Recombinant Human CXC-Chemokine Receptor-4 in Melanophores Are Linked to Gi Protein: Seven Transmembrane Coreceptors for Human Immunodeficiency Virus Entry into Cells

  1. Wen-Ji Chen1,
  2. Channa Jayawickreme2,
  3. Chris Watson2,
  4. Larry Wolfe2,
  5. William Holmes1,
  6. Robert Ferris3,
  7. Susan Armour1,
  8. Walter Dallas1,
  9. Grace Chen2,
  10. Larry Boone3,
  11. Michael Luther1 and
  12. Terry Kenakin2
  1. Departments of 1Molecular Sciences (W.-J.C., W.H., S.A.,W.D., M.L.),2Receptor Biochemistry (C.J., C.W., L.W., G.C., T.K.), and 3Virology (R.F., L.B.), Glaxo Wellcome Research and Development, 5 Moore Drive, Research Triangle Park, North Carolina 27709
     
    Next Section

    Abstract

    This article describes the transient expression of the CXC chemokine receptor-4 in Xenopuslaevis melanophores and the resulting functional assay for the endogenous ligand for this receptor stromal cell-derived factor (SDF)-1α. Specifically, it will be shown that SDF-1α produces increased light transmittance in transfected cells that is consistent with the activation of Gi protein. This stimulus pathway is further implicated by the abolition of this response after pretreatment of the cells with pertussis toxin, a known method for the inactivation of Giprotein. The fact that SDF-1α does not produce responses in nontransfected cells and that treatment of the cells with 12G5, an antibody specific for the CXC chemokine receptor-4, eliminates this response indicates that this ligand produces responses by activation of this receptor in these cells. The possible relevance to human immunodeficiency virus (HIV) entry into cells was explored by observing the effects of SDF-1α on HIV-mediated cell fusion. It was found that SDF-1α blocked cell-to-cell fusion (as has been previously reported) at concentrations 1200-fold greater than those required to produce Gi protein mediated responses. The implications of the functional assay to screening for new drugs to block HIV-mediated fusion is discussed.

    The discovery that HIV-1 utilizes seven transmembrane receptors as coreceptors for viral fusion has introduced a new target into the therapeutic field of view. Studies on HIV-1 envelope-mediated cell fusion have identified a 46-kDa, integral membrane protein named “fusin” that serves as a cofactor for HIV fusion and entry (Fenget al., 1996). Fusin is a 352-amino-acid, seven-transmembrane receptor, the sequence of which is identical to a previously cloned orphan receptor denoted LESTR (leukocyte-derived seven-transmembrane domain receptor). Sequence comparison has shown that fusin (or LESTR) is a member of the CXC chemokine receptor family with a sequence homology to the CXCR2 receptor (Loetscher et al., 1994; Raport et al., 1996; Wells et al., 1996). The identification of SDF-1α (a CXC chemokine) as a ligand for fusin has led to the suggested classification of this receptor as CXCR4 in the chemokine receptor nomenclature system (Bleulet al., 1996; Oberlin et al., 1996).

    This article describes the construction of a receptor assay in which the human CXCR4 couples to Gi-protein in recombinant Xenopus laevis melanophores. In these cells, melanosome dispersion can be affected via activation of adenylyl cyclase (Potenza et al., 1992; McClintock et al., 1993) or phospholipase C (Graminski et al., 1993), whereas melanosome aggregation results from the inhibition of adenylyl cyclase (Potenza et al., 1992; McClintock et al., 1993). Melanophore cells contain a wide range of Gα-proteins (Jayawickreme et al., 1994); therefore, the expression of numerous foreign G protein-coupled receptors can be facilitated (Potenza et al., 1992, 1994;Karne et al., 1993; McClintock et al., 1993;Graminski et al., 1993 and 1994; Jayawickreme et al., 1994a, 1994b; Lerner, 1994). Because both states of intracellular melanosome distribution (dispersion or aggregation) are easily detectable, various G protein-coupled receptors have been studied by monitoring ligand-mediated melanosome translocation, either by measuring the change in light transmittance through the cells or by imaging the cell response (Potenza et al., 1992, 1994; Karneet al., 1993; McClintock et al., 1993; Graminskiet al., 1993 and 1994; Jayawickreme et al., 1994a, 1994b; Lerner, 1994).

    We will show that SDF-1α mediates responses through CXCR4 and Gi protein; thus, the assay can be used to study ligand/receptor interaction. Although the implications of this functional linkage to viral fusion are presently unclear, the assay has utility as an indicator of receptor conformational states, and therefore as a CXCR4 screen.

    Previous SectionNext Section

    Experimental Procedures

    Materials.

    Leibovitz (L-15) medium was purchased from Sigma Chemical (St. Louis, MO), BSA was obtained from Boehringer Mannheim (Indianapolis, IN) and pertussis toxin was obtained from Calbiochem (La Jolla, CA). 12G5 antibody was generously provided by Jim Hoxie (University of Pennsylvania, Philadelphia, PA). The full-length cDNAs for CXCR4 and SDF-1β were kindly provided by Dr. Christine Power (Glaxo Wellcome, Geneva, Switzerland).

    Construction of expression vectors.

    The full-length cDNA for CXCR4 was cloned by a reverse transcriptase-PCR strategy. The sets of primers used for PCR were designed according to the GeneBank accession number M99293. The full-length cDNA of human SDF-1β was cloned by screening a human spleen cDNA library using the mouse SDF cDNA as a probe (R. B. Furness and C. Power, personal communication, 1997).

    CXCR4 was subcloned as a HindIII/XbaI fragment into the melanophore expression vector, pJG3.6 (Graminski et al., 1993). CXCR4 plasmid DNA used for melanophore transfections was prepared by a modification of the triton-lysozyme method and double-banded in CsCl/ethidium bromide equilibrium gradients as described (Davis et al., 1994).

    Oligonucleotide primers were designed for PCR amplification of the SDF-1α cDNA corresponding to the mature form of the protein (no signal sequence). One primer included the 5′-untranslated region of the bacteriophage T7 gene10A before the region coding for the amino terminus of SDF-1α. The sequences of primers are listed below: 5′-α: TCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGAAGCCCGTCAGCCTGAGCTACAG; 3′-α: ACGCGTCACTTGTTTAAAGCTTTCTCCAGGTACTC. The SDF-1α PCR fragment was inserted into the plasmid pCRII (InVitrogen, San Diego, CA) forming pCRII/SDF1α. An XbaI-SacI fragment was excised and inserted between the XbaI–SacI sites in pTX007, forming pTXSDFA9 (Dallas et al., 1992).

    Expression and purification of SDF-1α.

    Strain BL21[DE3] expressing SDF-1α was grown until absorbance was 0.6 at 37°, and induced by 0.25 mm isopropyl β-d-thiogalactoside for 3 hr. SDF-1α was purified to homogeneity using a three-column step procedure. The cell pellets were resuspended in a lysis buffer (50 mm HEPES, pH 7.4, 1 mm EDTA, 1 μg/ml aprotinin, 1 μg/ml leupeptin and 10 μm 4-amidinophenylmethanesulfonyl fluoride) and disrupted by a French pressure cell (SLM Instruments, Rochester, NY). After a low-speed centrifugation, the pellet was washed with lysis buffer and solubilized in a 8 m urea buffer (8 m urea, 20 mm dithiothreitol, and 1 mm EDTA) overnight. The solubilized material was loaded onto SP Sepharose columns and eluted with the same buffer containing 1 m NaCl. The SDF-containing fractions were identified by SDS-polyacrylamide gel electrophoresis and pooled. After renaturation in a buffer containing 0.1 m Tris·HCl, pH 8.0 and 0.1 mmglutathione, the proteins were loaded onto two tandem HiTrap SP Sepharose columns (Pharmacia Biotech, Piscataway, NJ) and eluted by a NaCl gradient in 25 mm Tris·HCl, pH 8.0. The fractions containing SDF-1α were loaded onto a reversed-phase poros column and eluted with an acetonitrile gradient in 0.1% trifluoroacetic acid. The purified SDF-1α was speed-vacuum-dried to complete dryness, and then resuspended in phosphate-buffered saline (0.2 g/liter KCl, 0.2 g/liter KH2PO4, 8 g/liter NaCl, 2.16 g/liter Na2HPO4·7H2O) and stored at −80° until use.

    Functional bioassay.

    Melanophores were maintained in cell cultures as described previously (Jayawickreme et al., 1994a, 1994b). Transient expression of CXCR4 plasmid DNA in melanophores was achieved after electroporation (Graminski et al., 1993; Jayawickreme et al., 1994). After electroporation, cells were seeded into flat-bottomed, 96-well, tissue culture plates (Falcon Plastics, Oxnard, CA) to a density of 40,000 cells/well in conditioned fibroblast medium and incubated at 27° for 24–48 hr.

    The ligand mediated responses in recombinant melanophores were monitored by measuring the change in transmittance using an SLT Spectra plate reader (Austria). For each experiment, media was removed from the plates and replaced with 0.7× L-15/0.1% BSA containing test drugs. Soon after the addition of reagents, the zero time reading (Ti) was obtained. The plates were then placed in the dark and read at appropriate time intervals (Tf). The extent of the response was quantified as (1 − Tf/Ti) (Jayawickreme et al., 1994a; Potenza et al., 1994).

    In the studies employing pertussis toxin, the transfected cells were incubated overnight (16–18 hr) in conditioned fibroblast medium with 1 μg/ml of pertussis toxin. Just before the assay, the media was removed and replaced with 0.7× L-15/0.1% BSA containing various reagents and/or drugs. In studies employing 12G5 antibody, the cells were incubated with antibody at a concentration of 16.9 μg/ml in 0.7× L-15/0.1% BSA media for 30 min before assaying.

    Viral fusion assay.

    An HIV-mediated fusion assay was developed based on the coculture of human embryonic kidney 293 cells stably transfected with pHIVΔRTBstEII (Kellam and Larder, 1994), designated 293ΔRT, and 1G5, a Jurkat T cell line containing a long terminal repeat-luciferase gene (Aguilar-Cordova et al., 1994). The 293ΔRT cells express HIV-1 gene products (except reverse transcriptase) and readily induce syncytia formation when co-cultured with CD4+/CXCR4+ cells (R. Ferris, and L. Boone, unpublished observations, 1997). The 1G5 cell line is susceptible to T cell line tropic HIV and, after infection, expresses luciferase from the transfected HIV long terminal repeat-luciferase reporter gene. Coculture of 293ΔRT cells with 1G5 cells results in fusion and tat-mediated activation of luciferase.

    The ability of SDF-1α to block HIV-mediated cell-to-cell fusion was determined by measuring its effect on the activation of luciferase. 293ΔRT cells were plated at 5 × 104cells/well (96-well cell culture plate) in RPMI 1640, 10% fetal bovine serum and allowed to grow overnight. 1G5 cells were added to a final concentration of 1 × 105cells/well in the same medium containing indicated concentrations of SDF-1α and coculture was continued for 5 hours. Media was removed and cells were lysed with 200 μl of lysis buffer (Luciferase Assay System; Promega, Madison, Wisconsin) for 20 min at room temperature followed by one freeze/thaw cycle. Luciferase activity was measured by incubating 20 μl of lysate with 50 μl of luciferase reagent (Promega) and reading them immediately in a luminometer (ML1000; Dynatech Laboratories, Chantilly, VA). Duplicate samples were averaged.

    Previous SectionNext Section

    Results and Discussion

    SDF-1α is a CXC chemokine produced by bone marrow stromal cells characterized by a typical four-cysteine motif (Baggiolini et al., 1994). There are two spliced forms of SDF-1, SDF-1α and SDF-1β. The amino acid sequences of SDF-1α and -β are identical for the first 89 amino acids, but SDF-1β has four additional amino acids at the carboxyl terminus. This chemokine is known to have multiple biological activities [e.g., proliferation of B cell progenitors (Tashiro et al., 1993; Nagasawa et al., 1994) and production of lymphocyte migration (Bleul et al., 1996)]. To test the functional activities of SDF-1α, the cDNA for this protein was first cloned and expressed.

    A T7 polymerase-based Escherichia coli expression system was used to express recombinant SDF-1α. pCRII is a plasmid designed for cloning PCR fragments with an unpaired A residue at each 3′-end. Because this plasmid also has a T7 promoter near the site of fragment insertion, we anticipated that by adding a ribosome binding region to the SDF-1α cDNA before cloning, the T7 promoter could be used to enhance expression. Results of the induction experiments with pCRII/SDF-1α in BL21[DE3] showed that initially (1 hr after induction), SDF-1α was one of the major proteins, but after 3 hr, it was almost totally degraded. We transferred the SDF-1α fragment from pCRII/SDF1α to pTX007, a plasmid we had used successfully for high level expression of a variety of proteins. When induced, BL21[DE3](pTXSDFA9) made SDF-1α to the extent that it was the major protein 1 hr after induction. The protein continued to accumulate and, over time, formed inclusion bodies. A three-step purification procedure was developed including the separation of renatured SDF-1α from denatured proteins. The purified proteins were analyzed on an SDS gel as shown in Fig. 1A. Amino-terminal sequence determination showed that the initiator methionine residue was not removed; therefore, recombinant SDF-1α differs from the native form. The deduced amino acid sequences of SDF-1α are shown in Fig.1B.

    Figure 1
    View larger version:
    Figure 1

    A, SDS-polyacrylamide gel electrophoresis analysis of purified SDF-1α. SDF-1α was purified as described in Experimental Procedures. One microgram (lane 1) or 2 μg (lane 2) of purified protein was loaded onto a 4–20% SDS gel and stained with Coomassie Brilliant Blue. The protein molecular mass standards used were myosin, 200 kDa; β-galactosidase, 116 kDa; phosphorylase B, 97 K; serum albumin, 66 K; ovalbumin, 45 kDa; carbonic anhydrase, 31 kDa; trypsin inhibitor, 22 kDa; lysozyme, 14 kDa; aprotinin, 6 kDa; and insulin β chain, 4 kDa. B, Deduced amino acids of purified recombinant protein.

    SDF-1α has recently been shown to be a ligand for CXCR4 and to produce calcium responses in Chinese hamster ovary cells stably transfected with CXCR4 (Bleul et al., 1996; Oberlin et al., 1996). Accordingly, a functional assay for CXCR4 was established. SDF-1α produced a concentration-dependent aggregation response in melanophores transfected with CXCR4 cDNA. Fig.2 shows the response to SDF-1α measured at timepoints 30 to 210 min. It can be seen that a steady state with SDF-1α was obtained after 90 min; the concentration producing ED50 was found to be 40 pm in the experiment shown. The mean ED50 from nine experiments is 53 ± 11 pm. One feature of Gi protein-coupled receptor effects in melanophores is the time-dependence of the response. Specifically, once Gi protein has been activated, the cell must reach a new steady state with respect to the altered cytosolic level of cyclic AMP; the time for this effect can vary. This property of melanophores makes temporal study of Gi-mediated responses important for the determination of the potency of agonists. The changing responses with time probably do not reflect the temporal interaction of SDF-1α and CXCR4, because the ED50 does not change after 30 min. Rather, the increased asymptotic response reflects the clearance of endogenous cyclic AMP in the presence of a new setpoint of Gi activation (Potenza et al., 1994). Although CXCR4 is similar to IL-8 receptors (CXCR1, CXCR2), IL-8 did not produce activation of CXCR-4 in melanophores (Fig. 2). No response to SDF-1α was observed in melanophores not transfected with CXCR4 or CXCR1 (data not shown). The involvement of Gi-protein in the response to SDF-1α was suggested by the fact that the ligand-mediated response is abolished in transfected cells treated with pertussis toxin (Fig.3), a treatment that inactivates Gi protein.

    Figure 2
    View larger version:
    Figure 2

    SDF-1α mediated receptor activity of CXCR-4 transiently transfected into melanophores. Effect of increasing concentrations of SDF-1α (abscissae as log scale) on melanophore responses (ordinates as 1 − (Tf/Ti) where Ti and Tf refer to transmittance through the well before and after addition of SDF-1α, respectively). A, Dose-response curves to SDF-1α obtained at various times of incubation: ○, 30 min; ▵, 60 min; ▾, 90 min; ⋄, 120 min; and ▪, 210 min. The lack of response to IL-8 in transfected cells also is shown (×).

    Figure 3
    View larger version:
    Figure 3

    Effect of pretreatment of melanophores with pertussis toxin on SDF-1α mediated CXCR-4 receptor activity. Ordinates and abscissae as for Fig. 2. Responses shown in the cells pretreated (▴) and not pretreated (•) with pertussis toxin.

    To further examine the interaction of SDF-1α with the CXCR4, experiments were done on melanophores pretreated with 12G5, a monoclonal antibody specific for CXCR4 (Endres et al., 1996). As shown in Fig. 4, pretreatment of transfected melanophores with 12G5 produced an inhibition of the SDF-1α response. The dose-response curve to SDF-1α was shifted to the right by a factor of 100 after treatment with 12G5 antibody.

    Figure 4
    View larger version:
    Figure 4

    Effect of 12G5 antibody on responses to SDF-1α. Control responses (•) and after 30-min incubation with 0.7× L-15/0.1% BSA containing 12G5 antibody (▴, 16.9 μg/ml).

    SDF-1α has been shown to block T cell trophic HIV-1 cell-to-cell fusion and infection (Oberlin et al., 1996). We wanted to determine the relative potency of SDF-1α as an agonist and its potency as an inhibitor of HIV-1 mediated cell-to-cell fusion, and verify that the amino-terminal methionine did not compromise the anti-HIV activity. Fusion was measured in a coculture system that utilizes a luciferase reporter system (Aguilar-Cordova et al., 1994). Preliminary experiments (not shown) indicated that luciferase activity increased continuously over the first 8–10 hr of coculture and could be completely blocked with soluble CD4 if present within the first 2 hr of coculture. We tested SDF-1α for the ability to block fusion in this assay; the data are shown in Fig.5A. The induction of luciferase activity was blocked by SDF-1α in a concentration-dependent manner. An IC50 value of 23 ± 4 nm(n = 16) was calculated for SDF-α. Control experiments (not shown) indicated that SDF-1α had no direct inhibitory effect on luciferase gene expression or enzyme activity in cells that did not contain CXCR4.

    Figure 5
    View larger version:
    Figure 5

    Effect of SDF-1α (A) and 12G5 antibody (B) on viral fusion. Ordinate axes, percent of control cell fusion; abscissae, logarithms of molar concentrations of SDF-1α (A) and 12-G5 antibody (B) and 52R2 antibody as control (μg/ml).

    The monoclonal antibody for CXCR4, 12G5, shown to be an antagonist in the melanophore system, is also known to block HIV-1 mediated cell-to-cell fusion (McKnight et al., 1997). This result was confirmed in these studies (Fig. 5B), in which the IC50 was found to be 3.5 μg/ml (±1.1 μg/ml,n = 2) when the antibody was preincubated with cells for 1 hr before coculture. An isotype control antibody did not inhibit fusion over a range of concentrations up to 10 μg/ml.

    The involvement of seven transmembrane receptors, such as CXCR4 in HIV viral fusion, has broad implications for the treatment of this disease. The discovery that seven transmembrane receptors are required for HIV-1 entry into cells offers a pharmacologically and chemically tractable target. Thus, if interaction of CXCR4 with either CD4 and/or the viral envelope (through gp120) can be disrupted, then the sequential process initiated by the tripartite protein interaction may stop fusion of cells (and subsequent viral entry). This is indicated by the blockade of viral fusion by SDF-1α. It is presently unclear whether activation of CXCR4 is required for the process of viral fusion, but the data showing that viral fusion is blocked by the 12G5 antibody, a ligand that does not produce responses in the melanophore system, indicates that this is not a requirement. This behavior is similar to the studies on chemokine receptor 5 as a coreceptor for HIV-mediated fusion where indirect evidence for the lack of receptor activation (with respect to G-protein) was obtained with CCR5/CCR2b receptor chimeras and mutants (Edinger et al., 1997; Farzan et al., 1997). In these studies, mutant receptors that were unable to mediate physiological responses facilitated viral fusion nevertheless.

    Although receptor activation does not seem to be required for inhibition of viral fusion, the relationship between ligand occupancy and receptor activation is unclear. Specifically, if ligand occupation of CXCR4 is required to block viral fusion, then the concentration of CXCR4 agonist ligand useful for protection against HIV-1 infection may be considerably greater than the ED50 for Gi protein activation. This is attributable to the well-known disparity between physiological responses and receptor occupancy brought on by agonist intrinsic efficacy and amplification of signals through stimulus-response mechanisms (i.e., effective receptor reserve). This is suggested by the 434-fold increase in concentration of SDF-1α (over the ED50 for melanophore response) required to inhibit viral fusion. The fact that the dose-response curve to SDF-1α was shifted 100-fold to the right by 12G5 antibody indicates a considerable effective receptor reserve in this preparation for this ligand.

    Under these circumstances, achieving a saturating receptor occupancy by SDF-1α may require considerably higher concentrations of SDF-1α than the pharmacologic ED50. A further unknown in the comparison of the two systems is the unknown receptor densities on the two cell lines. This latter factor may further distance the concentrations required to activate Gi proteins and prevent cell fusion. Further studies are required to elucidate the relationship between G protein activation by CXCR-4 and the role of this receptor as an HIV coreceptor for viral entry.

    The ability to monitor CXCR4 function still has broad implications for the screening of receptor active ligands and therapeutic approaches in this area. Presently, the extent to which the screening of CXCR4 function in a seven-transmembrane receptor system will assist in finding drugs to inhibit viral fusion is unknown. The theoretical basis of this approach is that the melanophore/Gi-protein matrix will function as a detection system for CXCR4 conformational states and that these will translate into differences in the interaction of the CXCR4 receptor and proteins of the HIV viral coat.

    Previous SectionNext Section

    Acknowledgments

    We wish to acknowledge Jay Levy and Carl Mackewicz for introducing us to the 1G5 reporter system and Randall Lanier and Richard Hazen for their help in establishing the system in-house. We also wish to thank Martin Rink and Jeff Robbins (GlaxoWellcome Research and Development) for scale up of SDF-1α. In addition, we appreciate the efforts of Tom Rimele for advice and support, Ken Queen for preparing the plasmids, Howard Sauls for data analysis, and Jill Haizlip for cell culture. We thank Brendan Larder (Glaxo-Wellcome) for providing the pHIVΔRTBstEII clone. We also wish to thank James Hoxie of University of Pennsylvania for the gift of 12G5 antibody. Finally, we wish to thank Mrs. Donna McGhee for her expert assistance in the preparation of this manuscript.

    Previous SectionNext Section

    Footnotes

    • Send reprint requests to: Terry Kenakin, Ph.D., Department of Receptor Biochemistry, Glaxo Wellcome Research and Development, 5 Moore Drive, Research Triangle Park, NC 27709.

    • Abbreviations:
      HIV-1
      human immunodeficiency virus type 1
      CXCRx
      CXC chemokine receptor, where xis the receptor number
      SDF
      stromal cell-derived factor
      BSA
      bovine serum albumin
      PCR
      polymerase chain reaction
      HEPES
      4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid
      SDS
      sodium dodecyl sulfate
      ED50
      dose effective on 50% of the population
      • Received August 29, 1997.
      • Accepted October 29, 1997.
    Previous Section
     

    References

    1. ↵
      1. Aguilar-Cordova,
      2. Chinen EJ,
      3. Donehower L,
      4. Lewis DE,
      5. Belmont JW
      (1994) A sensitive reporter cell line for HIV-1 tat activity, HIV-1 inhibitors, and T cell activation effects. AIDS Res Hum Retrovir 10:295–301.
      MedlineWeb of Science
    2. ↵
      1. Baggiolini M,
      2. Dewald B,
      3. Moser B
      (1994) Interleukin-8 and related chemotactic cytokines—CXC and CC chemokines. Adv Immunol 55:97–179.
      MedlineWeb of Science
    3. ↵
      1. Bleul CC,
      2. Farzan M,
      3. Choe H,
      4. Parolin C,
      5. Clark-Lewis I,
      6. Sodroski J,
      7. Springer AT
      (1996) The lymphocyte chemoattractant SDF-1 is a ligand for LESTR/fusin and blocks HIV-1 entry. Nature (Lond) 382:829–832.
      CrossRefMedline
    4. ↵
      1. Dallas WS,
      2. Gowen JE,
      3. Ray PH,
      4. Cox MJ,
      5. Dev IK
      (1992) Cloning, sequencing, and enhanced expression of the dihydropteroate synthase gene of Escherichia coli. J Bacteriol 174:5961–5970.
      Abstract/FREE Full Text
    5. ↵
      1. Davis LG,
      2. Kuehl MW,
      3. Battey JF
      (1994) Basic Methods in Molecular Biology (Appleton & Lange, Norwalk, CT), 2nd ed. pp 84–89.
    6. ↵
      1. Edinger AI,
      2. Amedee A,
      3. Miller K,
      4. Doranz BJ,
      5. Endres M,
      6. Sharron M,
      7. Samson M,
      8. Lu Z-H,
      9. Clements JE,
      10. Murphy-Corb M,
      11. Peiper SC,
      12. Parmentier M,
      13. Broder CC,
      14. Doms RW
      (1997) Differential utilization of CCR5 by macrophage and T cell tropic simian immunodeficiency virus strains. Proc Natl Acad Sci USA 94:4005–4010.
      Abstract/FREE Full Text
    7. ↵
      1. Endres MJ,
      2. Clapham PR,
      3. Marsh M,
      4. Ahuja M,
      5. Turner JD,
      6. McKnight A,
      7. Thomas JF,
      8. Stobenau-Haggarty B,
      9. Choe S,
      10. Vance PJ,
      11. Wells TNC,
      12. Power CA,
      13. Sutterwala SS,
      14. Doms RW,
      15. Landau NR,
      16. Hoxie JA
      (1996) CD4-independent infection of HIV-2 is mediated by Fusin/CXCR4. Cell 87:745–756.
      CrossRefMedlineWeb of Science
    8. ↵
      1. Farzan M,
      2. Choe H,
      3. Martin KA,
      4. Sun Y,
      5. Sidelko M,
      6. MacKay CR,
      7. Gerard NP,
      8. Sodroski J,
      9. Gerard C
      (1997) HIV-1 entry and macrophage inflammatory protein-1β-mediated signaling are independent functions of chemokine receptor CCR5. J Biol Chem 272:6854–6857.
      Abstract/FREE Full Text
    9. ↵
      1. Feng Y,
      2. Broder CC,
      3. Kennedy PE,
      4. Berger EA
      (1996) HIV-1 entry cofactor: functional cDNA cloning of a seven-transmembrane, G-protein-coupled receptor. Science (Washington DC) 272:872–877.
      Abstract
    10. ↵
      1. Graminski GF,
      2. Jayawickreme CK,
      3. Potenza MN,
      4. Lerner MR
      (1993) Pigment dispersion in frog melanophores can be induced by a phorbol ester or stimulation of a recombinant receptor that activates phospholipase C. J Biol Chem 268:5957–5964.
      Abstract/FREE Full Text
    11. ↵
      1. Graminski GF,
      2. Lerner MR
      (1994) A rapid bioassay for platelet-derived growth factor beta-receptor tyrosine kinase function. Bio/technology 12:1008–1011.
      CrossRefMedline
    12. ↵
      1. Jayawickreme CK,
      2. Graminski GF,
      3. Quillan JM,
      4. Lerner MR
      (1994a) Creation and functional screening of a multi-use peptide library. Proc Natl Acad Sci USA 91:1614–1618.
      Abstract/FREE Full Text
    13. ↵
      1. Jayawickreme CK,
      2. Graminski GF,
      3. Quillan JM,
      4. Lerner MR
      (1994b) Discovery and structure-function analysis of α-melanocyte-stimulating hormone antagonists. J Biol Chem 269:29846–29854.
      Abstract/FREE Full Text
    14. ↵
      1. Karne S,
      2. Jayawickreme CK,
      3. Lerner MR
      (1993) Cloning and characterization of an endothelin-3 specific receptor (ETC receptor) from Xenopus laevis dermal melanophores. J Biol Chem 26:19126–19133.
    15. ↵
      1. Kellam P,
      2. Larder B
      (1994) Recombinant virus assay: a rapid, phenotypic assay for assessment of drug susceptibility of human immunodeficiency virus type 1 isolates. Antimicrob Agents Chemother 38:23–30.
      Abstract/FREE Full Text
    16. ↵
      1. Lerner MR
      (1994) Tools for investigating functional interactions between ligands and G-protein-coupled receptors. Trends Neurosci 17:142–146.
      CrossRefMedlineWeb of Science
    17. ↵
      1. Loetscher M,
      2. Geiser T,
      3. O’Reilly T,
      4. Zwaheln R,
      5. Baggiolini M,
      6. Moser B
      (1994) Cloning of a human seven-transmembrane domain receptor, LESTR, that is highly expressed in leukocytes. J Biol Chem 269:232–237.
      Abstract/FREE Full Text
    18. ↵
      1. McClintock TS,
      2. Graminski GF,
      3. Potenza MN,
      4. Jayawickreme CK,
      5. Roby-Shemkovitz A,
      6. Lerner MR
      (1993) Functional expression of recombinant G-protein-coupled receptors monitored by video imaging of pigment movement in melanophores. Anal Biochem 209:298–305.
      CrossRefMedline
    19. ↵
      1. McKnight A,
      2. Wilkinson D,
      3. Simmons G,
      4. Talbot S,
      5. Picard L,
      6. Ahuja M,
      7. Marsh M,
      8. Hoxie JA,
      9. Clapham PR
      (1997) Inhibition of human immunodeficiency virus fusion by a monoclonal antibody to a coreceptor (CXCR-4) is both cell type and virus strain dependent. J Virol 71:1692–1696.
      Abstract
    20. ↵
      1. Nagasawa T,
      2. Kikutani H,
      3. Kishimoto T
      (1994) Molecular cloning and structure of a pre-B-cell growth-stimulating factor. Proc Natl Acad Sci USA 91:2305–2309.
      Abstract/FREE Full Text
    21. ↵
      1. Oberlin E,
      2. Amara A,
      3. Bachelerie F,
      4. Bessia C,
      5. Virelizier J-L,
      6. Arenzana-Seisdedos F,
      7. Schwartz O,
      8. Heard J-M,
      9. Clark-Lewis I,
      10. Legler DF,
      11. Loetscher M,
      12. Baggiolini M,
      13. Moser B
      (1996) The CXC chemokine SDF-1 is the ligand for LASTR/fusin and prevents infection by T-cell-line adapted HIV-1. Nature (Lond) 382:764–767.
    22. ↵
      1. Potenza MN,
      2. Graminski GF,
      3. Lerner MR
      (1992) A method for evaluating the effects of ligands upon Gs protein-coupled receptors using a recombinant melanophore-based bioassay. Anal Biochem 206:315–322.
      CrossRefMedlineWeb of Science
    23. ↵
      1. Potenza MN,
      2. Graminski GF,
      3. Schmauss C,
      4. Lerner MR
      (1994) Functional expression and characterization of human D2 and D3 dopamine receptors. J Neurosci 14:1463–1476.
      Abstract
    24. ↵
      1. Raport CJ,
      2. Schweickart VL,
      3. Chantry D,
      4. Eddy RL, Jr.,
      5. Shows TB,
      6. Godiska R,
      7. Gray PW
      (1996) New members of the chemokine receptor gene family. J Leukocyte Biol 59:18–23.
      Abstract
    25. ↵
      1. Tashiro K,
      2. Tada H,
      3. Heilker R,
      4. Shirozu M,
      5. Nakano T,
      6. Honjo T
      (1993) Signal sequence trap: a cloning strategy for secreted proteins and Type I membrane proteins. Science (Washington DC) 261:600–603.
      Abstract/FREE Full Text
    26. ↵
      1. Wells TNC,
      2. Power CA,
      3. Lusti-Narasimhan M,
      4. Hoogewerf AJ,
      5. Cooke RM,
      6. Chung C-W,
      7. Peitsch MC,
      8. Proudfoot AEI
      (1996) Selectivity and antagonism of chemokine receptors. J Leukocyte Biol 59:53–60.
      Abstract
    « Previous | Next Article »Table of Contents

    This Article

    1. Molecular Pharmacology February 1, 1998 vol. 53 no. 2 177-181
    1. AbstractFree
    2. » Full Text
    3. Full Text (PDF)

    Classifications

    Responses

    1. Submit a response
    2. No responses published

    Navigate This Article

    Current Issue

    1. November 2009, 76 (5)
    1. Current Issue
    1. Alert me to new issues of Molecular Pharmacology