![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
|
|
|
|
|
||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Graduate School of Bioscience and Biotechnology, Tokyo Institute of Technology, Yokohama, Japan (M.Y.,Y.K.,T.W.,H.H.); Integrated Research Institute Graduate school of Bioscience and Biotechnology, Tokyo Institute of Technology, Yokohama, Japan (T.W.,H.H.); and Graduate School of Pharmaceutical Sciences, University of Shizuoka, Shizuoka, Japan (A.A.)
Received for publication November 7, 2007.
Accepted for publication December 18, 2007.
 |
Abstract |
|---|
 Top Abstract Materials and MethodsResultsDiscussionReferences |
|---|
We reported previously the application of the high-performance affinity latex beads composed of a glycidylmethacrylate-covered glycidylmethacrylate-styrene copolymer core for identifying drug receptors (Shimizu et al., 2000
; Tomohiro et al., 2002). These latex beads have several advantages over conventional affinity purification of receptors. They enable the rapid and efficient purification of ligand- or drug-binding proteins (Ohtsu et al., 2005). These high-performance affinity beads have been used successfully for purification of various proteins, including transcription factors and drug receptors (Shimizu et al., 2000; Uga et al., 2006) and cisplatin-damaged DNA binding proteins (Tomohiro et al., 2002).
TAS-103 has been developed as an anticancer drug and displays antitumor activity in murine and human tumor models. It is a potent dual-inhibitor of topoisomerases (topo) I and II (Azuma and Urakawa, 1997; Utsugi et al., 1997), the enzymes associated with cleavage, passage, and recombination of DNA during DNA and RNA synthesis (Wang, 1985; Osheroff, 1989a) and exhibits powerful and broad antitumor activity against subcutaneously implanted human solid tumor xenografts, including cancers of the lung, pancreas, and kidney (Schabel et al., 1979; Kluza et al., 2000). Its topo I inhibitory activity is similar to that of SN-38, and its topo II inhibitory activity is stronger than that of the inhibitor VP-16 (Utsugi et al., 1997; Sunami et al., 1999). TAS-103 does not show any cross-resistance in several resistant phenotypes such as cis-diamminedichloroplatinum(II) resistance, multidrug resistance, or topoisomerase inhibitor resistance (Sunami et al., 1999). It also enhances DNA cleavage in vitro in the presence of mammalian topo I and human topo II
and IIβ. However, a study in yeast concluded that topo II is a primary cellular target of TAS-103 (Byl et al., 1999).
|
), another study has shown that cellular susceptibility to TAS-103 is not correlated with topo II expression and is correlated with p300 expression (Torigoe et al., 2005). p300 functions together with Sp1 in GC-boxdependent transcription (Suzuki et al., 2000; Xiao et al., 2000). That study has also demonstrated that TAS-103 treatment enhances the interaction of Sp1 with p300 and induces SV40 promoter activity in a GC-box-dependent manner in cells in which p300 is highly expressed (Torigoe et al., 2005). Nevertheless, the direct target of TAS-103 has remained unclear. Therefore, we have searched for another target protein of TAS-103 using the high-performance affinity latex beads and have identified a component of the signal recognition particle (SRP) as a TAS-103 binding protein.
The SRP is a ribonucleoprotein complex composed of an Alu domain and an S domain in mammalian cells. The Alu domain contains two SRP proteins: SRP9 and SRP14. The S domain contains unique sequence SRP RNA and four SRP proteins: SRP19, SRP54, SRP68, and SRP72 (Politz et al., 2000). The SRP is bound through SRP54 to the signal peptides of membrane and secretory proteins emerging from the ribosome. After signal peptide recognition, the SRP is bound to membrane receptors to ensure the proper delivery of secretory proteins (Lutcke, 1995; Keenan et al., 2001; Zwieb and Eichler, 2002; Rosenblad et al., 2003). Low levels of SRP lead to insufficient targeting of proteins to the ER (Lakkaraju et al., 2007).
Here we show that TAS-103 is not only bound to SRP54 but also disrupts SRP complex formation and reduces the amount of the SRP14 subunit. We have used interleukin-6 (IL-6)-FLAG as a model secretory protein with a signal peptide. TAS-103 treatment increases the level of intracellular IL-6-FLAG protein, similar to RNAi-mediated knockdown of SRP54 or SRP14. We propose that TAS-103 disrupts SRP complex formation and causes degradation of SRP14 through its binding to SRP54. As a result, TAS-103 inhibits the function of the SRP in directing the delivery of secretory proteins.
|
Materials and Methods |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
) (Fig. 1C). The TAS-1-3383 was synthesized by Taiho Pharmaceutical Co., Ltd. (Tokyo, Japan) and was dissolved at 1 mM in N,N-dimethylformamide (DMF; Nacalai Tesque, Kyoto, Japan) containing 9 mM triethylamine, followed by diluting to 0.3 and 0.1 mM with DMF containing 9 mM triethylamine. The SGNGDENC beads (5 mg) were reacted with 0.2 mM N-hydroxysuccinimide and 0.2 mM N-ethyl-N'-(3-dimethylaminopropyl)-carbodiimide hydrochloride and then mixed with 500 µl of the 1.0, 0.3, and 0.1 TAS-1-3383 solutions for 16 h at room temperature. After removal of the supernatants to fresh tubes, 500 µl of 1 M ethanolamine, pH 8.5, was added to the beads and mixed for 2 h to block unreacted amino groups on the beads. The concentrations of residual N-hydroxysuccinimide in the supernatants were measured by high-performance liquid chromatography to quantify the immobilized TAS-1-3383.
Cell Cultures. HeLa spinner cells were grown in minimal essential medium containing 10% horse serum as described previously (Wada et al., 1991). HeLa and 293T cells were cultured in Dulbecco's modified Eagle's medium (Invitrogen, Carlsbad, CA) supplemented with 10% fetal bovine serum, 50 U/ml penicillin, and 50 g/ml streptomycin. Cells were cultured at 37°C under an atmosphere of 5% CO2.
Preparation of HeLa Cell Extracts. Nuclear extracts (NE) of HeLa cells were prepared as described previously (Dignam et al., 1983; Wada et al., 1998; Ohtsu et al., 2005). The extracts were dialyzed against buffer E (10 mM Tris-HCl, 50 mM NaCl, 1 mM MgCl2, 1 mM CaCl2, 0.2 mM EDTA, and 10% glycerol) without NP-40.
Affinity Purification of Drug-Binding Proteins. TAS-1-3383-fixed latex beads (0.3 mg) were equilibrated with buffer E, mixed with 200 µl of NE, incubated at 4°C for 4 h with occasional agitation, washed with buffer E three times, and then agitated in 50 µl of buffer E containing 10 mM TAS-103 at 4°C for 1 h to elute the binding protein(s). The protein was visualized by silver staining and Coomassie brilliant blue staining. Coomassie brilliant blue-stained bands were subjected to in-gel trypsin digestion, and the resultant peptides were analyzed by liquid chromatography/mass spectrometry.
|
Western Blotting. Total protein was quantified using a Bradford protein assay (Bio-Rad, Hercules, CA). Equal amounts of protein were loaded into SDS-polyacrylamide gels and transferred to polyvinylidene difluoride filters (Millipore, Billerica, MA). Filters were blocked in blocking buffer (20 mM Tris-HCl, pH 7.6, 150 mM NaCl, 10% NaN3, and 3% bovine serum albumin) and washed in Tris-buffered saline/Tween 20 (20 mM Tris-HCl, pH 7.6, 150 mM NaCl, and 0.1% Tween 20). The primary antibodies were anti-β-actin (Millipore Bioscience Research Agents, Temecula, CA), anti-SRP54 (BD Pharmingen, San Diego, CA), anti-SRP14 (Santa Cruz Biotechnology, Santa Cruz, CA), anti-FLAG (Sigma-Aldrich, St. Louis, MO), anti-SRP19, kindly provided by Dirk Görlich (Zentrum für Molekulare Biologie der Universität Heidelberg, Heidelberg, Germany) (Dean et al., 2001), and anti-SRP72-4 and anti-SRP68-2, kindly provided by Bernhard Dobberstein (Zentrum für Molekulare Biologie der Universität Heidelberg) (Lutcke et al., 1993; Bacher et al., 1999). The secondary antibodies conjugated to horseradish peroxidase were anti-mouse IgG (Sigma-Aldrich), anti-goat IgG (Santa Cruz Biotechnology), and anti-rabbit IgG (Cell Signaling Technology, Danvers, MA). Signals were detected using the ECL system (GE Healthcare, Chalfont St. Giles, Buckinghamshire, UK) and Kodak BioMax films (Eastman Kodak, Rochester, NY)
Gel-Filtration Studies. The formation of the SRP was studied by gel-filtration chromatography using a SMART system and a Superose-6 PC 3.2/30 column (GE Healthcare). 293T cells were seeded into 60-mm collagen-coated dishes at 10 x 105 cells/dish. TAS-103 was added when the cultures had reached approximately 70 to 80% confluence. The cells were cultured for the next 12 h in the presence or absence of 10 µM TAS-103, collected with a scraper in PBS, washed with ice-cold PBS, lysed in 400 µl of 0.5% NP-40 lysis buffer (50 mM Tris-HCl, pH 8, 100 mM NaCl, and 0.5% NP-40) with occasional agitation, and centrifuged at 16,000g for 20 min at 4°C to remove any insoluble material. The supernatants were filtered with a 0.22-µm filter unit. The supernatants (50 µl) were loaded on the Superose-6 column equilibrated with the 0.5% NP-40 lysis buffer, and collected fractions were analyzed by Western blotting using antibodies against SRP54, SRP72, SRP68, and β-actin as a control. Molecular mass standards consisting of bovine serum albumin (66 kDa), alcohol dehydrogenase (150 kDa), horse spleen apoferritin (443 kDa), and bovine thyroglobulin (669 kDa) were used for calibration.
Construction of the FLAG-Tagged IL-6 Plasmid. A DNA insert encoding the FLAG-tagged human IL-6 fusion protein was constructed by polymerase chain reaction using the IL-6 cDNA and the primers 5'-GATGATATCGAATTCATGAACTCCTTCTCCACAAGCG-3' and 5'-GAGGATATCC TCGAGGACTCAGTCACTTAACTTGTCGTCATCCTTGTAGTCCATCATTTGCCGAAGAGCCCTCAG-3', followed by treatment with EcoRI and XhoI, and inserted into the expression vector pcDNA3.1 (Invitrogen) between the EcoRI and XhoI sites.
Construction of the FLAG-Tagged IL-6 Plasmid Lacking a Signal Peptide. A DNA insert encoding the FLAG-tagged human IL-6 fusion protein lacking a signal peptide was constructed by polymerase chain reaction using the IL-6 cDNA and the primers 5'-GATGATATCGAATTCATGGCCCCAGTACCCCCAGGA-3' and 5'-GAGGATATCCTCGAGGACTCAGTCACTTAACTTGTCGTCATCCTTGTAGTCCATCATTTGCCGAAGAGCCCTCAG-3', followed by treatment with EcoRI and XhoI, and inserted into the expression vector pcDNA3.1 between the EcoRI and XhoI sites.
Immunoprecipitation. 293T cells were washed with ice-cold PBS, lysed in 250 µl of the 0.5% NP-40 lysis buffer with occasional agitation, and centrifuged at 16,000g for 10 min at 4°C to remove any insoluble material. ANTI-FLAG M2 Affinity Gel (Sigma) was equilibrated in the 0.5% NP-40 lysis buffer. The supernatant (200 µl) was transferred to a fresh tube containing 20 µl of the equilibrated packed gel and incubated at 4°C with rotation for 3 h. The beads were collected by centrifugation at 500g for 5 min and washed three times with 1 ml of 0.5% NP-40 lysis buffer. The FLAG-tagged protein was competitively eluted with 50 µl of 0.5% NP-40 lysis buffer containing 0.2 µg/µl FLAG peptides.
Coimmunoprecipitation Assay. 293T cells were seeded into 60-mm collagen-coated dishes at 10 x 105 cells/dish. After 12 h, the cells were transfected with the plasmid pcDNA3-FLAG-HIS-SRP54. At 12 h after transfection, the medium was changed. TAS-103 was added when the cultures achieved approximately 70 to 80% confluence. The cells were cultured for the next 12 h in the presence or absence of 10 µM TAS-103, collected with a scraper in PBS, and washed with ice-cold PBS. The cells were lysed in 400 µl of 0.5% NP-40 lysis buffer with occasional agitation and centrifuged at 16,000g for 20 min at 4°C to remove any insoluble material. RNase A solution (5 µl) was added to the lysate before immunoprecipitation. The cell lysate (300 µl) was immunoprecipitated using ANTI-FLAG-M2 agarose beads (Sigma). The eluted fraction and the whole-cell lysate were analyzed by Western blotting with anti-SRP54, anti-SRP68, anti-SRP72, anti-SRP19, anti-SRP14, and anti-β-actin.
|
S-FLAG and the stealth RNAs (Invitrogen) using Lipofectamine 2000 (Invitrogen). The medium was changed 12 h later. After another 12 h, half of the cells were passaged in one plate and incubated for 24 h. The cells and culture media were collected at 48 h after transfection. The lysates were immunoprecipitated and analyzed by Western blotting. The sequences of the stealth RNAs were as follows: stealth RNA targeting SRP54: sense, 5'-GGATCCTGTCATCATTGCTTCTGAA-3'; and stealth RNA targeting SRP14: sense, 5'-GCTAACATGGATGGGCTGAAGAAG.A-3'.
Analysis of the Effects of TAS-103 on the Translocation of IL-6-FLAG. 293T cells were transfected with pcDNA3.1-IL-6-FLAG or pcDNA3.1-IL-6S-FLAG, and the medium was changed after 16 h. The cells were cultured for another8hinthe presence or absence of TAS-103. The cells and culture media were collected 24 h after transfection.
|
Results |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
; Osheroff, 1989a; Azuma and Urakawa, 1997; Utsugi et al., 1997; Byl et al., 1999; Fortune et al., 1999; Ishida and Asao, 1999). However, other studies have indicated that cellular susceptibility to TAS-103 is not correlated with topo II expression (Torigoe et al., 2005). Because the direct target of TAS-103 remained unclear, we searched for other TAS-103 binding protein(s) in HeLa cell extracts using the high-performance affinity latex beads carrying a TAS-103 derivative, TAS-1-3383, which has an additional amino group for the coupling reaction with the carboxyl groups of the beads ((Shimizu et al., 2000; Ohtsu et al., 2005) (Fig. 1B). We examined the biological activity of TAS-1-3383 before its immobilization on the beads. Cell viability assays were performed on HeLa cells cultured with TAS-103 or TAS-1-3383. The IC50 values were 40 and 500 nM for the cells cultured with TAS-103 and TAS-1-3383, respectively (data not shown). This result indicated that the additional amino group of TAS-1-3383 reduced its cytotoxicity on HeLa cells but that TAS-1-3383 still had a negative effect on tumor cell viability.
|
We analyzed the 54-kDa protein by liquid chromatography/mass spectrometry and found that it might be SRP54, a component of the SRP. To test whether the 54-kDa band was SRP54, we carried out Western blot analysis with anti-SRP54 antibody. The antibody reacted with the 54-kDa protein, and the band intensity increased in proportion to the amount of TAS-1-3383 immobilized on the beads (Fig. 2B). These results indicate that SRP54 was specifically bound to TAS-1-3383 on beads and was eluted competitively by the addition of TAS-103.
TAS-103 Disrupts SRP Complex Formation. We investigated whether TAS-103 affects SRP complex formation. We chose 293T cells for this assay because 293T whole-cell lysates can be readily prepared under mild detergent conditions. The 293T cells were incubated for 12 h with or without 10 µM TAS-103 and lysed in lysis buffer containing 0.5% NP-40. The cell extracts were fractionated by gel-filtration chromatography as described under Materials and Methods. Each fraction was analyzed by Western blotting with anti-SRP54, anti-SRP68, anti-SRP72, and anti-β-actin antibodies (see Materials and Methods for experimental details). SRP68 and SRP72 were observed in fractions 7, 8, and 9 regardless of TAS-103 treatment. In contrast, SRP54 was observed primarily in fractions 8 to 11 of cells cultured without TAS-103, whereas it was observed in fractions 8 to 12, and abundantly in fractions 11 and 12, of cells cultured with TAS-103, indicating that the addition of TAS-103 caused SRP54 to distribute in later fractions (Fig. 3A). TAS-103 treatment did not affect the distribution of β-actin, which was detected in fractions 11 to 14. The band intensities of the SRP54 and β-actin proteins were measured using NIH Image-J software (http://rsb.info.nih.gov/ij/) and plotted in Fig. 3B, which shows the clear difference in SRP54 distribution with TAS-103 treatment (Fig. 3B, left). In contrast, the control β-actin distribution was similar in fractions 10 to 14 regardless of the treatment (Fig. 3B, right). These results indicate that TAS-103 releases SRP54 from SRP68 and SRP72.
To better understand the effects of TAS-103 on the interactions between SRP54 and other subunits, we performed a coimmunoprecipitation assay. We overexpressed FLAG-tagged SRP54 in 293T cells. Untreated 293T cells were used as a control. The 293T cells were incubated for 12 h with or without 10 µM TAS-103 and lysed in lysis buffer containing 0.5% NP-40. The overexpressed FLAG-tagged SRP54 was immunoprecipitated using ANTI-FLAG-M2 agarose beads and released from the beads using FLAG peptide. The eluates were analyzed by Western blotting with anti-SRP54, anti-SRP68, anti-SRP72, anti-SRP19, anti-SRP14, and anti-β-actin antibodies (Fig. 4A). These SRP subunits were detected in the eluates from the 293T cells overexpressing SRP54-FLAG (Fig. 4A, lanes 2 and 4), whereas no bands were detected in the eluates from control cells (Fig. 4A, lanes 1 and 3). The band intensities of SRP68 and SRP72 were decreased in the eluates from cells grown with TAS-103 (Fig. 4A; compare lanes 2 and 4). These data indicate that SRP68 and SRP72 are released from SRP54 by the addition of TAS-103, consistent with the results of the gel-filtration assay shown in Fig. 3.
|
TAS-103 Treatment and the Knockdown of SRP54 and SRP14 Cause an Intracellular Increase in IL-6-FLAG. The SRP interacts with signal sequences that appear on the surface of translating ribosomes. After signal-peptide recognition, the SRP is bound to membrane receptors and ensures the proper delivery of secretory proteins (Lutcke, 1995; Keenan et al., 2001; Zwieb and Eichler, 2002; Rosenblad et al., 2003). We hypothesized that TAS-103 inhibits the translocation of proteins into the ER, thereby leading to the inhibition of translocation across the ER and resulting in the accumulation of secretory proteins in the cells.
IL-6 is a multifunctional cytokine that is produced by many cells after appropriate stimulation. IL-6 has a signal peptide for sorting and directing it to the ER via the SRP during translation. IL-6 lacking the signal peptide accumulates within the cytoplasm of transfected cells (Rose-John et al., 1993). Therefore, to examine whether TAS-103 causes secretory proteins with signal peptides to accumulate in cells, we used IL-6-FLAG with its signal peptide as a model and IL-6-FLAG lacking the signal peptide (IL-6S-FLAG) as a negative control.
293T cells were transfected with pcDNA3.1-IL-6-FLAG or pcDNA3.1-IL-6S-FLAG and cultured for 16 h. After a medium change, the cells were incubated with or without TAS-103 for another 8 h. The cell lysates and culture media were immunoprecipitated by anti-FLAG antibody, followed by Western blot analysis. The results showed that TAS-103 caused an increase in IL-6-FLAG in the cell lysates (Fig. 5A), but had no effect on the accumulation of IL-6S-FLAG (Fig. 5B).
To test whether specific reductions in SPR54 or SRP14 protein affected the accumulation of IL-6-FLAG or IL-6S-FLAG in cells, we performed RNAi-mediated knockdowns of SRP54 and SRP14. The cells were cotransfected with the pcDNA3.1-IL-6-FLAG plasmid or -IL-6S-FLAG plasmid and stealth RNA targeting SRP14 or SRP54 or control stealth RNA containing a scrambled sequence. The cell lysates and culture media were immunoprecipitated followed by Western blot analysis. The specific knockdowns of SRP54 and SRP14 were confirmed by Western blot analysis (Fig. 5C). The results showed that the reductions in SRP54 or SRP14 proteins increased intracellular IL-6-FLAG compared with the treatment with stealth RNA containing the scrambled sequence (Fig. 5C). In contrast, in cells cotransfected with the pcDNA3.1-IL-6S-FLAG plasmid and the stealth RNAs, the reductions in SRP54 or SRP14 protein had no effect on the amount of intracellular IL-6S-FLAG (Fig. 5D). Thus, treatment with TAS-103 and the specific knockdowns of SRP54 or SRP14 had similar effects on the accumulation of intracellular IL-6-FLAG. These results suggest that TAS-103 treatment causes the accumulation of intracellular IL-6-FLAG by inhibiting the SRP and thereby disrupting proper protein delivery.
|
Discussion |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
), we observe abundant SRP54 in HeLa cell nuclear extracts (Fig. 2B). Because DNA also has been considered to be a major target of TAS-103 (Ishida and Asao, 1999), we predicted that TAS-103 bound to SRP54 via nucleic acid. However, SRP54 was bound to the drug in the lysates treated with RNaseA (Fig. 2C), and the coimmunoprecipitation assay using FLAG-tagged SRP54 showed that SRP14 was released by the RNaseA treatment (Fig. 4A). We therefore deduce that SRP54 is a TAS-103-binding protein.
TAS-103 is classified as a topo II poison (Byl et al., 1999). Nevertheless, we did not find any topo II associated with TAS-103 (data not shown). We investigated TAS-103 binding proteins from the NE lysate lacking abundant supercoiled DNA, whereas TAS-103 stabilizes the covalently linked topo II-DNA complex called the "cleavable complex" (Willmore et al., 1998). In the drug-stabilized cleavable complex, topo II molecules are covalently bound to a DNA strand end at the double-strand break, thereby preventing religation of the DNA strands (Osheroff, 1989b). These stabilized complexes are believed to make the break permanent and inhibit DNA replication, leading to mutations, recombination events, and chromosome aberrations (Chen et al., 1996). We obtained a TAS-103 binding protein from NE lysates that did not contain abundant supercoiled DNA, whereas TAS-103 probably recognizes topoisomerases bound to supercoiled double-stranded DNA in cells. This may be a reason why topoisomerases were not obtained from the beads in our study, although further in-depth studies will be required to address this question.
We have shown that TAS-103 disrupts SRP complex formation and decreases the amounts of SRP14 and SRP19 in cells. SRP14 mRNA was not affected by the addition of TAS-103. Therefore, these results suggest that TAS-103 destabilizes SRP14 and SRP19 through the disruption of the SRP complex.
The SRP interacts with signal sequences appearing on the surface of translating ribosomes followed by binding to membrane receptors to ensure the proper delivery of secretory proteins (Lutcke, 1995; Zwieb and Eichler, 2002; Rosenblad et al., 2003). We have used IL-6-FLAG as a model protein with a signal peptide that is delivered by the SRP and IL-6-FLAG lacking a signal peptide (IL-6S-FLAG) as a negative control. We have examined the effects of TAS-103 and knockdowns of SRP54 and SRP14 on the translocation of IL-6-FLAG and IL-6S-FLAG and found that they increase intracellular IL-6-FLAG, whereas they have no effect on the amount of IL-6S-FLAG. Therefore, we hypothesize that the accumulation is caused by the disruption of post-translational translocation. We have observed that the addition of TAS-103 or RNAi-mediated knockdowns lead to increases in two types of intracellular IL-6-FLAG with different molecular masses. The reason for this is unknown; however, the increase in the molecular weight of the intracellular IL-6-FLAG was the same with the TAS-103 treatment as with the knockdowns.
Although we observed the accumulation of IL-6-FLAG caused by RNAi-mediated knockdowns of SRP14 or SRP54 or TAS-103 treatment, no corresponding decrease of IL-6-FLAG in the culture media was detected. The amount of IL-6-FLAG secreted from 293T cells into the culture media was found to be 20- to 40-fold more than the amount inside the cells (data not shown). The amount of intracellular IL-6-FLAG in cells treated with TAS-103 was two to four times more than in untreated cells. We speculate that the difference in the amount of IL-6-FLAG secreted into the culture media by TAS-103-treated and untreated cells was very small and therefore undetectable by Western blot analysis.
From these observations, we propose that the interaction between SRP and TAS-103 results in the disruption of SRP complex formation and degradation of SRP14 and SRP19, eventually inhibiting SRP function. This provides new insights into the mechanism underlying the effects of chemotherapies comprising TAS-103.
Currently, various chemical genetic approaches for the probing of potential interactions between large numbers of chemical compounds and potential targets are being actively explored for drug discovery. This work describes the usefulness of our affinity beads for providing high-quality chemical genetic information.
|
Acknowledgements |
|---|
|
Footnotes |
|---|
ABBREVIATIONS: topo, topoisomerase; SRP, signal recognition particle; DMF, N,N-dimethylformamide; IL-6, interleukin-6; NE, nuclear extract; buffer E, Tris-HCl, NaCl, MgCl2, CaCl2, EDTA, and glycerol; NP-40, Nonidet P-40; PBS, phosphate-buffered saline; ER, endoplasmic reticulum; SN-38, 7-ethyl-10-hydroxycamptothecin; VP-16, 4'-demethylepipodophyllotoxin 9-(4,6-O-(R)-ethylidene-β-D-glucopyranoside).
Address correspondence to: Dr. Hiroshi Handa, Graduate School of Bioscience and Biotechnology, Tokyo Institute of Technology, 4259 Nagatsuta-cho, Midori-ku, Yokohama, Kanagawa, 226-8501, Japan. E-mail: hhanda{at}bio.titech.ac.jp
|
References |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
Bacher G, Pool M, and Dobberstein B (1999) The ribosome regulates the GTPase of the beta-subunit of the signal recognition particle receptor. J Cell Biol 146: 723-730.
Byl JA, Fortune JM, Burden DA, Nitiss JL, Utsugi T, Yamada Y, and Osheroff N (1999) DNA topoisomerases as targets for the anticancer drug TAS-103: primary cellular target and DNA cleavage enhancement. Biochemistry 38: 15573-15579.[CrossRef][Medline]
Chen CL, Fuscoe JC, Liu Q, and Relling MV (1996) Etoposide causes illegitimate V(D)J recombination in human lymphoid leukemic cells. Blood 88: 2210-2218.
Dean KA, von Ahsen O, Gorlich D, and Fried HM (2001) Signal recognition particle protein 19 is imported into the nucleus by importin 8 (RanBP8) and transportin. J Cell Sci 114 (Pt 19): 3479-3485.
Dignam JD, Lebovitz RM, and Roeder RG (1983) Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res 11: 1475-1489.
Fortune JM, Velea L, Graves DE, Utsugi T, Yamada Y, and Osheroff N (1999) DNA topoisomerases as targets for the anticancer drug TAS-103: DNA interactions and topoisomerase catalytic inhibition. Biochemistry 38: 15580-15586.[CrossRef][Medline]
Ishida K and Asao T (1999) Interaction of a novel antitumor agent TAS-103 with DNA. Nucleic Acids Symp Ser 42: 129-130.
Keenan RJ, Freymann DM, Stroud RM, and Walter P (2001) The signal recognition particle. Annu Rev Biochem 70: 755-775.[CrossRef][Medline]
Kluza J, Lansiaux A, Wattez N, Mahieu C, Osheroff N, and Bailly C (2000) Apoptotic response of HL-60 human leukemia cells to the antitumor drug TAS-103. Cancer Res 60: 4077-4084.
Lakkaraju AK, Luyet PP, Parone P, Falguieres T, and Strub K (2007) Inefficient targeting to the endoplasmic reticulum by the signal recognition particle elicits selective defects in post-ER membrane trafficking. Exp Cell Res 313: 834-847.[CrossRef][Medline]
Lutcke H (1995) Signal recognition particle (SRP), a ubiquitous initiator of protein translocation. Eur J Biochem 228: 531-550.[Medline]
Lutcke H, Prehn S, Ashford AJ, Remus M, Frank R, and Dobberstein B (1993) Assembly of the 68- and 72-kD proteins of signal recognition particle with 7S RNA. J Cell Biol 121: 977-985.
Ohtsu Y, Ohba R, Imamura Y, Kobayashi M, Hatori H, Zenkoh T, Hatakeyama M, Manabe T, Hino M, Yamaguchi Y, et al. (2005) Selective ligand purification using high-performance affinity beads. Anal Biochem 338: 245-252.[CrossRef][Medline]
Osheroff N (1989a) Biochemical basis for the interactions of type I and type II topoisomerases with DNA. Pharmacol Ther 41: 223-241.[CrossRef][Medline]
Osheroff N (1989b) Effect of antineoplastic agents on the DNA cleavage/religation reaction of eukaryotic topoisomerase II: inhibition of DNA religation by etoposide. Biochemistry 28: 6157-6160.[CrossRef][Medline]
Politz JC, Yarovoi S, Kilroy SM, Gowda K, Zwieb C, and Pederson T (2000) Signal recognition particle components in the nucleolus. Proc Natl Acad Sci U S A 97: 55-60.
Rose-John S, Schooltink H, Schmitz-Van de Leur H, Mullberg J, Heinrich PC, and Graeve L (1993) Intracellular retention of interleukin-6 abrogates signaling. J Biol Chem 268: 22084-22091.
Rosenblad MA, Gorodkin J, Knudsen B, Zwieb C, and Samuelsson T (2003) SRPDB: Signal Recognition Particle Database. Nucleic Acids Res 31: 363-364.
Schabel FM Jr, Trader MW, Laster WR Jr, Corbett TH, and Griswold DP Jr (1979) cis-Dichlorodiammineplatinum(II): combination chemotherapy and cross-resistance studies with tumors of mice. Cancer Treat Rep 63: 1459-1473.[Medline]
Shima D, Yugami M, Tatsuno M, Wada T, Yamaguchi Y, and Handa H (2003) Mechanism of H-8 inhibition of cyclin-dependent kinase 9: study using inhibitor-immobilized matrices. Genes Cells 8: 215-223.[Abstract]
Shimizu N, Sugimoto K, Tang J, Nishi T, Sato I, Hiramoto M, Aizawa S, Hatakeyama M, Ohba R, Hatori H, et al. (2000) High-performance affinity beads for identifying drug receptors. Nat Biotechnol 18: 877-881.[CrossRef][Medline]
Sunami T, Nishio K, Kanzawa F, Fukuoka K, Kudoh S, Yoshikawa J, and Saijo N (1999) Combination effects of TAS-103, a novel dual topoisomerase I and II inhibitor, with other anticancer agents on human small cell lung cancer cells. Cancer Chemother Pharmacol 43: 394-401.[CrossRef][Medline]
Suzuki T, Kimura A, Nagai R, and Horikoshi M (2000) Regulation of interaction of the acetyltransferase region of p300 and the DNA-binding domain of Sp1 on and through DNA binding. Genes Cells 5: 29-41.[Abstract]
Takano H, Kohno K, Matsuo K, Matsuda T, and Kuwano M (1992) DNA topoisomerase-targeting antitumor agents and drug resistance. Anticancer Drugs 3: 323-330.[Medline]
Tomohiro T, Sawada Ji J, Sawa C, Nakura H, Yoshida S, Kodaka M, Hatakeyama M, Kawaguchi H, Handa H, and Okuno H (2002) Total analysis and purification of cellular proteins binding to cisplatin-damaged DNA using submicron beads. Bioconjug Chem 13: 163-166.[CrossRef][Medline]
Torigoe T, Izumi H, Wakasugi T, Niina I, Igarashi T, Yoshida T, Shibuya I, Chijiiwa K, Matsuo K, Itoh H, et al. (2005) DNA topoisomerase II poison TAS-103 transactivates GC-box-dependent transcription via acetylation of Sp1. J Biol Chem 280: 1179-1185.
Uga H, Kuramori C, Ohta A, Tsuboi Y, Tanaka H, Hatakeyama M, Yamaguchi Y, Takahashi T, Kizaki M, and Handa H (2006) A new mechanism of methotrexate action revealed by target screening with affinity beads. Mol Pharmacol 70: 1832-1839.
Utsugi T, Aoyagi K, Asao T, Okazaki S, Aoyagi Y, Sano M, Wierzba K, and Yamada Y (1997) Antitumor activity of a novel quinoline derivative, TAS-103, with inhibitory effects on topoisomerases I and II. Jpn J Cancer Res 88: 992-1002.[CrossRef]
Wada T, Takagi T, Yamaguchi Y, Ferdous A, Imai T, Hirose S, Sugimoto S, Yano K, Hartzog GA, Winston F, et al. (1998) DSIF, a novel transcription elongation factor that regulates RNA polymerase II processivity, is composed of human Spt4 and Spt5 homologs. Genes Dev 12: 343-356.
Wada T, Watanabe H, Usuda Y, and Handa H (1991) Different biological activities of the hetero- and homodimers formed by the 47- and 43-kilodalton proteins of transcription factor ATF/E4TF3. J Virol 65: 557-564.
Wang JC (1985) DNA topoisomerases. Annu Rev Biochem 54: 665-697.[CrossRef][Medline]
Willmore E, Frank AJ, Padget K, Tilby MJ, and Austin CA (1998) Etoposide targets topoisomerase II and IIβ in leukemic cells: isoform-specific cleavable complexes visualized and quantified in situ by a novel immunofluorescence technique. Mol Pharmacol 54: 78-85.
Xiao H, Hasegawa T, and Isobe K (2000) p300 collaborates with Sp1 and Sp3 in p21(waf1/cip1) promoter activation induced by histone deacetylase inhibitor. J Biol Chem 275: 1371-1376.
Zwieb C and Eichler J (2002) Getting on target: the archaeal signal recognition particle. Archaea 1: 27-34.[Medline]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|
 |
 |
 |
