A6 was identified in cell extracts of primary human hepatocytes and GR and HNF4 proteins from nuclear extracts of HeLa cells by Western blot analysis as described previously (Romero et al., 2002). In brief, 15 µg of protein from cell or nuclear extracts was separated by SDS-PAGE on a 12% polyacrylamide gel, transferred to nitrocellulose, and incubated for 1 h with monoclonal antibodies to human CYP2A6 (BD Biosciences, Mississauga, ON, Canada) at a dilution of 1:2000, and with polyclonal antibodies against HNF4 (H-171) or GR (H-300) (Santa Cruz Biotechnology, Inc.) at a dilution of 1:200. After incubation with either goat anti-mouse (CYP2A6) or goat anti-rabbit (GR and HNF4) peroxidase secondary antibody (Vector Laboratories, Burlington, ON, Canada), bands were detected by chemiluminescence (ECL Plus; GE Healthcare) and visualized using a Typhoon 9410 scanner (GE Healthcare). The nitrocellulose membrane was later stained with Amido Black (Bio-Rad) staining solution to ensure equal loading of protein. The relative amounts of HNF4 protein levels were subsequently determined by densitometry using National Institutes of Health ImageJ software (http://rsb.info.nih.gov/ij/). Three independent experiments were performed, and Western blots are presented from one representative experiment.

GR protein was immunoprecipitated from nuclear extracts prepared from 100 nM DEX-treated HeLa cells using a Nuclear Complex Co-IP kit (Active Motif Inc., Carlsbad CA). Nuclear protein levels were quantified using the Bradford assay (Bradford 1976), and 170 µg of nuclear extract was combined with 1 µg of anti-GR antibody (Santa Cruz Biotechnology, Inc.) diluted to 500 µl in immunoprecipitation incubation buffer in low-stringency conditions and incubated overnight at 4°C with gentle rotation. The antibody-protein mix was then incubated with 10 µl of protein A/G antibody binding beads (Santa Cruz Biotechnology, Inc.) at 4°C. The bead pellet was washed several times followed by centrifugation, and pellets were resuspended in SDS-PAGE loading dye and boiled for 5 min in preparation for SDS-PAGE and Western blotting.

Electrophoretic Mobility Shift Assay. Protein binding reactions were carried out in a 20-µl volume using 10 µg of nuclear extract and the Gel Shift Assay kit (Promega) according to the manufacturer's instructions. For competition studies, samples were incubated with a 50-fold molar excess of unlabeled oligonucleotide. The sequence of the HNF4-RE double-stranded oligonucleotide probe used for the gel shift assay was 5'-GTTGGGAGGTGAAATGAGGTAAT-3'. Competitor probe sequences were as follows: Sp1, 5'-ATTCGATCGGGGCGGGGCGAGC-3'; ApoCIII, 5'-CGAGCGCTG-GGCAAAGGTCACCTGC-3'; and CYP2A6HNF4-RE, 5'-GTAATCAGCCAAAGTCCATCCCTCT-3'.

In competition experiments, a 50-fold excess of the unlabeled oligonucleotides reaction mixes was preincubated with unlabeled oligonucleotides before adding the radiolabeled probe. In the supershift experiment, 2 µg of anti-HNF4 polyclonal antibody was added to the binding reaction and incubated at 4°C for 1 h. The DNA-protein complexes were resolved on a 6% acrylamide gel in 0.5x TBE buffer at 200 V for 19 min. The gel was dried and then imaged by phosphorimaging using a Typhoon 9410 scanner (GE Healthcare). The relative amounts of protein-bound ³²P-labeled oligonucleotide were subsequently determined by densitometry using ImageJ software. Samples were analyzed in triplicate, and gel shift assays results presented from one representative experiment.

Streptavidin-Agarose DNA Binding Assay. DNA binding reactions (100 µl) were carried out using 50 µg of nuclear extract with 5 µg of a biotinylated double-stranded CYP2A6 HNF4 RE probe (Invitrogen Canada Inc.) consisting of the same CYP2A6 HNF4 RE sequence indicated in EMSA above and incubated with 200 µl of 50% streptavidin-agarose beads (Novagen, Madison, WI). The samples were incubated at room temperature with mixing for 1 h. Samples were then centrifuged at 5000g for 30 s and washed three times with ice-cold phosphate-buffered saline before being resuspended in 50 µl of Western loading dye. Samples were then analyzed for the presence of bound HNF4 and GR protein by Western blotting as described above.

View larger version (23K): [in this window] [in a new window]   Fig. 1. Dex-mediated induction of CYP2A6 mRNA in human primary hepatocytes occurs via the GR. A and B, primary human hepatocytes were treated for 24 h with 100 nM DEX and/or 100 nM RU486. C, primary human hepatocytes were treated for 24 h with 100 nM DEX in the presence of absence of 10 µg/ml cycloheximide. Differences in CYP2A6 (A and C) and TAT mRNA (B) levels were determined by real-time RT-PCR and normalized to GAPDH mRNA levels as described under Materials and Methods. A, inset, primary human hepatocytes were treated with DEX (1, 10, and 100 nM), and cell extracts were assessed for CYP2A6 protein expression by Western blot analysis as described under Materials and Methods. Values represent the mean + S.E. of results from four different primary human hepatocyte cultures (A and B) or three independent experiments of a single culture of human hepatocytes (C) expressed relative to control hepatocytes. *, p < 0.05, significantly from controls. , p < 0.05significantly from cells treated with 100 nM DEX.

Statistical Analysis. Statistically significant differences among groups were identified by one-way analysis of variance. Data were further evaluated by Fisher's least significant difference test if groups were found to be significant. Significance was established at p < 0.05.

	Results

Top Abstract Materials and Methods Results Discussion References

 
DEX-Mediated Induction of CYP2A6 mRNA in Human Primary Hepatocytes Occurred via the GR. To determine the influence of glucocorticoids on CYP2A6 expression, human hepatocytes in primary culture were treated for 24 h with DEX (100 nM) and CYP2A6 mRNA levels were assessed by real-time RT-PCR (Fig. 1A). Increases in CYP2A6 protein were also observed in human hepatocytes treated with increasing concentrations of DEX (Fig. 1A, inset). Messenger RNA levels for tyrosine aminotransferase (TAT) gene, a conventional biomarker of glucocorticoid genomic effects was also determined (Fig. 1B). DEX treatment resulted in a 3.3-fold increase in CYP2A6 mRNA and a 5.5-fold increase in TAT mRNA relative to control hepatocytes (p < 0.05). Cotreatment with the GR antagonist RU486 significantly attenuated the DEX-mediated induction in CYP2A6 and TAT mRNA levels (p < 0.05). CYP2A6 and TAT mRNA levels were not significantly altered by RU486 treatment alone.

To determine whether induction of CYP2A6 mRNA by DEX was mediated directly or indirectly by the GR, we assessed whether de novo protein synthesis was necessary. Hepatocytes were treated with 100 mM DEX in the presence or absence of cycloheximide, a typical inhibitor of protein synthesis and CYP2A6 mRNA was assessed by real-time RT-PCR. In Fig. 1C, we show that cycloheximide had no effect on the 9-fold induction of CYP2A6 by DEX. These findings suggest that CYP2A6 induction by DEX is not dependent on de novo protein synthesis and occurs either in direct response to hGR or the interaction of hGR with transcriptional coactivators.

Responsiveness to DEX-Mediated CYP2A6 Transactivation Was Localized to the Proximal Promoter. To determine whether DEX elevates CYP2A6 mRNA levels by increasing the transcriptional activity of the CYP2A6 promoter, reporter gene assays were performed in HeLa cells, which constitutively express the endogenous GR, transfected with p2A6-2469 + 12-LUC. Treatment of transfectants with DEX resulted in a dose-dependent increase (p < 0.05) in luciferase activity to a maximum of 3.2-fold at a concentration of 1000 nM (Fig. 2A). Treatment with RU486 attenuated the DEX-mediated transactivation differing significantly from cells treated with 1 µM DEX only (p < 0.05). The response of cells transfected with p2A6-2469 + 12-LUC was similar to findings in HeLa cells transfected with pTAT-GRE-luc in which a 4-fold induction of luciferase activity (p < 0.05) was observed after treatment with 1 µM DEX, a response that was abolished by RU486.

View larger version (22K): [in this window] [in a new window]   Fig. 2 Responsiveness to DEX-mediated CYP2A6 transactivation is localized to the proximal promoter. A, HeLa cells were transiently transfected with p2A6-2469-LUC (solid bars) and treated for 24 h with DEX ± RU486. B, luciferase reporter constructs incorporated various lengths of the 5'-UTR of CYP2A6 were transiently transfected into HeLa cells and treated with 100 nM DEX for 24 h. Cell extracts were assayed for luciferase activity, which was normalized to Renilla luciferase activity. Cell extracts were assayed for luciferase activity that was normalized to Renilla luciferase activity. As a positive control, HeLa cells were transiently transfected with pTAT-TK-GRE-LUC (open bars) and treated with DEX and/or RU486. *, p < 0.05, significantly different from controls. , p < 0.05, significantly different from cells treated with 1000 nM DEX.

To delineate the location responsible for DEM-mediated transactivation of CYP2A6, HeLa cells were transfected with reporter plasmids containing progressive deletions of the CYP2A6 5'-flanking region and treated with 100 nM DEX. All deletion constructs, including the smallest consisting of -95 to +12 base pairs of the CYP2A6 promoter, responded to DEX with significant increases in luciferase activity (Fig. 2B). Accordingly, treatment of transfectants with RU486 inhibited the DEX-mediated transactivation of these regions (data not shown).

DEX-Mediated Increases in CYP2A6 Transcriptional Activity Occurred via an HNF4-RE. Although DEX responsiveness was localized to the proximal CYP2A6 promoter, computer analysis of this region failed to identify a putative GRE. However, an HNF4-RE present in this region has previously been shown to be pivotal in the transcriptional regulation of CYP2A6 (Pitarque et al., 2005). To determine whether the HNF4-RE plays a role in DEX-responsiveness, the HNF4-RE within p2A6-2469-LUC was mutated by site-directed mutagenesis and used in luciferase reporter assays as described above. Treatment of cells transfected with p2A6-2469HNF4 with increasing concentrations of DEX did not have any significant effect on luciferase activity (Fig. 3A). To confirm the role of HNF4-RE in CYP2A6 transcriptional activation, HeLa cells were cotransfected with p2A6-2469-LUC and increasing amounts of the expression plasmid pHNF4. (Fig. 3B). Without HNF4 overexpression (control in Fig. 3B), basic luciferase activity was reduced by approximately 50% in cells transfected with p2A6-2469-HNF4-LUC compared with transfectants with p2A6-2469-LUC. HNF4 overexpression resulted in dose-dependent increases (p < 0.01) in luciferase activity up to 3-fold of control levels; however, mutation of the HNF4-RE abolished this increase.

View larger version (20K): [in this window] [in a new window]   Fig. 3. The HNF4-RE is necessary for DEX-mediated CYP2A6 transactivation. A, site-directed mutagenesis of the CYP2A6 HNF4 site abrogates the DEX-mediated luciferase response. HeLa cells were transiently cotransfected with p2A6-2469-HNF4-LUC and treated for 24 h with DEX and/or 100 nM RU486. B, HNF4 overexpression induces CYP2A6 transactivation. HeLa cells were transiently cotransfected with either p2A6-2469-LUC (solid bars) or p2A6-2469-HNF4-LUC (open bars) and increasing amounts of pHNF4. Cell extracts were assayed for luciferase activity, which was normalized to Renilla luciferase activity. **, p < 0.01, significantly different from control cells with no HNF4 overexpression. , p < 0.05, significantly different from cells transfected with p2A6-2469-LUC and corresponding amounts of pHNF4.

View larger version (29K): [in this window] [in a new window]   Fig. 4. Effect of DEX on HNF4 expression levels in primary human hepatocytes. Hepatocytes were treated for 24 h with 100 nM DEX and/or 100 nM RU486. HNF4 mRNA and protein levels were assessed by real-time RT-PCR (A) and Western blot analysis (B), respectively, as described under Materials and Methods. Messenger RNA levels represent the mean + S.E. of four different hepatocyte cultures relative to untreated hepatocytes. For Western blots, the mean band intensities are shown from three independent experiments from different hepatocyte cultures assessed by densitometry and expressed relative to untreated controls. A representative western blot is shown. *, p < 0.05, significantly different from controls.

View larger version (64K): [in this window] [in a new window]   Fig. 5. DEX increases GR protein and interaction with HNF in nuclei of HeLa cells. A, HeLa cells were treated for 24 h with increasing concentrations of DEX (1, 10, and 100 nM), and Western blot analyses were performed on nuclear extracts using antibodies to GR and or HNF4 and HNF4β. B, GR protein was immunoprecipitated from nuclear extracts of HeLa cells and cell extracts of human hepatocytes cultured in the presence or absence of 100 nM DEX. Western blotting was then performed on immunoprecipitates using antibodies to HNF as described under Materials and Methods. Blots represent the results of two experiments with similar results.

DEX Increased Binding of HNF to the HNF4-RE in the CYP2A6 Promoter. To determine whether DEX increases CYP2A6 transcription by increasing binding of HNF4 to the HNF4-RE in the proximal CYP2A6 promoter, EMSA was performed by incubating nuclear extracts from control and DEX-treated human hepatocytes with a radiolabeled HNF4-RE probe (Fig. 6A). The shift of HNF4-RE probe-protein complexes observed with nuclear extracts from control cells was abolished in the presence of 50-fold excess of nonradioactive HNF4-RE probe (CYP2A6 HNF4-RE) and a probe consisting of the well characterized HNF-4-RE in the apoCIII gene promoter. However, the mutated probe (CYP2A6 HNF4-RE) and the nonspecific competitor probe (Sp1) had no effect. The presence of a supershift with the use of polyclonal antibodies identified HNF4 as the protein forming the HNF4-RE probe-protein complex.

View larger version (61K): [in this window] [in a new window]   Fig. 6. DEX increases binding of HNF4-GR complexes to the HNF4-RE in human hepatocytes. A, EMSA analysis of nuclear extracts from DEX-treated primary human hepatocytes. In EMSA experiments, nuclear extracts from human hepatocytes that were either untreated (control), treated with 100 nM DEX or from HeLa cells transfected with an HNF4 expression vector (HeLa + pHNF4) were incubated with a 32P-labeled HNF4-RE oligonucleotide probe and electrophoresed on a 6% polyacrylamide gel as described under Materials and Methods. Competition experiments comprised a radiolabeled probe incubated with nuclear extract from DEX-treated human hepatocytes and 50-fold excess of various unlabeled oligonucleotides in the binding reaction. Shifted (S) and supershifted (SS) probe-protein complexes are indicated by arrowheads. B, DNA binding reactions for the identification of interaction HNF4-GR complexes with HNF4-RE probes. Nuclear extracts from HeLa cells treated with increasing concentrations of DEX were incubated with a biotinylated HNF4-RE probe. Binding reactions were then incubated with streptavidin-agarose, and protein bound to the biotinylated probe was analyzed by Western blot analysis using polyclonal antibodies to HNF4 or GR.

To determine whether both HNF4 and GR were associated with the HNF4-RE and to determine the capacity of increasing concentrations of DEX to alter HNF4-HNF4-RE complex formation, a DNA binding assay using a biotinylated HNF4-RE probe nuclear extracts from DEX-treated HeLa cells was performed (Fig. 6B). Proteins bound to the HNF4-RE were identified by purifying the biotinylated probes on streptavidin-agarose beads followed by immunoblot analysis using polyclonal antibodies to either human HNF4 or GR. DEX treatment resulted in a dose-related increase in HNF4 and GR binding to HNF4-RE to levels up to a maximum of 2.5-fold and 1.9-fold higher than controls.

DEX Increased Histone H4 Acetylation and HNF4 Binding to the Proximal CYP2A6 Promoter in Human Hepatocytes. Histone acetylation results in chromatin structure relaxation, allowing for greater accessibility of transcription factors and gene transactivation. Using the ChIP assay, we investigated the degree of histone acetylation in the proximal CYP2A6 promoter in human hepatocytes (Fig. 7A). We also determined the extent to which HNF4 binds to the HNF4-RE in the CYP2A6 promoter in the presence and absence of DEX. Hepatocytes were first maintained 16 h in a glucocorticoid-free medium, and then they were treated with 100 nM DEX for 6 h. DEX increased histone H4 acetylation in the proximal CYP2A6 promoter region and binding of HNF4 to this region was also augmented with DEX. The specificity of the ChIP assay was verified using a pair of oligonucleotide primers spanning a region in the distal promoter, far removed from the identified HNF4-RE, for which a DEX-mediated effect was not observed. These data suggest that DEX causes changes in chromatin structure in the vicinity of CYP2A6 promoter, allowing for an increased binding of HNF4 to the HNF4-RE and resulting in increased transcription of the CYP2A6 gene.

View larger version (21K): [in this window] [in a new window]   Fig. 7. DEX increases histone acetylation of the proximal CYP2A6 promoter and binding of HNF4 to this region in human hepatocytes. A, human hepatocytes were cultured in a glucocorticoid-free medium for 24 h. Thereafter, cells were cultured for 6 h with 100 nM DEX. Using a ChIP assay, the association of acetylated histone H4 (AH4) and HNF4 with the CYP2A6 promoter was detected by immunoprecipitation followed by PCR amplification of the proximal (-274 to +28) and distal (-2978 to -2659) regions of the CYP2A6 promoter region. Five microliters of each of the analyzed samples were used for PCR amplification as the input control (Input) before immunoprecipitation. B, HeLa cells were incubated with DEX for 24 h before performing a modified ChIP assay that included dimethyl-3,3-dithiobispropionimidate-2HCl to improve detection of protein-protein interactions by cross-linking primary amines. PCR amplification of samples immunoprecipitated with anti-GR antibodies revealed the presence of GR at the proximal (-274 to +28) CYP2A6 promoter. Input sample DNA was PCR-amplified before immunoprecipitation, and the negative control was immunoprecipitated in the absence of antibodies.

	Discussion

Top Abstract Materials and Methods Results Discussion References

 
The purpose of this study was to investigate the mechanism by which the GR modulates transcriptional regulation of CYP2A6. Several lines of evidence suggest that the GR is involved in the induction of P450 genes. Functional GREs have been identified within the promoter regions of human CYP2C8 (Ferguson et al., 2005), CYP2C9 (Gerbal-Chaloin et al., 2002), and CYP2C19 genes (Chen et al., 2003). However, other investigations have raised concerns regarding glucocorticoid-mediated induction of P450 genes because many genes lack GREs. The results of this study demonstrate that DEX-mediated induction of CYP2A6 occurs via the GR and that it is mediated through interaction of HNF4 with HNF4-RE rather than a GRE.

We present several findings indicating GR-mediated regulation of CYP2A6 gene expression. We observed that induction of CYP2A6 mRNA in primary human hepatocytes treated with DEX paralleled DEX-mediated increases in CYP2A6 promoter transactivation in luciferase reporter assays. Dose-dependent induction of CYP2A6 at submicromolar concentrations of DEX supports GR involvement as the dissociation constant (K_d) for DEX is in the nanomolar range (Hirschelmann et al., 1990; Bernasconi et al., 1997). In addition, cotreatment with RU486, a prototypical human GR antagonist, abrogated increases in CYP2A6 mRNA levels, and it significantly inhibited DEX-mediated CYP2A6 transactivation, further implicating the involvement of the GR. Finally, transactivation of the prototypical glucocorticoid-inducible gene TAT was also observed at the same concentrations of DEX. We have reported previously correlations between TAT and CYP2C9 promoter responsiveness to DEX in luciferase reporter assays (Gerbal-Chaloin et al., 2002).

Through deletion analysis of the 5' flanking region of CYP2A6, we delineated the region of DEX responsiveness to the proximal promoter region (-95 to +12). However, computer analysis of this region failed to identify GRE equivalents, suggesting that the observed DEX responsiveness was due to a nonconventional glucocorticoid response. Site-directed mutagenesis of an HNF4-RE within the proximal promoter abrogated the DEX-mediated transactivation of CYP2A6, thereby confirming this suspicion. It has been previously demonstrated, by adenovirus-mediated antisense targeting in cultured human primary hepatocytes, that HNF4 is a general activator of CYP2A6 (Pitarque et al., 2005). HNF4-REs have also been identified in the 5' flanking region of the hCYP2C8 (Ferguson et al., 2005) and hCYP2C9 (Chen et al., 2005) genes. In addition, CYP2A5 the mouse ortholog of CYP2A6 is regulated by HNF4 through an HNF4-RE identified at position -63 to -47 within the proximal promoter (Ulvila et al., 2004) that displays considerable sequence homology with the CYP2A6 HNF4-RE. Thus, the current study confirms the role of HNF4 in transcriptional regulation of CYP2A6, and it suggests that GR may contribute to CYP2A6 induction by interacting with HNF4.

There are several possible mechanisms by which DEX influences HNF4-mediated CYP2A6 transcriptional activation, including GR-mediated up-regulation of HNF4 expression, increased access to and/or binding of HNF4 to the HNF4-RE or various combinations thereof. Several of our findings suggest that increased expression of HNF4 is not required for GR-mediated induction of CYP2A6. Although DEX increased HNF4 mRNA levels in primary human hepatocytes, HNF4 nuclear protein levels were clearly not altered. Moreover, cycloheximide treatment did not reduce DEX-mediated increases in CYP2A6 transcript levels, indicating that synthesis of de novo protein is not required for CYP2A6 transcription. Results of ChIP assays demonstrated that DEX treatment facilitates binding of HNF4 to the HNF4-RE perhaps by increasing histone H4 acetylation, thereby altering chromatin structure and enhancing accessibility to the CYP2A6 proximal promoter. We have previously shown a similar DEX-mediated increase in histone H4 acetylation in the proximal CAR promoter (Assenat et al., 2004). However, changes in histone H4 acetylation cannot explain the effect of DEX on HNF4 interactions with HNF4-RE observed in EMSA and luciferase reporters assays in which the true chromatin structure is not present.

Although HNF4 is clearly required for DEX-mediated induction of CYP2A6, the precise relationship between GR and HNF4 in facilitating binding to the HNF4-RE is currently unclear. Previous studies have shown that high-affinity binding of GR to the phosphoenolpyruvate carboxykinase gene promoter is strictly dependent on associated accessory factor elements, including HNF4 (Stafford et al., 2001). Moreover, we have recently shown that CYP3A4 and CYP2C9 promoters are activated by GR in placental cells only after cotransfection with HNF4 (Pavek et al., 2007). However, the novelty of the findings of the current study is that the mechanism by which GR and HNF4 cooperatively transactivate CYP2A6 is independent of a GRE. Nevertheless, direct GR-DNA interactions may not be necessary for CYP2A6 transactivation because GR may act through the formation of complexes with HNF4 and possibly other coactivators of transcription. Results of the ChIP and streptavidin DNA binding assays indicate that both HNF4 and GR are present at the HNF4-RE suggesting that GR may perform a tethering role through direct protein-protein interaction that stimulates transcriptional activity of HNF4. Such a physical interaction has been observed with GR and the chicken ovalbumin upstream promoter-transcription factor II that plays a critical role in the metabolism of glucose, cholesterol, and xenobiotics (De Martino et al., 2004). Moreover, the Glucocorticoid receptor interacting protein 1 (GRIP1) in known to associate with the HNF4 receptor (Wang et al., 1998) and the GR (Li et al., 2003), raising the possibility that activated GR may recruit GRIP1 to act as a bridging factor between the GR and HNF4, resulting in transactivation via the HNF4-RE. However, a necessary assumption would be that interaction between the GR and GRIP1 occurs independently of a GRE. In preliminary streptavidin DNA binding experiments using biotinylated HNF4-RE probes, we have shown that complexes among GR, HNF4, and GRIP1 do occur at the HNF4-RE.

In conclusion, the results of this study demonstrate that DEX-mediated induction of CYP2A6 occurs by transcriptional activation via a mechanism involving the GR and enhanced interactions between HNF4 and an HNF4-RE present in the proximal CYP2A6 promoter. Glucocorticoid-mediated induction of CYP2A6 expression has profound implications on the rate of nicotine metabolism and clearance and tobacco dependence.

	Footnotes

 
This research was funded by the Natural Sciences and Engineering Research Council of Canada.

ABBREVIATIONS: P450, cytochrome P450; GRE, glucocorticoid response element; GR, glucocorticoid receptor; DEX, dexamethasone; HNF4, hepatic nuclear factor 4; HNF4-RE, HNF4 response element; RU486, mifepristone, 17β-hydroxy-11β-[4-dimethylamino phenyl]-17-[1-propynyl]estra-4,9-dien-3-one; RT-PCR, reverse transcription-polymerase chain reaction; PCR, polymerase chain reaction; UTR, untranslated region; DTT, dithiothreitol; PMSF, phenylmethylsulfonyl fluoride; PAGE, polyacrylamide gel electrophoresis; EMSA, electrophoretic mobility shift assay(s); ChIP, chromatin immunoprecipitation; DTBP, dimethyl-3,3-dithiobispropionimidate-2HCl; TAT, tyrosine aminotransferase; GRIP, glucocorticoid receptor interacting protein; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

Address correspondence to: Dr. Gordon M. Kirby, Department of Biomedical Sciences, University of Guelph, Guelph, ON, Canada, N1G 2W1. E-mail: gkirby{at}uoguelph.ca

	References

Top Abstract Materials and Methods Results Discussion References

 
Assenat E, Gerbal-Chaloin S, Larrey D, Saric J, Fabre JM, Maurel P, Vilarem MJ, and Pascussi JM (2004) Interleukin 1beta inhibits CAR-induced expression of hepatic genes involved in drug and bilirubin clearance. Hepatology 40: 951-960.[CrossRef][Medline]

Bernasconi AG, Rebuffat AG, Lovati E, Frey BM, Frey FJ, and Galli I (1997) Cortisol increases transfection efficiency of cells. FEBS Lett 419: 103-106.[CrossRef][Medline]

Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72: 248-254.[CrossRef][Medline]

Chen Y, Ferguson SS, Negishi M, and Goldstein JA (2003) Identification of constitutive androstane receptor and glucocorticoid receptor binding sites in the CYP2C19 promoter. Mol Pharmacol 64: 316-324.[Abstract/Free Full Text]

Chen Y, Kissling G, Negishi M, and Goldstein JA (2005) The nuclear receptors constitutive androstane receptor and pregnane X receptor cross-talk with hepatic nuclear factor 4alpha to synergistically activate the human CYP2C9 promoter. J Pharmacol Exp Ther 314: 1125-1133.[Abstract/Free Full Text]

De Martino MU, Alesci S, Chrousos GP, and Kino T (2004) Interaction of the glucocorticoid receptor and the chicken ovalbumin upstream promoter-transcription factor II (COUP-TFII): implications for the actions of glucocorticoids on glucose, lipoprotein, and xenobiotic metabolism. Ann N Y Acad Sci 1024: 72-85.[CrossRef][Medline]

Dignam JD, Lebovitz RM, and Roeder RG (1983) Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res 11: 1475-1489.[Abstract/Free Full Text]

Ferguson SS, Chen Y, LeCluyse EL, Negishi M, and Goldstein JA (2005) Human CYP2C8 is transcriptionally regulated by the nuclear receptors constitutive androstane receptor, pregnane X receptor, glucocorticoid receptor, and hepatic nuclear factor 4. Mol Pharmacol 68: 747-757.[Abstract/Free Full Text]

Gerbal-Chaloin S, Daujat M, Pascussi JM, Pichard-Garcia L, Vilarem MJ, and Maurel P (2002) Transcriptional regulation of CYP2C9 gene. Role of glucocorticoid receptor and constitutive androstane receptor. J Biol Chem 277: 209-217.[Abstract/Free Full Text]

Hirschelmann R, Schade R, Burger W, and Bekemeier H (1990) Nonspecific action of glucocorticosteroids after high-dose pulse therapy? Agents Actions 31: 148-151.[CrossRef][Medline]

Kamataki T, Fujieda M, Kiyotani K, Iwano S, and Kunitoh H (2005) Genetic polymorphism of CYP2A6 as one of the potential determinants of tobacco-related cancer risk. Biochem Biophys Res Commun 338: 306-310.[CrossRef][Medline]

Kirby GM, Batist G, Alpert L, Lamoureux E, Cameron RG, and Alaoui JMA (1996) Overexpression of cytochrome P-450 isoforms involved in aflatoxin B1 bioactivation in human liver with cirrhosis and hepatitis. Toxicol Pathol 24: 458-467.[Abstract/Free Full Text]

Li X, Wong J, Tsai SY, Tsai MJ, and O'Malley BW (2003) Progesterone and glucocorticoid receptors recruit distinct coactivator complexes and promote distinct patterns of local chromatin modification. Mol Cell Biol 23: 3763-3773.[Abstract/Free Full Text]

Malaiyandi V, Sellers EM, Tyndale RF, Nakajima M, Kuroiwa Y, and Yokoi T (2005) Implications of CYP2A6 genetic variation for smoking behaviors and nicotine dependence. Clin Pharmacol Ther 77: 145-158.[CrossRef][Medline]

Nakajima M, Kuroiwa Y, and Yokoi T (2002) Interindividual differences in nicotine metabolism and genetic polymorphisms of human CYP2A6. Drug Metab Rev 34: 865-877.[CrossRef][Medline]

Pascussi JM, Busson-Le Coniat M, Maurel P, and Vilarem MJ (2003) Transcriptional analysis of the orphan nuclear receptor constitutive androstane receptor (NR1I3) gene promoter: identification of a distal glucocorticoid response element. Mol Endocrinol 17: 42-55.[Abstract/Free Full Text]

Pavek P, Cerveny L, Svecova L, Brysch M, Libra A, Vrzal R, Nachtigal P, Staud F, Ulrichova J, Fendrich Z, et al. (2007) Examination of glucocorticoid receptor alpha-mediated transcriptional regulation of P-glycoprotein, CYP3A4, and CYP2C9 genes in placental trophoblast cell lines. Placenta 28: 1004-1011.[CrossRef][Medline]

Pelkonen O, Rautio A, Raunio H, and Pasanen M (2000) CYP2A6: a human coumarin 7-hydroxylase. Toxicology 144: 139-147.[CrossRef][Medline]

Pianezza ML, Sellers EM, and Tyndale RF (1998) Nicotine metabolism defect reduces smoking. Nature 393: 750.[CrossRef][Medline]

Pichard-Garcia L, Gerbal-Chaloin S, Ferrini JB, Fabre JM, and Maurel P (2002) Use of long-term cultures of human hepatocytes to study cytochrome P450 gene expression. Methods Enzymol 357: 311-321.[CrossRef][Medline]

Pitarque M, Rodriguez-Antona C, Oscarson M, and Ingelman-Sundberg M (2005) Transcriptional regulation of the human CYP2A6 gene. J Pharmacol Exp Ther 313: 814-822.[Abstract/Free Full Text]

Pitarque M, von Richter O, Oke B, Berkkan H, Oscarson M, and Ingelman-Sundberg M (2001) Identification of a single nucleotide polymorphism in the TATA box of the CYP2A6 gene: impairment of its promoter activity. Biochem Biophys Res Commun 284: 455-460.[CrossRef][Medline]

Raunio H, Rautio A, Gullsten H, and Pelkonen O (2001) Polymorphisms of CYP2A6 and its practical consequences. Br J Clin Pharmacol 52: 357-363.[CrossRef][Medline]

Raunio H, Rautio A, and Pelkonen O (1999) The CYP2A subfamily: function, expression and genetic polymorphism. IARC Sci Publ 1999: 197-207.

Romero L, Higgins MA, Gilmore J, Boudreau K, Maslen A, Barker HJ, and Kirby GM (2002) Down-regulation of alpha class glutathione S-transferase by interleukin-1beta in human intestinal epithelial cells (Caco-2) in culture. Drug Metab Dispos 30: 1186-1193.[Abstract/Free Full Text]

Sellers EM, Tyndale RF, and Fernandes LC (2003) Decreasing smoking behaviour and risk through CYP2A6 inhibition. Drug Discov Today 8: 487-493.[CrossRef][Medline]

Sotaniemi EA, Rautio A, Backstrom M, Arvela P, and Pelkonen O (1995) CYP3A4 and CYP2A6 activities marked by the metabolism of lignocaine and coumarin in patients with liver and kidney diseases and epileptic patients. Br J Clin Pharmacol 39: 71-76.[Medline]

Stafford JM, Wilkinson JC, Beechem JM, and Granner DK (2001) Accessory factors facilitate the binding of glucocorticoid receptor to the phosphoenolpyruvate carboxykinase gene promoter. J Biol Chem 276: 39885-39891.[Abstract/Free Full Text]

Tutka P, Mosiewicz J, and Wielosz M (2005) Pharmacokinetics and metabolism of nicotine. Pharmacol Rep 57: 143-153.[Medline]

Ujjin P, Satarug S, Vanavanitkun Y, Daigo S, Ariyoshi N, Yamazaki H, Reilly PE, Moore MR, and Kamataki T (2002) Variation in coumarin 7-hydroxylase activity associated with genetic polymorphism of cytochrome P450 2A6 and the body status of iron stores in adult Thai males and females. Pharmacogenetics 12: 241-249.[CrossRef][Medline]

Ulvila J, Arpiainen S, Pelkonen O, Aida K, Sueyoshi T, Negishi M, and Hakkola J (2004) Regulation of Cyp2a5 transcription in mouse primary hepatocytes: roles of hepatocyte nuclear factor 4 and nuclear factor I. Biochem J 381: 887-894.[CrossRef][Medline]

Wang J, Pitarque M, Ingelman-Sundberg M, Rodriguez-Antona C, and Oscarson M (2006) 3'-UTR polymorphism in the human CYP2A6 gene affects mRNA stability and enzyme expression. Biochem Biophys Res Commun 340: 491-497.[CrossRef][Medline]

Wang JC, Stafford JM, and Granner DK (1998) SRC-1 and GRIP1 coactivate transcription with hepatocyte nuclear factor 4. J Biol Chem 273: 30847-30850.[Abstract/Free Full Text]

This article has been cited by other articles:

				N. Anderson and J. Borlak Molecular Mechanisms and Therapeutic Targets in Steatosis and Steatohepatitis Pharmacol. Rev., September 1, 2008; 60(3): 311 - 357. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: mol.107.039354v1 73/2/451    most recent Submit a response Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Onica, T. Articles by Kirby, G. M. Search for Related Content PubMed PubMed Citation Articles by Onica, T. Articles by Kirby, G. M.