![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
|
|
|
|
|
||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
B Pathway in Breast Cancer
Institut National de la Santé et de la Recherche Médicale, U844, and University of Montpellier I, Montpellier, France (C.C., C.B., A.F., S.D., C.Jor., G.L.); and Department of Medicine, Pharmacology, and Center for Gastrointestinal Biology and Disease, University of North Carolina at Chapel Hill, Chapel Hill, North Carolina (M.M., C.Job.)
Received for publication March 19, 2008.
Accepted for publication July 30, 2008.
 |
Abstract |
|---|
 Top Abstract Materials and MethodsResultsDiscussionReferences |
|---|
)-negative breast cancer cells compared with ER-positive breast cancer cells. We now demonstrate that histone deacetylases (HDACs) play an essential role in the regulation of IL-8 gene expression in ER-positive MCF-7 breast cancer cells. Treatment of MCF-7 cells with the HDAC inhibitor trichostatin A (TSA) led to a strong up-regulation of IL-8 protein and RNA levels in MCF-7 cells. The up-regulation of IL-8 in MCF-7 cells was time- and concentration-dependent. Moreover, run-on and transfection experiments demonstrated that IL-8 induction by HDAC inhibitors was transcriptional and involved mainly the nuclear factor-
B (NF-B) site of the IL-8 promoter. These observations are corroborated by an up-regulation of NF-B activity in MCF-7 cells in the presence of TSA. In addition, blocking NF-B pathway by adenoviral delivery of a dominant-negative IBorIB kinase complex 2 (IKK2) mutant abolished IL-8 gene induction by histone deacetylase inhibitors. HDAC inhibitors triggered IKK phosphorylation and up-regulated p65 nuclear translocation, although they decreased the protein levels of IB, which accounts for NF-B activation. TSA increased binding of acetylated histone 3 to the IL-8 gene promoter. In summary, our results demonstrate that NF-B pathway repression by HDAC is responsible for the low expression of IL-8 in ER-positive breast cancer cells.
). IL-8 has been shown to be expressed by a number of cancer cells, including breast cancer (Freund et al., 2003, 2004; Ali and Lazennec, 2007; Bièche et al., 2007; Chavey et al., 2007). IL-8 is believed not only to favor the invasion and the metastatic spread of cancer cells but also to increase angiogenesis in growing tumors (Freund et al., 2003; Lin et al., 2004; Bièche et al., 2007; Yao et al., 2007). We have reported previously that IL-8 is overexpressed in highly invasive breast cancer cells lacking the estrogen receptor (ER) compared with ER-positive breast cancer cells (Freund et al., 2003; Ali and Lazennec, 2007).
We hypothesized that the low expression of IL-8 in ER-positive breast cancer cells could be the result of epigenetic repression. Epigenetic events like DNA methylation and histone acetylation are known to play an important role in regulating gene expression and in cancer (Marks et al., 2000; Margueron et al., 2003; Duong et al., 2006; Yang and Seto, 2007). Unwinding of the closed, repressive chromatin configuration during active transcription of genes permits accessibility to transcription factors and transcriptional control. It is believed that histone acetylation and acetylation of transcription factors, governed by histone acetyltransferase activity, generally promotes transcriptional activation of genes after conformational changes within the chromatin, whereas repression of transcriptional activity is commonly correlated with histone hypoacetylation due to histone deacetylase (HDAC) activity (Wu, 1997; Kuo and Allis, 1998; Wade, 2001). Differential acetylation of histones and transcription factors plays an important regulatory role in the developmental process, proliferation, and differentiation (Timmermann et al., 2001). Consistent with this is the involvement of aberrant acetylation in cancer. Both histone hyperacetylation and hypoacetylation seem to be implicated in the neoplastic process, depending on the target gene involved. Thus, in cancer, some genes such as tumor suppressor genes might be repressed by the inappropriate recruitment of HDACs (Glozak and Seto, 2007; Yang and Seto, 2007). Inhibitors of histone deacetylase are now being evaluated for their therapeutic effects in cancer (Marks et al., 2000; Rasheed et al., 2007).
|
|
-positive MCF-7 breast cancer cells producing low IL-8 levels. Moreover, IL-8 induction by TSA in MCF-7 cells involves the NF-B pathway. This occurs through an increase of p65 nuclear translocation and IKK phosphorylation, a concomitant decrease of IB levels, and an acetylation of histone H3 on the IL-8 promoter. In summary, our results demonstrate that NF-B pathway repression by HDAC is responsible for the low expression of IL-8 in ER-positive breast cancer cells. |
Materials and Methods |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
). CAMA-1 and BT-474 cells were cultured in DMEM/F-12 medium supplemented with 10% FCS.
Plasmids. Wild-type and mutant constructs of IL-8 promoter corresponding to -1481/+44 bp have been described previously (Freund et al., 2004). NF-B family expression vectors (p50 and p65) and the dominant-negative form of IB, IKK2, were a kind gift of Dr. B. B. Aggarwal, Dr. W. C. Greene, Dr. R. De Martin, and Dr. H. Nakshatri. pNF-B reporter plasmid was from Clontech (Mountain View, CA). CMV-GAL corresponds to the β-galactosidase gene under the control of the cytomegalovirus (CMV) promoter.
Transient Transfection. Cells (3 x 105) were plated in six-well plates in DMEM/F-12 supplemented with 10% FCS 24 h before transfection. Transfections were performed as described previously (Lazennec et al., 2001) with Lipofectamine using 4 µg of luciferase reporter along with 100 ng of each expression vector and 0.8 µg of the internal reference reporter plasmid (CMV-Gal) per well. After overnight lipofection, the medium was removed, and the cells were placed into fresh medium supplemented with control vehicle ethanol or TSA. Eighteen hours later, cells were harvested and assayed for luciferase activity on a Centro LB960 Berthold luminometer (Berthold Technologies, Bad Wildbad, Germany). β-Galactosidase was determined as described previously (Duong et al., 2006).
|
|
B [IB(SA)2, with S32A and S36A mutations], dominant-negative IKK2, and dominant-negative NIK used in this study and their propagation have been described previously (He et al., 1998; Lazennec et al., 2001; Oitzinger et al., 2001; Haller et al., 2002; Russo et al., 2002; Lucas et al., 2003; Freund et al., 2004). MCF-7 cells were infected for 6 h at a multiplicity of infection of 100 with the different adenoviruses in DMEM/F-12 10% FCS. The next day, the medium was changed, and the cells were treated with ethanol vehicle or TSA for 18 h before collecting culture medium and harvesting cells for ELISA assays and RNA isolation, respectively.
Cell Lysis and Western Blotting. Cells were harvested, centrifuged (5 min, 800g, 4°C), and washed with ice-cold phosphate-buffered saline. For whole-cell extracts, cells were harvested in Tris-glycerol buffer (Tris-HCl 50 mM, EDTA 1.5 mM, and 10% glycerol) supplemented with protease inhibitor cocktail (Roche, Mannheim, Germany) and were then sonicated. For nuclear cell extracts, cells were centrifuged, and pellets were resuspended in buffer A (10 mM HEPES pH 7.2, 60 mM KCl, 1 mM EDTA, and 0.5% Nonidet P-40) supplemented with protease inhibitor cocktail (Roche) and incubated on ice for 15 min and then centrifuged (30 s, 12,000g, 4°C). Pelleted nuclei were resuspended in buffer B (10 mM HEPES pH 7.2, 60 mM KCl, and 1 mM EDTA) supplemented with protease inhibitor cocktail, lysed by three freezing/defreezing cycles (liquid nitrogen, 37°C) and then centrifuged (10 min, 13,000 rpm, 4°C). For IKK phosphorylation assessment, cells were scraped in cold phosphate-buffered saline and then lysed in buffer (1% Triton X-100, 50 mM Tris-HCl, pH 7.5, 100 mM NaCl, and 2 mM EDTA) containing phosphatase inhibitors (β-GP 20 mM, sodium fluoride 10 mM, and sodium orthovanadate 1 mM) and protease inhibitors. Protein extracts were subjected to SDS-polyacrylamide gel electrophoresis and Western blot analyses done using p65, p50, IB (all Santa Cruz Biotechnology, Santa Cruz, CA), IKK, phosphor-IKK (Ser180)/IKKβ (Ser181) (both from Cell Signaling Technology Inc., Danvers, MA), and actin (Sigma-Aldrich, St. Louis, MO). Immunoreactivity was detected with Amersham Enhanced Chemiluminescence system (GE Healthcare, Chalfont St. Giles, Buckinghamshire, UK). Actin was used as a loading control. IKK-P phosphorylation was quantified with the Scion Image software (Scion Corporation, Frederick, MD).
IL-8 ELISA. IL-8 concentration in culture supernatants was determined by ELISA with Duoset kit (R&D Systems, Minneapolis, MN) as recommended by the manufacturer.
RNA Extraction, Reverse Transcription, and Quantitative PCR. Total RNA was isolated with TriReagent reagent (Euromedex, Souffelweyersheim, France) as described by the manufacturer. Reverse transcription was performed using 5 µg of total RNA, random primers, and Superscript II enzyme (Invitrogen, Carlsbad, CA). Quantitative PCR was performed with FastStart DNA Master SYBR Green I kit (Roche) on a Light Cycler instrument (Roche) as specified by the manufacturer. Ribosomal protein S9 (rS9) was used as an internal control. Primers used were as follows: IL-8: sense, CACCGGAAGGAACCATCTCACT; antisense, TCAGCCCTCTTCAAAAACTTCTCC; IB: sense, CGTTATGAGCGCAAAGG; antisense, AGTCACTCGAAGCACA; P50: sense, GCAAATCTCCGGGGGCATCAAACC; antisense, CTCCGCTTCCGCTGCACCTCTTCC; p65: sense, CTCCGCGGGCAGCATCC; antisense, AGCCGCACAGCATTCAGGTCGTAG; and rS9: sense, AAGGCCGCCCGGGAACTGCTGAC; antisense, ACCACCTGCTTGCGGACCCTGATA.
Run-On Assay. IL-8 and rS9 transcription was measured by run-on assays described previously (Freund et al., 2004). In brief, equal amounts (107 cpm/ml) of labeled nuclear RNA were hybridized at 65°C for 24 h to 
-probe membranes (Bio-Rad, Hercules, CA) bound previously with 5 µg of linearized plasmid DNAs. The immobilized plasmids used were pCR2-IL8 and pCR2-rS9. After washing, the filters were subjected to autoradiography. Radioactive transcripts were quantified on a Fuji Bas Reader (Fuji Film, Tokyo, Japan). Data were normalized to transcription of the rS9 gene.
Chromatin Immunoprecipitation Analysis. MCF-7 cells were stimulated with TSA (500 ng/ml) for 0, 1, 6, and 18 h, and chromatin immunoprecipitation (ChIP) assays were performed an Upstate-Cell Signaling kit (Millipore Bioscience Research Reagents, Temecula, CA) as described previously (Mühlbauer et al., 2008). Immunoprecipitation was carried out using 5 µg of anti-acetyl-histone H3 antibody (acetylated lysines in position 9 and 14 of the protein; Upstate-Cell Signaling Solutions). IL-8 promoter-specific primers (-121 to +61 of the IL-8 promoter) were as follows: IL-8 sense, GGGCCATCAGTTGCAAATC; and ChIP IL-8 antisense, TCCTTCCGGTGGTTTCTTC. Relative-fold changes in H3 were determined by a semiquantitative assay using the ABI 7700 sequence detection system (Applied Biosystems, Foster City, CA) as described previously (Mühlbauer et al., 2008).
|
|
Results |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
-positive MCF-7 breast cancer cells express low levels of IL-8 (Freund et al., 2003), which could be the result of an epigenic repression. To determine whether IL-8 gene expression is modified by acetylation regulation, we treated MCF-7 breast cancer cells with the deacetylase inhibitor TSA. As shown in Fig. 1A, such treatment resulted in a 10-fold increase of secreted IL-8 by MCF-7 cells compared with nontreated control cells. The basal level of IL-8 secretion of MCF-7 was low and between 25 and 50 pg/ml, according to these experiments. The TSA-mediated induction of IL-8 secretion in MCF-7 cells was time- and concentration-dependent with maximal induction at 24 h and 500 ng/ml, respectively (Fig. 1B). As shown by quantitative PCR, treatment of MCF-7 cells with TSA also increased IL-8 mRNA expression above control levels in a time- and dose-dependent manner. Consistent with IL-8 secretion levels, maximal induction of IL-8 mRNA was observed at 24 h and 500 ng/ml, respectively (Fig. 2). It is remarkable that maximal induction of IL-8 mRNA expression in MCF-7 cells exceeded control levels up to 300-fold. Higher doses of TSA did not lead to a further induction of IL-8 gene (Supplemental Fig. 1). The induction of the IL-8 gene expression by TSA was not restricted to MCF-7 cells but could be also observed in BT-474 and CAMA-1 breast cancer cells (Fig. 3).
IL-8 Regulation by TSA Is Transcriptional and Involves the NF-B Pathway. To determine whether the effects of HDAC inhibitors observed in MCF-7 cells were transcriptional, we performed run-on experiments (Fig. 4A). We observed a strong up-regulation of IL-8 gene activity by approximately 100-fold in the presence of TSA. This led us to the question of which sequences of the IL-8 promoter could account for this regulation by TSA. MCF-7 cells were transfected with various 5'-truncated IL-8 promoter-constructs and assayed for their responsiveness to TSA (Fig. 4B). Elimination of sequences located between -1481 and -272 bp of the promoter did not affect significantly the transcriptional response to TSA. On the contrary, a drastically decreased induction by TSA was observed with the -98-bp promoter construct lacking the AP-1 site, compared with the full-size IL-8 promoter. Moreover, the inducibility by TSA was completely lost with the -50-bp IL-8 promoter construct, in which the three upstream sequence elements for AP-1, NF-B, and C/EBP are lacking (Fig. 4B). To further characterize the contribution of defined sequence elements, we tested different point-mutated IL-8 promoter constructs (Fig. 4C). Mutation of the AP-1 or C/EBP site inhibited IL-8 transcriptional activation by TSA by approximately 3-fold, whereas mutation of NF-B completely abolished the responsiveness to TSA, demonstrating that NF-B was the predominant element in TSA-mediated transcriptional activation. It is interesting that the mutation of both C/EBP and AP-1 sites led also to a complete shutdown of TSA induction of IL-8 promoter, suggesting that these sites are also contributing to IL-8 regulation by HDAC inhibitors. We next investigated whether TSA could enhance histone H3 acetylation of the endogenous IL-8 gene promotor. ChIP experiments showed that the levels of acetylated histone H3 present on the IL-8 gene promoter were strongly enhanced by HDAC inhibitor treatment (Fig. 4D).
p65 and IB Are the Main Regulators of IL-8 Promoter Induction in Response to TSA. Because the NF-B site was the main regulator of IL-8 gene regulation by TSA, we analyzed in more detail the contribution of the NF-B pathway to this phenomenon. We further tested the functional involvement of the p50 and p65 subunits of NF-Bin TSA-mediated IL-8 promoter induction in MCF-7 cells. Although cotransfection with p65 alone resulted in approximately 3-fold potentiation of IL-8 promoter activity in response to TSA in MCF-7 cells, cotransfection with p50 did not further modulate TSA induction of IL-8 promoter (Fig. 5A). Cotransfection of both p50 and p65 increased IL-8 promoter activity by approximately 2-fold in the presence of TSA. Next, we took advantage of an NF-B super-repressor, IB IB(SA)2 (Haller et al., 2002), which expresses an IB protein that is not degraded by the proteasome and thus prevents both p65 nuclear translocation and DNA binding. It is interesting that IB(SA)2 reduced TSA induction of IL-8 promoter by approximately 80% (Fig. 5A). Based on these results, we analyzed whether NF-B activity was differentially regulated by TSA in MCF-7 cells, by transfecting a NF-B reporter (Fig. 5B). When TSA was added, the reporter activity was enhanced approximately 60-fold in MCF-7 cells, demonstrating that NF-B signaling was activated (Fig. 5B).
|
B signaling pathway, we infected the cells with dominant-negative forms of IB, IKK2, and NIK (Fig. 6A). Dominant-negative NIK reduced by half IL-8 RNA induction by TSA, whereas IKK2dn and IBdn decreased by more than 90% IL-8 RNA levels (Fig. 6A). Measurement of secreted IL-8 levels showed that Ad-IBdn virus could reduce by approximately 80% IL-8 secretion in the presence of TSA (Fig. 6B). We next assessed whether IKK was subjected to phosphorylation upon TSA treatment. Our results showed that IKK total levels were not affected by TSA treatment, whereas IKK and IKKβ phosphorylation were increased by TSA addition (Fig. 6C).
NF-B Signaling Is Modulated by HDAC Inhibitors. Because NF-B signaling was strongly enhanced by TSA, we evaluated whether p50 and p65 levels were modulated by HDAC inhibition. At the RNA level, p65 levels remained unchanged, whereas p50 RNA was increased by 2-fold (Fig. 7A). In terms of proteins, total p65 protein levels remained unchanged (Fig. 7B, right), whereas p65 nuclear translocation increased (Fig. 7B, left). In contrast, nuclear p50 protein levels were not affected (Fig. 7C). In addition, IB expression was reduced both at the RNA and protein levels by TSA (Fig. 7, D and E). IB down-regulation by TSA could be reduced by the use of MG-132 proteasome inhibitor, demonstrating that IB protein was also subject to degradation by HDAC inhibitor treatment (data not shown).
|
|
Discussion |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
-positive breast cancer cells could be the result of an inhibition by HDACs. We show that in MCF-7 cells, in which constitutive IL-8 gene expression was low, histone deacetylase inhibition with TSA increased dramatically IL-8 production. This result could be obtained with other ER-positive breast cancer cells such as BT-474 and CAMA-1 cells. The increase in IL-8 secretion was also consistent with an increase in IL-8 RNA, gene transcription, histone H3 acetylation on the IL-8 promoter, and increased activity of the IL-8 promoter. This regulation seems relatively early, because IL-8 RNA levels are already increased after 8 h of TSA treatment. However, to obtain a full induction, a treatment for 24 h with HDAC inhibitors was required. Such strong regulation of cytokine genes by HDAC inhibitors has been reported for IL-6 when cells were cotreated with TNF- and TSA (Zhong et al., 2002; Adam et al., 2003), whereas HDAC inhibitors are also capable of repressing the lipopolysaccharide-induced expression of cytokines such as TNF-, IL-1β, or interferon-
(Leoni et al., 2002). HDAC inhibitors have been shown to induce IL-8 gene expression in most studies investigating cell types from different origins, but this occurs generally in the presence of inducers such as TNF- but not with HDAC inhibitors alone (Ashburner et al., 2001; Rahman et al., 2002; Gilmour et al., 2003; Tomita et al., 2003). However, it is worth mentioning that, in most instances, HDAC inhibitors were acting mainly in cooperation with other inducers of IL-8 gene expression. This is the case for the synergy between HDAC inhibitors and IL-1β (Ito et al., 2001; Wen and Wu, 2001; Böcker et al., 2003) or TNF- (Ashburner et al., 2001; Iwata et al., 2002; Adam et al., 2003). On the other hand, in some cell types, IL-8 expression is even down-regulated by HDAC inhibitors (Hoshimoto et al., 2002; Iwata et al., 2002).
In breast cancer cells, HDAC inhibitors were sufficient to induce IL-8 transcription. Using serial deletions and mutations of the IL-8 promoter, we show that NF-B is the major pathway involved in TSA-induced IL-8 gene expression in MCF-7 breast cancer cells, although AP-1 and C/EBP sites also contribute to achieve maximal induction by HDAC inhibitors. The importance of NF-B in TSA-induced IL-8 regulation was further demonstrated by using the NF-B inhibitors capsaicin (data not shown), IB super-repressor and dominant-negative IKK2, and the fact that TSA strongly up-regulates the activity of a synthetic NF-B responsive gene, which suggests that both upstream and downstream mediators of NF-B pathway are affected. In addition, we demonstrate that nuclear translocation of p65 was increased with TSA treatment, whereas IB protein levels decreased. This is in contrast to the results obtained by Mayo et al. (2003) in non-small-cell lung cancer cells, who did not observe any change in IB levels after TSA treatment, suggesting that IB regulation might be cell-specific (Mayo et al., 2003). Our findings are also in line with recent reports in which TNF- was shown to increase nuclear localization of IKK and p65 (Anest et al., 2003). IKK and IKKβ are required for histone H4 acetylation by TNF- but not by TSA, whereas histone H3 phosphorylation by TNF- or TSA involves IKK and IKKβ (Yamamoto et al., 2003). We observed that IB down-regulation by TSA could be antagonized by using proteasome inhibitors such as MG-132 (data not shown). Our results suggest that the hyperactivation of NF-B pathway and concomitant increased IL-8 expression by TSA is the result of an enhancement of p65 translocation, a reduced sequestration of p65 by IB, and an enhanced H3 acetylation on the gene promoter. In addition, we observed an increased phosphorylation of IKK and IKKβ with TSA treatment. It has been reported that the p65 subunit of NF-B is subject to reversible deacetylation by HDAC3, which promotes effective binding to IB and leads in turn to nuclear export of NF-B, thus ensuring control of the duration of the NF-B transcriptional response (Chen et al., 2001). Deacetylase inhibition has been shown to potentiate TNF-induced DNA binding activity and nuclear localization of NF-B (Gilmour et al., 2003). This is in correlation with a delayed restoration of cytoplasmic inhibitor IB, probably because of persistent degradation by the proteasome (Adam et al., 2003). On the other hand, other studies have not observed modifications on the DNA binding capacity of NF-B proteins (Mayo et al., 2003).
Taken together, our results indicate that activation of the IL-8 gene expression in breast cancer cells is acetylation-dependent and requires NF-B activation. Based on our previous results showing that IL-8 can account for the higher aggressiveness of breast cancer cells, the use of HDAC inhibitors in anticancer strategies could also have adverse effects by increasing the expression of proinflammatory molecules.
|
Acknowledgements |
|---|
|
Footnotes |
|---|
ABBREVIATIONS: IL-8, interleukin-8; ER, estrogen receptor; HDAC, histone deacetylase; TSA, trichostatin A; IKK, IB kinase; NIK, nuclear factor-B-inducing kinase; NF-B, nuclear factor-B; FCS, fetal calf serum; DMEM, Dulbecco's modified Eagle's medium; bp, base pair; ELISA, enzyme-linked immunosorbent assay; ChIP, chromatin immunoprecipitation; PCR, polymerase chain reaction; AP-1, activator protein 1; dn, dominant negative; TNF-, tumor necrosis factor ; C/EBP, CCAAT/enhancer-binding protein; rS9, ribosomal protein S9; MG-132, N-benzoyloxycarbonyl (Z)-Leu-Leu-leucinal.
The online version of this article (available at http://molpharm.aspetjournals.org) contains supplemental material. 
Address correspondence to: Dr. Gwendal Lazennec, INSERM, U844, Site Saint Eloi-Bâtiment INM, 80, rue Augustin Fliche, 34091 Montpellier cedex 5, France. E-mail: Gwendal.Lazennec{at}inserm.fr
|
References |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
B activation by deacetylase inhibitors is associated with a delayed cytoplasmic reappearance of IB. Mol Cell Biol 23: 6200-6209.Ali S and Lazennec G (2007) Chemokines: novel targets for breast cancer metastasis. Cancer Metastasis Rev 26: 401-420.[CrossRef][Medline]
Anest V, Hanson JL, Cogswell PC, Steinbrecher KA, Strahl BD, and Baldwin AS (2003) A nucleosomal function for IkappaB kinase-alpha in NF-kappaB-dependent gene expression. Nature 423: 659-663.[CrossRef][Medline]
Ashburner BP, Westerheide SD, and Baldwin AS Jr (2001) The p65 (RelA) subunit of NF-kappaB interacts with the histone deacetylase (HDAC) corepressors HDAC1 and HDAC2 to negatively regulate gene expression. Mol Cell Biol 21: 7065-7077.
Bièche I, Chavey C, Andrieu C, Busson M, Vacher S, Le Corre L, Guinebretière JM, Burlinchon S, Lidereau R, and Lazennec G (2007) CXC chemokines located in the 4q21 region are up-regulated in breast cancer. Endocr Relat Cancer 14: 1039-1052.
Böcker U, Nebe T, Herweck F, Holt L, Panja A, Jobin C, Rossol S, Sartor BR, and Singer MV (2003) Butyrate modulates intestinal epithelial cell-mediated neutrophil migration. Clin Exp Immunol 131: 53-60.[CrossRef][Medline]
Chavey C, Bibeau F, Gourgou-Bourgade S, Burlinchon S, Boissière F, Laune D, Roques S, and Lazennec G (2007) Estrogen-receptor negative breast cancers exhibit a high cytokine content. Breast Cancer Res 9: R15.[CrossRef][Medline]
Chen L, Fischle W, Verdin E, and Greene WC (2001) Duration of nuclear NF-kappaB action regulated by reversible acetylation. Science 293: 1653-1657.
Duong V, Licznar A, Margueron R, Boulle N, Busson M, Lacroix M, Katzenellenbogen BS, Cavaillès V, and Lazennec G (2006) ERalpha and ERbeta expression and transcriptional activity are differentially regulated by HDAC inhibitors. Oncogene 25: 1799-1806.[CrossRef][Medline]
Freund A, Chauveau C, Brouillet JP, Lucas A, Lacroix M, Licznar A, Vignon F, and Lazennec G (2003) IL-8 expression and its possible relationship with estrogen-receptor-negative status of breast cancer cells. Oncogene 22: 256-265.[CrossRef][Medline]
Freund A, Jolivel V, Durand S, Kersual N, Chalbos D, Chavey C, Vignon F, and Lazennec G (2004) Mechanisms underlying differential expression of interleukin-8 in breast cancer cells. Oncogene 23: 6105-6114.[CrossRef][Medline]
Gilmour PS, Rahman I, Donaldson K, and MacNee W (2003) Histone acetylation regulates epithelial IL-8 release mediated by oxidative stress from environmental particles. Am J Physiol Lung Cell Mol Physiol 284: L533-L540.
Glozak MA and Seto E (2007) Histone deacetylases and cancer. Oncogene 26: 5420-5432.[CrossRef][Medline]
Haller D, Russo MP, Sartor RB, and Jobin C (2002) IKKβ and phosphatidylinositol 3-kinase/Akt participate in non-pathogenic Gram-negative enteric bacteria-induced RelA phosphorylation and NF-B activation in both primary and intestinal epithelial cell lines. J Biol Chem 277: 38168-38178.
He TC, Zhou S, da Costa LT, Yu J, Kinzler KW, and Vogelstein B (1998) A simplified system for generating recombinant adenoviruses. Proc Natl Acad Sci U S A 95: 2509-2514.
Hoshimoto A, Suzuki Y, Katsuno T, Nakajima H, and Saito Y (2002) Caprylic acid and medium-chain triglycerides inhibit IL-8 gene transcription in Caco-2 cells: comparison with the potent histone deacetylase inhibitor trichostatin A. Br J Pharmacol 136: 280-286.[CrossRef][Medline]
Ito K, Lim S, Caramori G, Chung KF, Barnes PJ, and Adcock IM (2001) Cigarette smoking reduces histone deacetylase 2 expression, enhances cytokine expression, and inhibits glucocorticoid actions in alveolar macrophages. FASEB J 15: 1110-1112.
Iwata K, Tomita K, Sano H, Fujii Y, Yamasaki A, and Shimizu E (2002) Trichostatin A, a histone deacetylase inhibitor, down-regulates interleukin-12 transcription in SV-40-transformed lung epithelial cells. Cell Immunol 218: 26-33.[CrossRef][Medline]
Kuo MH and Allis CD (1998) Roles of histone acetyltransferases and deacetylases in gene regulation. Bioessays 20: 615-626.[CrossRef][Medline]
Lazennec G, Bresson D, Lucas A, Chauveau C, and Vignon F (2001) ER beta inhibits proliferation and invasion of breast cancer cells. Endocrinology 142: 4120-4130.
Lazennec G, Kern L, Salbert G, Saligaut D, and Valotaire Y (1996) Cooperation between the human estrogen receptor (ER) and MCF-7 cell-specific transcription factors elicits high activity of an estrogen-inducible enhancer from the trout ER gene promoter. Mol Endocrinol 10: 1116-1126.
Leoni F, Zaliani A, Bertolini G, Porro G, Pagani P, Pozzi P, Donà G, Fossati G, Sozzani S, Azam T, et al. (2002) The antitumor histone deacetylase inhibitor suberoylanilide hydroxamic acid exhibits antiinflammatory properties via suppression of cytokines. Proc Natl Acad Sci U S A 99: 2995-3000.
Lin Y, Huang R, Chen L, Li S, Shi Q, Jordan C, and Huang RP (2004) Identification of interleukin-8 as estrogen receptor-regulated factor involved in breast cancer invasion and angiogenesis by protein arrays. Int J Cancer 109: 507-515.[CrossRef][Medline]
Lucas A, Kremer EJ, Hemmi S, Luis J, Vignon F, and Lazennec G (2003) Comparative transductions of breast cancer cells by three DNA viruses. Biochem Biophys Res Commun 309: 1011-1016.[CrossRef][Medline]
Margueron R, Licznar A, Lazennec G, Vignon F, and Cavaillès V (2003) Oestrogen receptor alpha increases p21(WAF1/CIP1) gene expression and the antiproliferative activity of histone deacetylase inhibitors in human breast cancer cells. J Endocrinol 179: 41-53.[Abstract]
Marks PA, Richon VM, and Rifkind RA (2000) Histone deacetylase inhibitors: inducers of differentiation or apoptosis of transformed cells. J Natl Cancer Inst 92: 1210-1216.
Mayo MW, Denlinger CE, Broad RM, Yeung F, Reilly ET, Shi Y, and Jones DR (2003) Ineffectiveness of histone deacetylase inhibitors to induce apoptosis involves the transcriptional activation of NF-B through the Akt pathway. J Biol Chem 278: 18980-18989.
Moser B, Wolf M, Walz A, and Loetscher P (2004) Chemokines: multiple levels of leukocyte migration control. Trends Immunol 25: 75-84.[CrossRef][Medline]
Mühlbauer M, Chilton PM, Mitchell TC, and Jobin C (2008) Impaired Bcl3 up-regulation leads to enhanced lipopolysaccharide-induced interleukin (IL)-23P19 gene expression in IL-10(-/-) mice. J Biol Chem 283: 14182-14189.
Oitzinger W, Hofer-Warbinek R, Schmid JA, Koshelnick Y, Binder BR, and de Martin R (2001) Adenovirus-mediated expression of a mutant IkappaB kinase 2 inhibits the response of endothelial cells to inflammatory stimuli. Blood 97: 1611-1617.
Rahman I, Gilmour PS, Jimenez LA, and MacNee W (2002) Oxidative stress and TNF-alpha induce histone acetylation and NF-kappaB/AP-1 activation in alveolar epithelial cells: potential mechanism in gene transcription in lung inflammation. Mol Cell Biochem 234-235: 239-248.[CrossRef]
Rasheed WK, Johnstone RW, and Prince HM (2007) Histone deacetylase inhibitors in cancer therapy. Expert Opin Investig Drugs 16: 659-678.[CrossRef][Medline]
Russo MP, Bennett BL, Manning AM, Brenner DA, and Jobin C (2002) Differential requirement for NF-kappaB-inducing kinase in the induction of NF-kappaB by IL-1beta, TNF-alpha, and Fas. Am J Physiol Cell Physiol 283: C347-C357.
Timmermann S, Lehrmann H, Polesskaya A, and Harel-Bellan A (2001) Histone acetylation and disease. Cell Mol Life Sci 58: 728-736.[CrossRef][Medline]
Tomita K, Barnes PJ, and Adcock IM (2003) The effect of oxidative stress on histone acetylation and IL-8 release. Biochem Biophys Res Commun 301: 572-577.[CrossRef][Medline]
Wade PA (2001) Transcriptional control at regulatory checkpoints by histone deacetylases: molecular connections between cancer and chromatin. Hum Mol Genet 10: 693-698.
Wen X and Wu GD (2001) Evidence for epigenetic mechanisms that silence both basal and immune-stimulated transcription of the IL-8 gene. J Immunol 166: 7290-7299.
Wu C (1997) Chromatin remodeling and the control of gene expression. J Biol Chem 272: 28171-28174.
Yamamoto Y, Verma UN, Prajapati S, Kwak YT, and Gaynor RB (2003) Histone H3 phosphorylation by IKK-alpha is critical for cytokine-induced gene expression. Nature 423: 655-659.[CrossRef][Medline]
Yang XJ and Seto E (2007) HATs and HDACs: from structure, function and regulation to novel strategies for therapy and prevention. Oncogene 26: 5310-5318.[CrossRef][Medline]
Yao C, Lin Y, Chua MS, Ye CS, Bi J, Li W, Zhu YF, and Wang SM (2007) Interleukin-8 modulates growth and invasiveness of estrogen receptor-negative breast cancer cells. Int J Cancer 121: 1949-1957.[CrossRef][Medline]
Zhong H, May MJ, Jimi E, and Ghosh S (2002) The phosphorylation status of nuclear NF-kappa B determines its association with CBP/p300 or HDAC-1. Mol Cell 9: 625-636.[CrossRef][Medline]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 |
 |
 |
|
 |
 |
 |
