![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
|
|
|
|
|
||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Division of Pharmacology/Neurobiology, Biozentrum of the University of Basel, Basel, Switzerland (A.R., R.L., M.K., S.M.B., F.R., U.A.M.); Department of Gene Regulation and Drug Discovery, Beckman Research Institute, City of Hope National Medical Center, Duarte, California (W.H.); and Department of Molecular and Cellular Biology, Baylor College of Medicine, Houston, Texas (D.D.M.)
Received August 17, 2007; accepted January 4, 2008
 |
Abstract |
|---|
 Top Abstract Materials and MethodsResultsDiscussionReferences |
|---|
). PXR and CAR form heterodimers with the retinoid X receptor (RXR) and bind to specific DNA sequences in the regulatory region of target genes. PXR and CAR induce an overlapping set of genes involved in metabolism and transport of drugs (Maglich et al., 2002) but also genes involved in the regulation of steroids, bile acids, eicosanoids, and genes involved in cholesterol and bile acid homeostasis (Staudinger et al., 2001; Huang et al., 2003).
Insig-1 and Insig-2 are proteins of endoplasmic reticulum (ER) membrane and play an important role in the control of triglyceride and cholesterol biosynthesis (Yabe et al., 2002; Yang et al., 2002). The two isoforms bind in a sterol-dependent fashion to another ER membrane protein, sterol regulatory element binding protein (Srebp) cleavage-activating protein, or Scap, a transport protein needed for escort and subsequent activation of Srebp transcription factors (Hua et al., 1996). When Insig proteins are activated by sterols, insulin or other stimuli, they retain the Scap-Srebp complex in the ER membrane, thereby preventing Srebp-dependent target gene expression. Srebps are a group of basic helix-loop-helix transcription factors, which activate an array of genes involved in the synthesis of cholesterol and triglycerides. Whereas Srebp-2 is mainly involved in cholesterol biosynthesis, Srebp-1a and Srebp1c mainly activate genes involved in fatty acid and triglyceride synthesis (Shimano, 2001).
A decrease in hepatic and/or serum lipids, in particular triglycerides, has been observed in rodents after treatment with inducers of xenobiotic metabolism many years ago (Bjondahl, 1978; Hall et al., 1990; Venkatesan et al., 1994). More recently, known inducers of human drug metabolism such as the commonly used antiretroviral drug efavirenz or the barbiturate phenobarbital (PB) also have been shown to inhibit lipogenesis (El Hadri et al., 2004; Kiyosawa et al., 2004). The molecular mechanism of the effect of inducers on triglycerides has not been explained.
In the present study, we show that nuclear receptors CAR and PXR transcriptionally activate Insig-1 by binding to an enhancer sequence of the Insig-1 gene. Our results explain the negative effect of drugs and xenobiotics on hepatic lipids in vivo and show that CAR and PXR not only play a role in the catabolism of various endogenous and exogenous compounds but also directly affect lipogenic pathways by activating Insig-1. Moreover, because Insig-1 has recently been found to be a possible drug target for the treatment of diabetes (Nakagawa et al., 2006), this study contributes to the understanding of the regulation of this gene and possibly to the development of new therapies against dyslipidemia.
|
Materials and Methods |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
-carbonitrile (PCN; Sigma) in a 5% dimethyl sulfoxide-corn oil solution i.p. or with vehicle 10 h before dissection. Animals were sacrificed by exposure to CO2, blood was collected by heart puncture, and livers were excised and snap-frozen in liquid nitrogen and stored at -80°C until use.
Analysis of Triglycerides and Cholesterol. Fifty to 100 mg of liver was used for each preparation. After weight determination, liver samples were put in an ethanol/ether [3:1 (v/v)] mixture in FastPrep tubes (Lysing matrix D; Qbiogene, Illkirch, France). Livers were homogenized on the FastPrep instrument for 40 s at position 6.5 and evaporated to complete dryness on a SpeedVac evaporator (Thermo Fisher Scientific, Waltham, MA). Samples were redissolved in 1 ml of isopropanol, and tissue remnants were spun down for 5 min at 14,000g. Six hundred microliters of the supernatant was mixed with 400 µl of water, and lipids were determined using the esterase/oxidase kit for cholesterol determination and the L--glycerol phosphate oxidase kit for the determination of triglycerides (Roche Diagnostics, Basel, Switzerland).
RT-PCR Analysis. RNA from cells and tissues was isolated using Tri-Reagent (Sigma). One microgram of total RNA was reverse-transcribed with Moloney murine leukemia virus reverse transcriptase (Roche Diagnostics). PCR was performed using the TaqMan PCR Core Reagent Kit (Applied Biosystems, Foster City, CA) and the transcript level quantitated with an ABI PRISM 7700 Sequence Detection System (Applied Biosystems) according to the manufacturer's protocol. In brief, relative transcript levels were determined using the relative quantitation method by measuring the change in threshold cycle between the gene of interest and the internal control glyceraldehyde-3-phosphate dehydrogenase. Primers and fluorescent probes used in these PCRs are listed in Table 1.
|
Reporter Gene Assays. Culture and transfection of CV-1 cells with Lipofectamine transfection reagent (Invitrogen, Carlsbad, CA) was performed as previously published (Handschin et al., 2000). Expression vectors encoding mouse PXR and mouse CAR as well as the β-galactosidase vector used for signal normalization have been described previously (Handschin et al., 2002). For construction of hemagglutinin-tagged vp16 fusion proteins, nuclear receptor sequences were amplified from expression plasmids and subcloned into pcDNA3/vp16-hemagglutinin (HA) (a kind gift from Dr. Dieter Kressler, Biozentrum, University of Basel, Switzerland). Reporter vectors were based on PGL3-LUC (Promega, Madison, WI). Genomic DNA from the murine Insig-1 enhancer region was amplified using PCR primers carrying restriction sites suitable for direct subcloning into the reporter vector.
Preparation of Primary Hepatocytes. For the preparation of mouse hepatocytes animals were anesthetized with ketamine/xylazine (Sigma). The portal vein was cannulated and perfused with HEPES-EGTA, pH 7.4, for 5 min and then with collagenase (type 2; Worthington, Lakewood, NJ) for 6 min. The livers were excised, and cells were filtered through a nylon mesh and centrifuged three times at 50g and 4°C for 5 min each. After determination of viability, cells were plated at a density of 400,000 cells/well (12-well plate) and were allowed to attach for 2 h in Williams' E medium without phenol red (Invitrogen), 10% fetal calf serum, 4 µg/ml insulin, 200 µM glutamine, and 1% penicillin/streptomycin (50 IU/ml) on collagen-coated dishes. Induction experiments were performed in the same medium without fetal calf serum and with reduced insulin (2 µg/ml) but with the addition of 1 µM hydrocortisone.
Primary human hepatocytes in suspension were allowed to attach on collagen-coated plates in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum, 1% penicillin/streptomycin (50 IU/ml), and 1 µM dexamethasone overnight before the start of the experiments. For induction, cells were cultured in Dulbecco's modified Eagle's medium without serum but supplemented with insulin-transferrin-selenium mixture (Sigma) and 1 µM hydrocortisone.
|
). Immunoblotting, Gel-Mobility-Shift Assay, and Chromatin Immunoprecipitation. For Western blot analysis of SREBP1, liver proteins were extracted from 100 to 200 mg of frozen tissue in 1 ml of ice-cold buffer [50 mM Tris-HCl, pH 7.4, 100 mM KCl, 1 mM EDTA, pH 8.0, 10 mM β-mercaptoethanol, 5 mM dithiothreitol, 0.1% (v/v) Triton X-100, 0.1% (v/v) Nonidet P-40, 1 tablet/50 ml buffer Protease Inhibitor Cocktail (Roche Diagnostics] in a 5-ml polystyrene tube using a Polytron Rotor-Stator Homogenizer (Kinematica, Basel, Switzerland). The homogenate was centrifuged for 30 min at 10,000 rpm at 4°C, and 50 µg of protein was loaded on a 10% SDS gel. SREBP1 isoforms were detected using mouse anti-SREBP1 monoclonal antibody (anti-SREBP1 monoclonal antibody; BD PharMingen, San Diego, CA).
Transcription factors were synthesized in vitro by using the TNT T7 Quick-Coupled Transcription/Translation System (Promega) according to the manufacturer's instructions. Probes were labeled with the Klenow fragment of DNA polymerase in the presence of radiolabeled [-32P]ATP, and the probe was purified over a Biospin 6 chromatography column. A volume of labeled oligonucleotide corresponding to 100,000 cpm was used for each reaction in 10 mM Tris-HCl, pH 8.0, 40 mM KCl, 0.05% Nonidet P-40, 6% (v/v) glycerol, 1 mM dithiothreitol containing 0.2 µg of poly(dI-dC) · poly(dI-dC) and 2.5 µl of the in vitro-synthesized proteins as described previously (Handschin et al.). The mix was incubated for 20 min at room temperature and subsequently electrophoresed on a 6% polyacrylamide gel in 0.5x Tris-borate/EDTA buffer (1x Tris-borate/EDTA buffer is composed of 0.9 M Tris-Borate and 0.002 M EDTA, pH 8.3) followed by autoradiography at 70°C. Oligonucleotides used for electrophoretic mobility shift assays were obtained as follows. For the mouse Insig-1 DR4. the following oligonucleotides were annealed and labeled using polynucleotide kinase: CCTGAGGGTCAACAGAGGACACCTAG (forward) and CTAGGTGTCCTCTGTTGACCCTCAGG (reverse).
Chromatin immunoprecipitation was performed using the EZ-Chip kit from Millipore (Billerica, MA). Primary mouse hepatocytes were infected with adenoviral particles encoding HA-tagged vp16-mouse CAR or mouse PXR, respectively. After 24 h, cells were harvested, and samples were processed according to the manufacturer's recommendations. For immunoprecipitation, HA antibody (monoclonal HA.11 clone 16B12 mouse IgG1 MMS-101P) from Covance Research Products (Princeton, NJ) was used.
Targeting of Insig-1 in Primary Mouse Hepatocytes by siR-NAs. For the transfection of primary mouse hepatocytes, Dharmafect1 transfection reagent (Dharmacon RNA Technologies (Lafayette, CO) was used. siRNAs (100 nM; siGenome SmartPool mINSIG1 and siControl Nontargeting siRNAPool; Dharmacon) and 14 µl of Dharmafect were used according to the manufacturer's instructions. Six hours after transfection, medium was removed and replaced with fresh medium without serum. Twenty-four hours later, medium was replace by medium containing 500 µM phenobarbital and mRNAs and Srebp-1 protein analyzed after 24 h as described.
|
Results |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
), was unchanged, whereas stearoyl-CoA desaturase 1, which is a target gene of Srebp-1 (Shimano et al., 1999), was reduced after drug treatment. Again, TCPOBOP showed strongest effects (Fig. 1, middle). Whether the reduction in hepatic triglycerides was due to reduced nuclear expression of Srebp-1 was tested by immunoblotting of liver protein extracts from drug-treated animals using an antibody that can discriminate between the inactive precursor form of Srebp1 and the activated nuclear (mature) form of Srebp-1 (Fig. 2A). The graph shows a reduction in nuclear content of Srebp-1 in drug-treated mice with strongest effects by PB and TCPOBOP. A time course experiment in primary mouse hepatocytes revealed that the time-dependent induction profile of Insig-1 mRNA paralleled the one of the classic CAR- and PXR-inducible gene Cyp2b10 (Fig. 2B).
|
|
; Fig. 3). Figure 3 shows that two typical target genes of PXR and CAR, Cyp2b10 and Cyp3a11, expectedly were not inducible by PB in PXR/CAR-null mice. Blunted induction of Insig-1 mRNA in these animals after PB treatment as well as an unchanged triglyceride profile compared with wild-type animals was observed (Fig. 3, bottom). These data support a PXR/CAR-dependent mechanism for the triglyceride-lowering effect of inducer compounds.
|
). This element responded well to PXR and CAR, and specificity was assessed using a mutated version of the DR-4 element, which resulted in a decreased response to drugs (Fig. 4A). The same DR-4 element was used in electromobility shift assays together with in vitro-translated PXR, CAR, and their heterodimeric partner, RXR (Fig. 4B). A strong band was observed when CAR and RXR were incubated with the oligonucleotide carrying the DR-4 element, and less intensive binding appeared when PXR was used. Both nuclear receptor complexes were supershifted by coincubation with an anti-RXR antibody. Functionality of this element was tested in vivo by chromatin immunoprecipitation in primary mouse hepatocytes (Fig. 4C). Cells were infected with adenovirus particles expressing HA-tagged versions of both CAR and PXR. The amplified PCR product corresponds to the 157-bp region in the murine Insig-1 promoter where the designated DR-4 element is located. In Fig. 5B, a reporter gene analysis using the Insig-1 DR-4 with inducers of mouse PXR and CAR, respectively, was performed and revealed a 4-fold induction after PCN treatment and a 7.2-fold induction after TCBOBOP treatment (Fig. 5A).
|
|
As recently reported, induction of drug-metabolizing enzymes requires activation of AMP-activated kinase (Rencurel et al., 2005, 2006). We therefore wanted to test whether this kinase, alone or in combination with drug, can regulate transcription of Insig-1 (Fig. 6B). Primary human hepatocytes were infected with control virus (expressing β-galactosidase) or different versions of AMPK: a dominant-negative construct (kinase dead), the -1 or the -2 subunit of AMPK. Although the dominant-negative version repressed expression of Insig-1, both subunits induced Insig-1 with stronger effects seen using the -1 subunit. Furthermore, exposure to PB enhanced these effects (Fig. 6B).
|
Discussion |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
) and that overexpression of Insig-1 in livers of mice has been shown to cause a drop in triglyceride levels with smaller effects on cholesterol (Engelking et al., 2004; Takaishi et al., 2004) made Insig-1 an interesting candidate gene for transcriptional regulation by CAR and PXR. We first established that in CAR/PXR double-knockout mice, PB had lost its effect on triglycerides, and there was no induction of Insig-1 (Fig. 3). This strongly supported the idea of a CAR/PXR-mediated transcriptional activation of the Insig-1 gene. Moreover, the induction of Insig-1 mRNA appeared early after the addition of drug (Fig. 2B), making a rapid decrease in the activated nuclear form of Srebp-1 protein levels a plausible scenario (Fig. 2A). The more pronounced effects on triglycerides seen with the CAR activators TCPOBOP and PB compared with the PXR ligand PCN are in line with the more pronounced activation of the Insig-1 promoter by CAR (Figs. 4A and 5B), with the higher affinity of CAR to bind to the DR-4 element (Fig. 4B) as well as with the stronger enrichment in CAR-immunoprecipitated samples of this fragment (Fig. 4C). A role for Insig-1 in mediating these effects was established in mouse hepatocytes with siRNA-reduced Insig-1 expression (Fig. 5B). Although the repressive effect of PB on nuclear protein levels of Srebp-1 was evident, in cells with repressed Insig-1 expression, this effect was not detectable, strongly supporting the concept that PXR/CAR-activated Insig-1 is responsible for reduced Srebp-1 and thereby for lowered hepatic triglycerides. Moreover, the fact that these effects could be reproduced in human hepatocytes supports the concept of a general mechanism by which drugs affect hepatic lipid biosynthesis (Fig. 6A). Insig-2, the other member of the Insig family of Srebp-regulating genes, was not affected by PXR/CAR inducers, and a potential role of this gene in linking drug treatment to reduced triglyceride levels was not pursued. It cannot be ruled out, of course, that under different conditions, this gene may also play a role in mediating lipid synthesis due to a xenobiotic challenge.
An effect of PXR on lipogenic genes has recently been described by Nakamura et al. (2007). In strong support of our data, they observed down-regulation of lipogenic genes by the PXR-specific activator PCN, and this effect was not seen in PXR-/- mice. Interestingly, Nakamura et al. furthermore observed an induction of stearoyl-CoA desaturase 1 in PCN-treated animals that were fasted for 24 h. This suggests an additional level of regulation of lipogenesis by xenobiotics in the fasted state.
Another new finding of our study is the role of AMPK in the induction of Insig-1 (Fig. 6B). AMPK is considered a metabolic master-switch sensing cellular energy levels and regulating glucose transport and gluconeogenesis. It is activated in response to metabolic stress signals that deplete cellular ATP and stimulate fatty acid oxidation (Kahn et al., 2005). It was recently shown that CAR-dependent induction of CYP2B by PB requires activation of AMPK (Rencurel et al., 2006). Blättler et al. (2007) demonstrated that PB interferes with mitochondrial function and activates the AMPK upstream kinase LKB1, which then mediates the activation cascade of AMPK to CAR. Interestingly, AMPK, either via activation by 5-aminoimidazole-4-carboxamide riboside or via adenoviral overexpression of its catalytic subunit, also has been shown to reduce Srebp-1c expression (Zhou et al., 2001; Foretz et al., 2005). Because these observations lacked a mechanistic explanation, the activation of Insig-1 by AMPK shown here may indicate a signaling pathway leading to repression of Srebp-1c. In line with observations by Rencurel et al. (2006), AMPK alone seems capable of regulating expression of CAR/PXR target genes, and addition of a nuclear receptor activator leads to a synergistic effect on gene transcription. However, the detailed interplay among PB, nuclear receptors, and AMPK in the induction of Insig-1 clearly requires further investigation.
In addition, the data presented here account for the immediate physiologic response of the liver to a xenobiotic challenge. Long-term treatment with drugs leading to constant activation of PXR and/or CAR may lead to diverse adaptive gene regulations to maintain lipid homeostasis (Kiyosawa et al., 2004; Zhou et al., 2006).
In conclusion, the results of our experiments suggest that the signaling pathways involved in mediating the effect of xenobiotics on detoxification also induce Insig-1, a gene regulating lipid biosynthesis, and that this is associated with an acute lowering of triglyceride levels in the liver. Because Insig-1 has recently been suggested as a possible drug target for the treatment of dyslipidemic diseases including diabetes (Nakagawa et al., 2006), the observation that CAR and PXR ligands or activators induce Insig-1 may have clinical consequences and explains the reported alterations in lipid levels after drug therapy.
|
Acknowledgements |
|---|
|
Footnotes |
|---|
ABBREVIATIONS: P450, cytochrome(s) P450; PXR, pregnane X receptor; CAR, constitutive androstane receptor; RXR, retinoid X receptor; ER, endoplasmic reticulum; Srebp, sterol regulatory element binding protein; PB, phenobarbital; TCPOBOP, 1,4-bis[2-(3,5-dichloropyridyloxy)]-benzene; PCN, pregnenolone-16-carbonitrile; RT, reverse transcriptase; PCR, polymerase chain reaction; HA, hemagglutinin; AMPK, AMP-activated kinase; siRNA, small interfering RNA; bp, base pair(s).
Address correspondence to: Urs A. Meyer, Division of Pharmacology/Neurobiology, Biozentrum of the University of Basel, Klingelbergstrasse 50-70, CH-4056 Basel, Switzerland. E-mail: urs-a.meyer{at}unibas.ch
|
References |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
Blättler SM, Rencurel F, Kaufmann MR, and Meyer UA (2007) In the regulation of cytochrome P450 genes, phenobarbital targets LKB1 for necessary activation of AMP-activated protein kinase. Proc Natl Acad Sci U S A 104: 1045-1050.
El Hadri K, Glorian M, Monsempes C, Dieudonne MN, Pecquery R, Giudicelli Y, Andreani M, Dugail I, and Feve B (2004) In vitro suppression of the lipogenic pathway by the nonnucleoside reverse transcriptase inhibitor efavirenz in 3T3 and human preadipocytes or adipocytes. J Biol Chem 279: 15130-15141.
Engelking LJ, Kuriyama H, Hammer RE, Horton JD, Brown MS, Goldstein JL, and Liang G (2004) Overexpression of Insig-1 in the livers of transgenic mice inhibits SREBP processing and reduces insulin-stimulated lipogenesis. J Clin Invest 113: 1168-1175.[CrossRef][Medline]
Foretz M, Ancellin N, Andreelli F, Saintillan Y, Grondin P, Kahn A, Thorens B, Vaulont S, and Viollet B (2005) Short-term overexpression of a constitutively active form of AMP-activated protein kinase in the liver leads to mild hypoglycemia and fatty liver. Diabetes 54: 1331-1339.
Hall IH, Patrick MA, and Maguire JH (1990) Hypolipidemic activity in rodents of phenobarbital and related derivatives. Arch Pharm (Weinheim) 323: 579-586.[CrossRef][Medline]
Handschin C and Meyer UA (2003) Induction of drug metabolism: the role of nuclear receptors. Pharmacol Rev 55: 649-673.
Handschin C, Podvinec M, Amherd R, Looser R, Ourlin JC, and Meyer UA (2002) Cholesterol and bile acids regulate xenosensor signaling in drug-mediated induction of cytochromes P450. J Biol Chem 277: 29561-29567.
Handschin C, Podvinec M, and Meyer UA (2000) CXR, a chicken xenobiotic-sensing orphan nuclear receptor, is related to both mammalian pregnane X receptor (PXR) and constitutive androstane receptor (CAR). Proc Natl Acad Sci U S A 97: 10769-10774.
Horton JD, Shimomura I, Brown MS, Hammer RE, Goldstein JL, and Shimano H (1998) Activation of cholesterol synthesis in preference to fatty acid synthesis in liver and adipose tissue of transgenic mice overproducing sterol regulatory element-binding protein-2. J Clin Invest 101: 2331-2339.[Medline]
Hua X, Sakai J, Brown MS, and Goldstein JL (1996) Regulated cleavage of sterol regulatory element binding proteins requires sequences on both sides of the endoplasmic reticulum membrane. J Biol Chem 271: 10379-10384.
Huang W, Zhang J, Chua SS, Qatanani M, Han Y, Granata R, and Moore DD (2003) Induction of bilirubin clearance by the constitutive androstane receptor (CAR). Proc Natl Acad Sci U S A 100: 4156-4161.
Kahn BB, Alquier T, Carling D, and Hardie DG (2005) AMP-activated protein kinase: ancient energy gauge provides clues to modern understanding of metabolism. Cell Metab 1: 15-25.[CrossRef][Medline]
Kiyosawa N, Tanaka K, Hirao J, Ito K, Niino N, Sakuma K, Kanbori M, Yamoto T, Manabe S, and Matsunuma N (2004) Molecular mechanism investigation of phenobarbital-induced serum cholesterol elevation in rat livers by microarray analysis. Arch Toxicol 78: 435-452.[Medline]
Locker J, Tian J, Carver R, Concas D, Cossu C, Ledda-Columbano GM, and Columbano A (2003) A common set of immediate-early response genes in liver regeneration and hyperplasia. Hepatology 38: 314-325.[Medline]
Maglich JM, Stoltz CM, Goodwin B, Hawkins-Brown D, Moore JT, and Kliewer SA (2002) Nuclear pregnane X receptor and constitutive androstane receptor regulate overlapping but distinct sets of genes involved in xenobiotic detoxification. Mol Pharmacol 62: 638-646.
Nakagawa Y, Shimano H, Yoshikawa T, Ide T, Tamura M, Furusawa M, Yamamoto T, Inoue N, Matsuzaka T, Takahashi A, et al. (2006) TFE3 transcriptionally activates hepatic IRS-2, participates in insulin signaling and ameliorates diabetes. Nat Med 12: 107-113.[CrossRef][Medline]
Nakamura K, Moore R, Negishi M, and Sueyoshi T (2007) Nuclear pregnane X receptor cross-talk with FoxA2 to mediate drug-induced regulation of lipid metabolism in fasting mouse liver. J Biol Chem 282: 9768-9776.
Podvinec M, Kaufmann MR, Handschin C, and Meyer UA (2002) NUBIScan, an in silico approach for prediction of nuclear receptor response elements. Mol Endocrinol 16: 1269-1279.
Rencurel F, Foretz M, Kaufmann MR, Stroka D, Looser R, Leclerc I, da Silva Xavier G, Rutter GA, Viollet B, and Meyer UA (2006) Stimulation of AMP-activated protein kinase is essential for the induction of drug metabolizing enzymes by phenobarbital in human and mouse liver. Mol Pharmacol 70: 1925-1934.
Rencurel F, Stenhouse A, Hawley SA, Friedberg T, Hardie DG, Sutherland C, and Wolf CR (2005) AMP-activated protein kinase mediates phenobarbital induction of CYP2B gene expression in hepatocytes and a newly derived human hepatoma cell line. J Biol Chem 280: 4367-4373.
Shimano H (2001) Sterol regulatory element-binding proteins (SREBPs): transcriptional regulators of lipid synthetic genes. Prog Lipid Res 40: 439-452.[CrossRef][Medline]
Shimano H, Yahagi N, Amemiya-Kudo M, Hasty AH, Osuga J, Tamura Y, Shionoiri F, Iizuka Y, Ohashi K, Harada K, et al. (1999) Sterol regulatory element-binding protein-1 as a key transcription factor for nutritional induction of lipogenic enzyme genes. J Biol Chem 274: 35832-35839.
Staudinger JL, Goodwin B, Jones SA, Hawkins-Brown D, MacKenzie KI, LaTour A, Liu Y, Klaassen CD, Brown KK, Reinhard J, et al. (2001) The nuclear receptor PXR is a lithocholic acid sensor that protects against liver toxicity. Proc Natl Acad Sci U S A 98: 3369-3374.
Takaishi K, Duplomb L, Wang MY, Li J, and Unger RH (2004) Hepatic insig-1 or -2 overexpression reduces lipogenesis in obese Zucker diabetic fatty rats and in fasted/refed normal rats. Proc Natl Acad Sci U S A 101: 7106-7111.
Venkatesan N, Davidson MB, Simsolo RB, and Kern PA (1994) Phenobarbital treatment enhances insulin-mediated glucose metabolism and improves lipid metabolism in the diabetic rat. Metabolism 43: 348-356.[CrossRef][Medline]
Yabe D, Brown MS, and Goldstein JL (2002) Insig-2, a second endoplasmic reticulum protein that binds SCAP and blocks export of sterol regulatory element-binding proteins. Proc Natl Acad Sci U S A 99: 12753-12758.
Yang T, Espenshade PJ, Wright ME, Yabe D, Gong Y, Aebersold R, Goldstein JL, and Brown MS (2002) Crucial step in cholesterol homeostasis: sterols promote binding of SCAP to INSIG-1, a membrane protein that facilitates retention of SREBPs in ER. Cell 110: 489-500.[CrossRef][Medline]
Zhang J, Huang W, Qatanani M, Evans RM, and Moore DD (2004) The constitutive androstane receptor and pregnane X receptor function coordinately to prevent bile acid-induced hepatotoxicity. J Biol Chem 279: 49517-49522.
Zhou G, Myers R, Li Y, Chen Y, Shen X, Fenyk-Melody J, Wu M, Ventre J, Doebber T, Fujii N, et al. (2001) Role of AMP-activated protein kinase in mechanism of metformin action. J Clin Invest 108: 1167-1174.[CrossRef][Medline]
Zhou J, Zhai Y, Mu Y, Gong H, Uppal H, Toma D, Ren S, Evans RM, and Xie W (2006) A novel pregnane X receptor-mediated and sterol regulatory element-binding protein-independent lipogenic pathway. J Biol Chem 281: 15013-15020.
This article has been cited by other articles:
|
|
 |
|
  N. Anderson and J. Borlak Molecular Mechanisms and Therapeutic Targets in Steatosis and Steatohepatitis Pharmacol. Rev., September 1, 2008; 60(3): 311 - 357. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|
 |
 |
 |
