Primer | Orientation | Oligonucleotide Sequence (5′-3′) | nt Assignment |
---|---|---|---|
P1 | Sense | T7-AGGCTCTGACAGCCCAGAGTT | 3618–3638 |
P21-a | Antisense | CGAATTGGAGCTCCACCGC | 11–29 |
P3 | Sense | T7-GTGTCTGCAGCACTTGGATC | 2998–3017 |
P4 | Antisense | ACTCAGTGCCAGAAGCTGGA | 3638–3657 |
P5 | Sense | T7-ACAGCCCAGAGTTCCAGCT | 3626–3644 |
P6 | Antisense | GGAGAGAGATTTAGTAGTCCAC | 3762–3783 |
P7 | Sense | T7-GTGGACTACTAAATCTCTCT | 3762–3781 |
P8 | Antisense | CTGTACATAGTGCAGCTAA | 3961–3979 |
P9 | Sense | T7-ATACTTAGCTGCACTATGTACAG | 3957–3979 |
P10 | Sense | T7-TTGGAGCTGAGAGCAGAG | 3874–3891 |
P11 | Antisense | CTGTACATAGTGCAGCTAAG | 3960–3979 |
P12 | Antisense | ATTGGGAGTAGACAAAAGTATCT | 4007–4029 |
P13 | Sense | T7-GATGGCTTGGGCCTTTCCT | 4030–4048 |
P14 | Sense | T7-AATATTTATATAAAATACA | 4068–4086 |
The different sets of primers used to amplify various fragments from iNOS coding sequence and 3′UTR are shown, as seen in Figure 2. T7 represents the T7 RNA polymerase promoter sequence 5′-TAATACGACTCACTATAGGGAGA-3′. The nucleotide assignments correspond to the iNOS sequence in GenBank reference number M92649 (Lowenstein et al, 1992).
P, Primer; nt, nucleotide.
↵1-a P2 is within the pBluescript multiple cloning site flanking the cloned iNOS cDNA (in the NotI site). All fragments produced with P2 were digested withNotI to remove the additional 29 nt.