MolPharm

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
 QUICK SEARCH:   [advanced]


     


Molecular Pharmacology Fast Forward
First published on November 16, 2007; DOI: 10.1124/mol.107.039099


0026-895X/08/7302-607-612$20.00
Mol Pharmacol 73:607-612, 2008

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
mol.107.039099v1
73/2/607    most recent
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Stayrook, K. R.
Right arrow Articles by Burris, T. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Stayrook, K. R.
Right arrow Articles by Burris, T. P.

Regulation of Human 3{alpha}-Hydroxysteroid Dehydrogenase (AKR1C4) Expression by the Liver X Receptor {alpha}

Keith R. Stayrook, Pamela M. Rogers, Rajesh S. Savkur1, Yongjun Wang, Chen Su, Gabor Varga, Xin Bu, Tao Wei, Sunil Nagpal2, Xiaole Shirley Liu, and Thomas P. Burris

Nuclear Receptor Biology Laboratory, Pennington Biomedical Research Center, Louisiana State University System, Baton Rouge, Louisiana (P.M.R., Y.W., T.P.B.); Lilly Research Laboratories, Lilly Corporate Center, Indianapolis, Indiana (K.R.S., R.S.S., X.B., S.N.); Lilly Research Laboratories, Greenfield, Indiana (C.S., G.V.); and Department of Biostatistics and Computational Biology, Dana-Farber Cancer Institute, Boston, MA (X.S.L.)

Received for publication June 15, 2007.

Accepted for publication November 15, 2007.


    Abstract
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Type I human hepatic 3{alpha}-hydroxysteroid dehydrogenase (AKR1C4) plays a significant role in bile acid biosynthesis, steroid hormone metabolism, and xenobiotic metabolism. Utilization of a hidden Markov model for predictive modeling of nuclear hormone receptor response elements coupled with chromatin immunoprecipitation/microarray technology revealed a putative binding site in the AKR1C4 promoter for the nuclear hormone receptor known as liver X receptor {alpha}, (LXR{alpha} [NR1H3]), which is the physiological receptor for oxidized cholesterol metabolites. The putative LXR{alpha} response element (LXRE), identified by chromatin immunoprecipitation, was ~1.5 kilobase pairs upstream of the transcription start site. LXR{alpha} was shown to bind specifically to this LXRE and mediate transcriptional activation of the AKR1C4 gene, leading to increased AKR1C4 protein expression. These data suggest that LXR{alpha} may modulate the bile acid biosynthetic pathway at a unique site downstream of CYP7A1 and may also modulate the metabolism of steroid hormones and certain xenobiotics.


Human 3{alpha}-hydroxysteroid dehydrogenases (3{alpha}-HSD), members of the aldo-keto reductase (AKR) enzyme superfamily, are essential enzymes in metabolic pathways, including the biosynthesis of bile acids and the metabolism of steroid hormones and xenobiotics. AKRs are soluble NAD(P)(H) oxidoreductases that reduce aldehydes and ketones to primary and secondary alcohols. Type I 3{alpha}-HSD (AKR1C4) displays a pattern of liver-specific expression and functions both to produce intermediates in bile acid biosynthesis and inactivate circulating steroid hormones (Penning et al., 2000Go). AKR1C4 protects against circulating steroid hormone excess by catalyzing the reduction of 3-ketosteroids to 3{alpha}-hydroxysteroids (Jin and Penning, 2007Go). In addition, AKR1C4 catalyzes the production of 3{alpha},7{alpha},12{alpha}-trihydroxy-5β-cholestane, a committed precursor within the bile acid biosynthetic pathway, from 7{alpha},12{alpha}-diihydroxy-5β-cholestan-3-one.

The liver X receptors (LXR{alpha} [NR1H3] and LXRβ [NR1H2]) are members of the nuclear hormone receptor (NHR) superfamily and function as ligand-activated transcription factors. Both LXR{alpha} and LXRβ are expressed in the liver (with LXR{alpha} levels significantly higher than LXRβ levels) and function as physiological receptors for oxidized cholesterol metabolites, oxysterols. LXRs play an important role in the regulation of bile acid biosynthesis by either directly (most rodents) or indirectly (primates) regulating the expression of CYP7A1, the rate-limiting enzyme in bile acid biosynthesis (Chiang, 2004Go). Because production of bile acids from cholesterol is the metabolic pathway for degradation of cholesterol, LXRs serve as "cholesterol sensors" to provide levels of CYP7A1 expression that maintain appropriate concentrations of cholesterol. In addition to their roles in bile acid biosynthesis, LXRs regulate an array of genes involved in cholesterol and lipid synthesis and transport (Michael et al., 2005Go).

In this study, we use a combination of LXRE predictive modeling and ChIP/microarray technology to identify AKR1C4 as a potential direct target gene of the nuclear hormone receptor LXR{alpha}. LXR{alpha} directly regulates the expression of the human AKR1C4 gene. Because AKR1C4 is involved in bile acid biosynthesis, our finding suggests a novel mechanism by which oxysterols might modulate the rate of bile acid production and, hence, cholesterol degradation. In addition, AKR1C4 plays a key role in hepatic metabolism of steroid hormones; therefore, it is possible that oxysterols influence this pathway via activation of LXR.


Figure 1
View larger version (19K):
[in this window]
[in a new window]

 
Fig. 1. Identification of a putative LXRE immediately upstream of the AKR1C4 gene. A, diagram of the ABCA1 gene indicating regions of significant LXR{alpha} occupancy identified in the ChIP-chip experiment. B, diagram of the AKR1C4 gene indicating regions of significant LXR{alpha} occupancy identified in the ChIP-chip experiment. C, sequence of the DR4 element identified by HMM in the AKR1C4 gene. D, sequence comparison of the putative AKR1C4 LXRE to the Cyp7a1 LXRE. HMM scores are indicated.

 

    Materials and Methods
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Cell Culture and mRNA/Protein Measurement. HuH7 and HepG2 cells were maintained in Dulbecco's modified Eagle's medium/Ham's F12 (1:3) supplemented with 10% fetal bovine serum at 37°C under 5% CO2. Twenty-four hours before treatment, HuH7 and HepG2 cells were plated in six-well plates in serum-free media (Dulbecco's modified Eagle's medium/Ham's F12, 1:3) at a density of 1 x 106 cells/well. Cells were stimulated with the LXR{alpha} agonist T0901317 (1 µM in 0.1% DMSO). Total cellular RNA was isolated 24 h after stimulation. cDNA synthesized from mRNA was quantified by TaqMan analysis as described previously (Savkur et al., 2005Go; Stayrook et al., 2005Go). AKR1C4 protein levels were assessed by Western blot using an antibody from Abnova (Taipei, Taiwan). LXR{alpha} and control siRNA was obtained from Ambion (Austin, TX).

Plasmid Construction. Full-length untagged LXR{alpha} and LXR{alpha}{Delta}AF2 were constructed by cloning PCR-amplified DNA fragments into the BamHI and EcoRV sites of pcDNA3.1D/V5-His-TOPO (Invitrogen, Carlsbad, CA). The plasmid expressing FLAG-tagged LXR{alpha} was constructed by inserting the PCR product for LXR{alpha} into 3xFLAG pCMV7.1 (Sigma, St. Louis, MO). The 3{alpha}-HSD-tk-Luc reporter plasmid was generated by PCR amplification of human genomic DNA (-1899 to -1226 of the human AKR1C4 promoter region) (Clontech, Mountain View, CA) as the template. The resulting PCR product was inserted between the MluI and BglII sites upstream of the minimal thymidine kinase promoter linked to a luciferase gene (pTA-Luc; Clontech). The mutation of the LXR binding site within the AKR1C4 promoter was obtained by site-directed mutagenesis (Stratagene, La Jolla, CA). All constructs were verified by DNA sequence analysis.

Transient Cotransfection Experiments. Twenty-four hours before transfection, HuH7 cells were plated in serum-free medium in 96-well plates at a density of 15 x 103 cells/well. Each transfection contained 25 ng of the 3{alpha}-HSD-tk-Luc reporter and receptor as described in the figure legend using FuGENE 6 (Roche Molecular Biochemicals, Indianapolis, IN). Sixteen hours after transfection, cells were stimulated with T0901317 (1 µM in 0.1% DMSO). Twenty-four hours after treatment, the luciferase activity was measured using standard luciferase substrate reagents.

Electrophoretic Mobility Shift Assays. LXR{alpha} and RXR{alpha} were expressed using coupled in vitro transcription and translation. EM-SAs were performed using the [{alpha}-32P]dCTP labeled 3{alpha}-HSD LXRE oligonucleotide. Competition assays were performed using various amounts of the unlabeled wild type or the mutant oligonucleotide as described previously (Burris et al., 1995Go).

Chromatin Immunoprecipitation Assays. HuH7cells transfected with either 3xFLAG-tagged LXR{alpha} or 3xFLAG-tagged bacterial alkaline phosphatase (BAP) were subjected to ChIP using standard procedures with M2 mouse monoclonal anti-FLAG antibody (Sigma). The 3{alpha}-HSD promoter region was PCR-amplified using the oligonucleotides 5'-TAATCTCTTGCCAGTGGCATCT-3' (forward) and 5'-CACACAGAGTGTCATCAGCAGG-3' (reverse) to yield a 168-bp product that was analyzed by electrophoresis on a 2% agarose gel. Endogenous LXR{alpha} and acetylated histone H3 chIP analysis was performed in HepG2 cells treated with DMSO or T1317 (1 µM) for 48 h using an anti-LXR{alpha} antibody (Abcam, Cambridge, MA) or anti-acetylated histone H3 antibody (Millipore, Billerica, MA). Precipitated DNA was quantitated using quantitative PCR with the primers indicated above for the promoter or the following AKR1C4 primers for the acetylated histone H3 ChIP: forward, CTGCCTCCTGAGTTTAAGCAAT; reverse, CAAGGCGGTAGGTTTACTTGAG.

ChIP-Chip Analysis. ChIP/microarrays were performed from HuH7 cells transfected and incubated for 48 h with FLAG-tagged LXR{alpha} or FLAG-tagged control vector. Chromatin immunoprecipitations and chromosomal tiling array hybridization was performed by GENpathway, Inc. (San Diego, CA). Immunoprecipitated and amplified chromatin was hybridized to GeneChip Human Tiling 2.0R Array Set (Affymetrix, Inc., Santa Clara, CA). Microarray slides were scanned with the Affymetrix scanner (model 3000) and processed with Affymetrix GeneChip Operating Software (GCOS v1.4). The acquired .CEL files were analyzed with the MAT software v2.0 (Johnson et al., 2006Go). The NCBI36 assembly of the human genome (http://www.ncbi.nlm.nih.gov/mapview/map_search.cgi?taxid=9606) was used to map all Affymetrix probe sets from the GeneChip Human Tiling 2.0R Array Set. The signal intensities of the input DNA and the FLAG-control immunoprecipitated DNA were used as a normalization factor. The bandwidth parameter was set to 1000 bp, and the maximum gap between positive probes was 300 bp. The threshold p value was set to 10-5. The genomic intervals with p values below this threshold were then retrieved from the genomic database and analyzed by the LXRE.HMM predictive model that was developed for the identification of LXR response elements (Varga and Su, 2007Go) to pinpoint candidate LXREs. The LXRE.HMM score cutoff was set to 2.5. Subsequently, the candidate LXREs were compared with known LXREs for further classification. The results from the HMM model and the MAT analysis were integrated and visualized using the Integrated Genome Browser (ver. 4.56; Affymetrix).


    Results
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
By using predictive response element modeling and whole-genome analysis of LXR{alpha} occupancy sites using ChIP/microarray technology, we identified a relatively short region (~2 kb) immediately 5' of the AKR1C4 gene in chromosome 10p15-p14 that displayed significant signal (Fig. 1A). We also identified LXR{alpha} occupancy of several well characterized direct LXR{alpha} target genes, including NR1H3 (Laffitte et al., 2001Go; Whitney et al., 2001Go; Li et al., 2002Go) (Fig. 1B), indicating that the Chip/microarray technology was successful. Analysis of this region in the LXR{alpha} occupancy site within the AKR1C4 gene with the LXRE.HMM model revealed a single putative binding site with two direct repeating half-sites and a 4-bp spacer (DR4) located between positions 1548 and 1533 upstream of the transcription start site. The putative binding site exhibited similarities to the LXRE previously identified in the Cyp7A1 gene (Fig. 1B) (Lehmann et al., 1997Go); the second half-site of the direct repeat was identical to the second half-site of the Cyp7A1 LXRE, whereas the first half-site contained three conserved nucleotides. Two of these three conserved nucleotides were also shown to be completely conserved across all known LXREs. The high degree of nucleotide conservation corroborated the hypothesis that the predicted DR4 site is a novel LXR binding site. To determine whether LXR was capable of binding to the putative AKR1C4 LXRE, EMSAs were performed using in vitro translated LXR{alpha} and RXR{alpha} (Fig. 2). A radiolabeled oligonucleotide spanning the putative LXRE (-1552; Fig. 2B) was not able to bind to either LXR{alpha} or RXR{alpha} alone; however, the LXR{alpha}/RXR{alpha} heterodimer bound as illustrated by a shifted protein/DNA complex (Fig. 2). Furthermore, this shifted band was efficiently competed by the unlabeled oligonucleotide, indicating that LXR{alpha}/RXR{alpha} heterodimer binds to this response element in a specific manner in vitro. Previous studies studying the orientation of LXR{alpha}/RXR{alpha} heterodimer on DNA have demonstrated that LXR{alpha} occupies the 3' half-site of the response element (Willy and Mangelsdorf, 1997Go). To determine the specificity of the LXRE in binding to LXR{alpha}, the LXR binding region within the LXRE was mutated (Fig. 2). Competition binding analysis of this mutant unlabeled oligonucleotide revealed that the shifted band using the radiolabeled wild-type oligonucleotide was not inhibited by even a 100-fold molar excess of the unlabeled mutant oligonucleotide, further demonstrating the specificity of binding of the LXR{alpha}/RXR{alpha} heterodimer to the LXRE in the AKR1C4 promoter.


Figure 2
View larger version (42K):
[in this window]
[in a new window]

 
Fig. 2. LXR{alpha} binds to the AKR1C4 LXRE. The sequence of the oligonucleotide probe corresponding to the putative LXR response element from AKR1C4 and a mutated derivative of the LXR binding site (AKR1C4 LXREmut; mutated bases are underlined in lower case). EMSA was performed using in vitro transcribed/translated LXR{alpha} and RXR{alpha}, as indicated, and the radiolabeled AKR1C4 LXRE (-1552). Competition EMSA was performed with increasing concentrations (5x, 25x, and 100x) of unlabeled AKR1C4 LXRE (-1552) or AKR1C4 LXREmut (-1552mut). The positions of the shifted LXR{alpha}/RXR{alpha} complex and free probe are indicated.

 


Figure 3
View larger version (16K):
[in this window]
[in a new window]

 
Fig. 3. Identification of a functional LXR response element within the AKR1C4 promoter. HuH7 cells were transfected with the human wild-type (AKR1C4 LXRE) or the mutated derivative of the LXR binding site (AKR1C4 LXREmut; mutated bases are underlined in lower case) luciferase reporter plasmid (25 ng) along with 25 ng of a plasmid expressing either full-length LXR{alpha} (LXR{alpha}) or a plasmid expressing a helix 12 deleted LXR{alpha} (LXR{alpha}{Delta}AF2). Sixteen hours after transfection, cells were treated with DMSO or the LXR agonist (T0901317; 1 µM). Twenty-four hours after treatment, cells were harvested and the luciferase activity was measured.

 


Figure 4
View larger version (20K):
[in this window]
[in a new window]

 
Fig. 4. Induction of AKR1C4 by LXR agonists in human hepatoma cells. HuH7 and HepG2 cells were treated with T0901317 (1 µM) or DMSO for 24 h of HuH7 (A) or 6 h of HepG2 (B) followed by assessment of AKR1C4 mRNA expression. Values were normalized to 18S rRNA (HuH7) or GAPDH (glyceraldehyde-3-phosphate dehydrogenase; HepG2) expression.

 
To characterize its LXR responsiveness, a fragment of the AKR1C4 promoter (-1899 to -1226) containing the LXRE was cloned upstream of a minimal promoter directing the expression of a luciferase reporter. As shown in Fig. 3, when cotransfected into HuH7 hepatoma cells along with LXR{alpha}, there is a LXR ligand-dependent induction of luciferase activity. If a mutant of LXR{alpha} lacking the ability to activate transcription (helix 12 deletion-LXR{alpha}{Delta}H12) is used instead of WT LXR{alpha}, the LXR dependence is lost. The identical mutation within the AKR1C4 LXRE that eliminated LXR/RXR binding was introduced into the AKR1C4 promoter reporter and cotransfected into HuH7 cells. All responsiveness to LXR{alpha} was lost, indicating that this LXRE confers LXR responsiveness to the promoter (Fig. 3).


Figure 5
View larger version (53K):
[in this window]
[in a new window]

 
Fig. 5. LXR{alpha} binds to the AKR1C4 LXRE in vivo. Untransfected HuH7 cells (control) or cells transfected with 3xFLAG-tagged LXR{alpha} (LXR{alpha}- or 3xFLAG-tagged BAP) in the absence or presence of the LXR agonist T0901317 (T1317; 1 µM) were subjected to ChIP (upper panel) using an anti-FLAG antibody as described under Materials and Methods. In vivo AKR1C4 promoter occupancy was assessed by PCR amplification of the AKR1C4 promoter regions using the forward and reverse primer sets. The lower panel (Input) represents DNA before immunoprecipitation that has been amplified using the same set of primers.

 
We next examined the ability of the LXR ligand T1317 to induce AKR1C4 expression in two human hepatoma cell lines, HuH7 and HepG2. Cells were treated for 24 h with 1 µM T1317 followed by quantitation of AKR1C4 mRNA by quantitative PCR. Figure 4A shows that AKR1C4 mRNA increases approximately 2.3-fold in HuH7 cells in response to LXR ligand treatment. Consistent with this observation, AKR1C4 mRNA is induced by the same degree in HepG2 cells by the LXR ligand (Fig. 4B). This level of induction is consistent with the degree of induction of other direct LXR target genes, such as PLTP (Laffitte et al., 2003Go). To confirm that LXR{alpha} occupies the LXRE within the AKR1C4 promoter in vivo, we performed a ChIP assay in HuH7 cells that were transiently transfected with an expression vector expressing FLAG-tagged LXR{alpha} or FLAG-tagged BAP as the control. As illustrated in Fig. 5, LXR{alpha} occupancy was observed within the AKR1C4 promoter and no signal was detected in the BAP control. LXR{alpha} occupancy of the site was ligand-independent. LXR agonist treatment (T1317) also induced AKR1C4 protein expression (~2.3-fold) in HepG2 cells after 48 h of treatment (Fig. 6A). Induction of AKR1C4 mRNA was also detected after 48 h of treatment (~1.6-fold) with T1317, and the induction was LXR{alpha}-dependent because knock-down of LXR{alpha} with specific siRNA (~50% decrease in LXR{alpha} expression; Fig. 6B) significantly reduced the T1317 effect (Fig. 6, C and D). We examined the occupancy of the LXRE within the AKR1C4 promoter by endogenously expressed LXR{alpha} in HepG2 cells by ChIP analysis as shown in Fig. 6E. LXR{alpha} was detected in the absence of the agonist, and addition of T1317 led to a significant increase in LXR{alpha} occupancy (Fig. 6E). In addition, we observed an increase in histone H3 acetylation of the AKR1C4 gene when we treated HepG2 cells with T1317 (Fig. 6F). These data, taken together, indicate that the AKR1C4 gene is directly regulated by LXR{alpha} and that regulation is ligand-dependent.


Figure 6
View larger version (31K):
[in this window]
[in a new window]

 
Fig. 6. LXR{alpha} regulates AKR1C4 protein levels. A, Western blot illustrating a 2.3-fold increase in AKR1C4 protein expression in response to T1317 treatment for 48h. B, Western blot illustrating the degree of loss of LXR{alpha} protein in response to siRNA treatment in HepG2 cells. C, relative to control (DMSO alone; expression = 1.0), T1317 induced AKR1C4 mRNA expression approximately 1.6-fold (48-h treatment). Transfection of cells with a selective siRNA directed against LXR{alpha} substantially reduced the induction. Treatments received either control siRNA or selective LXR{alpha} siRNA as described under Materials and Methods. D, analysis of AKR1C4 protein expression under conditions identical to C. E, ChIP analysis of the LXRE in the AKR1C4 promoter illustrating LXR{alpha} occupancy in HepG2 cells. F, ChIP analysis of the AKR1C4 gene indicating increased histone H3 acetylation in response to LXR agonist treatment of HepG2 cells.

 

    Discussion
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Type I or hepatic 3{alpha}-HSD (AKR1C4) is an essential enzyme required for both biosynthesis of bile acids and metabolism of steroid hormones within the liver. In addition, AKR1C4 plays an important role in the metabolism of certain xenobiotics (Jin and Penning, 2007Go). In this study, we identified a putative LXRE in the proximal promoter of the AKR1C4 gene using the LXRE.HMM predictive model coupled with LXR ChIP/microarray analysis. The LXRE.HMM prediction and subsequent analysis of nucleotide conservation of the binding site signature showed that the putative LXRE exhibited similarities to other DR4 classes of functional LXREs identified in other LXR responsive genes, such as the Cyp7A1 gene (Lehmann et al., 1997Go). The AKR1C4 LXRE bound directly to an RXR/LXR heterodimer, and when a fragment of the AKR1C4 promoter was cloned upstream of a reporter, it conferred LXR- and LXR ligand-dependent reporter expression. In addition, AKR1C4 mRNA expression was induced in two human hepatoma cell lines upon treatment with a specific LXR agonist, T1317. Thus, the human AKR1C4 gene is directly regulated by LXR{alpha}. Given the role of LXR as a receptor for oxysterols, the above results provide unique insight into novel mechanisms of regulation of bile acid synthesis and steroid hormone metabolism via cholesterol metabolites.

Conversion of cholesterol to bile acids provides an essential method for elimination of cholesterol from animals. Cyp7A1 catalyzes the first and rate-limiting step in the classic pathway for bile acid production (Chiang, 2004Go). High-cholesterol diets induce Cyp7A1 expression in rats and mice, and the induction of this gene is mediated via oxysterol metabolites of cholesterol-activating LXR, which directly regulates transcription of Cyp7A1 via a LXRE located in its promoter (Janowski et al., 1996Go; Lehmann et al., 1997Go). Thus, these rodents efficiently induce Cyp7A1 expression in response to a high-cholesterol diet, increase cholesterol conversion to bile acids, and adapt to the diet with little effect on plasma cholesterol levels. In contrast, humans develop hypercholesterolemia in response to a high-cholesterol diet, which is consistent with the observation that Cyp7A1 is not induced in this state as a result of the lack of conservation of the LXRE within the gene's promoter (Chiang et al., 2001Go; Agellon et al., 2002Go). Human CYP7A1 expression is actually repressed by LXR agonists, an effect that was recently shown to be an indirect effect of LXR mediated via induction of hSHP expression (Goodwin et al., 2003Go). Our observation that human AKR1C4 gene expression is induced by LXR ligands provides an additional point of potential regulation of bile acid synthesis downstream of Cyp7A1 by oxysterol metabolites of cholesterol. It is unclear whether this regulatory pathway functions in rodents. Rats seem to have a single 3{alpha}-HSD gene (AKR1C19) whereas humans have four: AKR1C4, AKR1C3, AKR1C2, and AKR1C1 (Penning et al., 2003Go). Thus, direct comparison of the function and regulation of these pathways between the species is difficult.

Beyond its role in regulation of bile acid synthesis, AKR1C4 is an important enzyme involved in steroid hormone metabolism. Together with 5{alpha}- and 5β-HSDs, 3{alpha}-HSD is primarily responsible for the metabolism of most steroids (Penning, 1997Go). In the liver, AKR1C4 plays this important 3{alpha}-HSD role. Therefore, LXR and its ligands, oxidized cholesterol metabolites, may play a role in increasing the rate of metabolism of steroid hormones. Because cholesterol is the common precursor for biosynthesis of the steroid hormones, the fact that oxysterols that are thought to be general indicators of cholesterol levels or potentially regulating the degradation of the steroid hormones via LXR suggests that a feedback loop may be operating.

In addition, AKR1C4 is an important enzyme in the metabolism of several drugs, including tibolone and naltrexone. Along with AKR1C1 and AKR1C2, AKR1C4 is responsible for conversion of the selective estrogen receptor modulator tibolone to the estrogenic form of the drug 3{alpha}/β-hydroxytibolone (Steckelbroeck et al., 2004Go). AKR1C4 is also responsible for conversion of the opiate antagonist naltrexone to the longer half-life metabolite 6β-naltrexol (Porter et al., 2000Go). AKR1C4 is also involved in the activation of carcinogenic polycyclic hydrocarbons as well as in the detoxification of nicotine-derived carcinogens (Jin and Penning, 2007Go). Thus, activation of LXR{alpha} may lead to modulation of the metabolism of these xenobiotics.

In summary, we have shown that the human AKR1C4 gene is regulated by LXR{alpha}. The regulation is mediated by specific binding of the receptor to a LXRE located in the promoter of the AKR1C4 gene. LXR{alpha}/RXR heterodimers occupy this site in vivo and directly increase the expression of this gene in response to LXR ligands. These data suggest that LXR{alpha} may modulate the bile acid biosynthetic pathway at a unique site downstream of CYP7A1 and may also modulate the metabolism of steroid hormones and certain xenobiotics. Because LXR has been demonstrated to be a potential drug target for a variety of disorders, including dyslipidemia, diabetes, and inflammation (Cao et al., 2003Go; Michael et al., 2005Go; Chintalacharuvu et al., 2007Go), these data indicate that LXR agonists may have side effect profiles that include alterations in steroid hormone degradation and xenobiotic metabolism.


    Acknowledgements
 
We acknowledge the aid of Dr. Wei Li with MAT and Dr. Jun Song with the Microarray Blob Remover program.


    Footnotes
 
ABBREVIATIONS: HSD, hydroxysteroid dehydrogenase; AKR, aldo-keto reductase; LXR, liver X receptor; LXRE, liver X receptor response element; T0901317, N-[4-(1,1,1,3,3,3-hexafluoro-2-hydroxypropan-2-yl)phenyl]-N-(2,2,2-trifluoroethyl)benzenesulfonamide; DMSO, dimethyl sulfoxide; PCR, polymerase chain reaction; EMSA, electrophoretic mobility shift assay; RXR, retinoid X receptor; ChIP, chromatin immunoprecipitation; BAP, bacterial alkaline phosphatase; bp, base pair(s); T1317, N-[4-(1,1,1,3,3,3,-hexafluoro-2-hydroxypropan-2-yl)phenyl]-N-(2,2,2-trifluoromethyl)benzene sulfonamide; siRNA, small interfering RNA; HMM, hidden Markov model.

1 Current affiliation: PTC Therapeutics, South Plainfield, New Jersey. Back

2 Current affiliation: Wyeth Research, 500 Arcola Rd, Collegeville, Pennsylvania. 19426 Back

Address correspondence to: Dr. Thomas P. Burris, PBRC/LSU, 6400 Perkins Rd, Baton Rouge LA 70808. E-mail: thomas.burris{at}pbrc.edu


    References
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Agellon LB, Drover VAB, Cheema SK, Gbaguidi GF, and Walsh A (2002) Dietary cholesterol fails to stimulate the human cholesterol 7{alpha}-hydroxylase gene (CYP7A1) in transgenic mice. J Biol Chem 277: 20131-20134.[Abstract/Free Full Text]

Burris TP, Guo WW, Le T, and McCabe ERB (1995) Identification of a putative steroidogenic factor-I response element in the Dax-1 promoter. Biochem Biophys Res Commun 214: 576-581.[CrossRef][Medline]

Cao GQ, Liang Y, Broderick CL, Oldham BA, Beyer TP, Schmidt RJ, Zhang YY, Stayrook KR, Suen C, Otto KA, et al. (2003) Antidiabetic action of a liver X receptor agonist mediated by inhibition of hepatic gluconeogenesis. J Biol Chem 278: 1131-1136.[Abstract/Free Full Text]

Chiang JYL (2004) Regulation of bile acid synthesis: pathways, nuclear receptors, and mechanisms. J Hepatol 40: 539-551.[CrossRef][Medline]

Chiang JYL, Kimmel R, and Stroup D (2001) Regulation of cholesterol 7{alpha}-hydroxylase gene (CYP7A1) transcription by the liver orphan receptor (LXR{alpha}). Gene 262: 257-265.[CrossRef][Medline]

Chintalacharuvu SR, Sandusky GE, Burris TP, Burmer GC, and Nagpal S (2007) Liver X receptor is a therapeutic target in collagen-induced arthritis. Arthritis Rheum 56: 1365-1367[CrossRef][Medline]

Goodwin B, Watson MA, Kim H, Miao J, Kemper JK, and Kliewer SA (2003) Differential regulation of rat and human CYP7A1 by the nuclear oxysterol receptor liver X receptor-{alpha}. Mol Endocrinol 17: 386-394.[Abstract/Free Full Text]

Janowski BA, Willy PJ, Devi TR, Falck JR, and Mangelsdorf DJ (1996) An oxysterol signalling pathway mediated by the nuclear receptor LXR alpha. Nature 383: 728-731.[CrossRef][Medline]

Jin Y and Penning TM (2007) Aldo-keto reductases and bioactivation/detoxication. Annu Rev Pharmacol Toxicol 47: 263-292.[CrossRef][Medline]

Johnson WE, Li W, Meyer CA, Gottardo R, Carroll JS, Brown M, and Liu XS (2006) Model-based analysis of tiling-arrays for ChIP-chip. Proc Natl Acad Sci U S A 103: 12457-12462.[Abstract/Free Full Text]

Laffitte BA, Joseph SB, Chen M, Castrillo A, Repa J, Wilpitz D, Mangelsdorf D, and Tontonoz P (2003) The phospholipid transfer protein gene is a liver X receptor target expressed by macrophages in atherosclerotic lesions. Mol Cell Biol 23: 2182-2191.[Abstract/Free Full Text]

Laffitte BA, Joseph SB, Walczak R, Pei LM, Wilpitz DC, Collins JL, and Tontonoz P (2001) Autoregulation of the human liver X receptor alpha promoter. Mol Cell Biol 21: 7558-7568.[Abstract/Free Full Text]

Lehmann JM, Kliewer SA, Moore LB, Smith-Oliver TA, Oliver BB, Su J-L, Sundseth SS, Winegar DA, Blanchard DE, Spencer TA, et al. (1997) Activation of the nuclear receptor LXR by oxysterols defines a new hormone response pathway. J Biol Chem 272: 3137-3140.[Abstract/Free Full Text]

Li Y, Bolten C, Bhat BG, Woodring-Dietz J, Li SZ, Prayaga SK, Xia CS, and Lala DS (2002) Induction of human liver X receptor alpha gene expression via an autoregulatory loop mechanism. Mol Endocrinol 16: 506-514.[Abstract/Free Full Text]

Michael LF, Schkeryantz JM, and Burris TP (2005) The pharmacology of LXR. Mini-Rev Med Chem 5: 729-740.[CrossRef]

Penning TM (1997) Molecular endocrinology of hydroxysteroid dehydrogenases. Endocr Rev 18: 281-305.[Abstract/Free Full Text]

Penning TM, Burczynski ME, Jez JM, Hung CF, Lin HK, Ma HC, Moore M, Palackal N, and Ratnam K (2000) Human 3 alpha-hydroxysteroid dehydrogenase isoforms (AKR1C1-AKR1C4) of the aldo-keto reductase superfamily: functional plasticity and tissue distribution reveals roles in the inactivation and formation of male and female sex hormones. Biochem J 351: 67-77.[CrossRef][Medline]

Penning TM, Jin Y, Heredia VV, and Lewis M (2003) Structure-function relationships in 3[alpha]-hydroxysteroid dehydrogenases: a comparison of the rat and human isoforms. J Steroid Biochem Mol Biol 85: 247-255.[CrossRef][Medline]

Porter SJ, Somogyi AA, and White JM (2000) Kinetics and inhibition of the formation of 6β-naltrexol from naltrexone in human liver cytosol. Br J Clin Pharmacol 50: 465-471.[CrossRef][Medline]

Savkur RS, Bramlett KS, Michael LF, and Burris TP (2005) Regulation of pyruvate dehydrogenase kinase expression by the farnesoid X receptor. Biochem Biophys Res Commun 329: 391-396.[CrossRef][Medline]

Stayrook KR, Bramlett KS, Savkur RS, Ficorilli J, Cook T, Christe ME, Michael LF, and Burris TP (2005) Regulation of carbohydrate metabolism by the farnesoid X receptor. Endocrinology 146: 984-991.[Abstract/Free Full Text]

Steckelbroeck S, Jin Y, Oyesanmi B, Kloosterboer HJ, and Penning TM (2004) Tibolone is metabolized by the 3{alpha}/3β-hydroxysteroid dehydrogenase activities of the four human isozymes of the aldo-keto reductase 1C subfamily: inversion of stereospecificity with a {Delta}5(10)-3-ketosteroid. Mol Pharmacol 66: 1702-1711.[Abstract/Free Full Text]

Varga G and Su C (2007) Classification and predictive modeling of liver x receptor response elements. BioDrugs 21: 117-124.[CrossRef][Medline]

Whitney KD, Watson MA, Goodwin B, Galardi CM, Maglich JM, Wilson JG, Willson TM, Collins JL, and Kliewer SA (2001) Liver X receptor (LXR) regulation of the LXR {alpha} gene in human macrophages. J Biol Chem 276: 43509-43515.[Abstract/Free Full Text]

Willy PJ and Mangelsdorf DJ (1997) Unique requirements for retinoid dependent transcriptional activation ay the orphan receptor LXR. Genes Dev 11: 289-298.[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
Mol. Pharmacol.Home page
Y. Wang, P. M. Rogers, K. R. Stayrook, C. Su, G. Varga, Q. Shen, S. Nagpal, and T. P. Burris
The Selective Alzheimer's Disease Indicator-1 Gene (Seladin-1/DHCR24) Is a Liver X Receptor Target Gene
Mol. Pharmacol., December 1, 2008; 74(6): 1716 - 1721.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Wang, P. M. Rogers, C. Su, G. Varga, K. R. Stayrook, and T. P. Burris
Regulation of Cholesterologenesis by the Oxysterol Receptor, LXR{alpha}
J. Biol. Chem., September 26, 2008; 283(39): 26332 - 26339.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
mol.107.039099v1
73/2/607    most recent
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Stayrook, K. R.
Right arrow Articles by Burris, T. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Stayrook, K. R.
Right arrow Articles by Burris, T. P.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
All ASPET Journals Molecular Pharmacology Pharmacological Reviews
 Molecular Interventions Drug Metabolism and Disposition

Copyright © 2008 by the American Society for Pharmacology and Experimental Therapeutics