Primers used in quantitative RT-PCR
Probes specific for human AC5 and AC6 were synthesized by RT-PCR using human heart mRNA and oligonucleotides specific for each isoform. The sequence of the human AC5 amplified product has 93% identity with the rat AC5 cDNA sequence, 61.6% identity with the rat AC6 cDNA sequence, and 62.7% with the human AC6 cDNA sequence. The sequence of the human AC6 amplified product has 90.3% identity with the rat AC6 cDNA sequence and 72.7% identity with the rat AC5 cDNA sequence. In all cases the annealing temperature was 60°C and the number of PCR cycles was 40.
| Sequence | GenBank Accession Number | Primer | Oligonucleotide Sequence | Position | Expected Size Product |
|---|---|---|---|---|---|
| bp | |||||
| AC5 | M96159 | Forward | 5′ - CCCTGGTGTTCCTCTCGGCTTTTG- 3′ | 2971—2994 | 305 |
| Reverse | 5′ - CACGTAGATGAGCTCGATGGCCAGC - 3′ | 3275—3251 | |||
| AC6 | AF250226 | Forward | 5′ - GTGACCCTGGCCAACCACATGG - 3′ | 2189—2209 | 453 |
| Reverse | 5′ - CAGAAACCGGCGCACATGGTC - 3′ | 2641—2621 | |||
| cPLA2 | IM72393 | Forward | 5′ - GATGTGATAAAAGAAGCCATGGTTGAAAGC - 3′ | 2241—2270 | 195 |
| Reverse | 5′ - GTTGTCATGGGATTGCAAACTGCCTC - 3′ | 2436—2411 | |||
| GAPDH | AF261085 | Forward | 5′ - GGATTTGGTCGTATTGGGCGC - 3′ | 131—150 | 165 |
| Reverse | 5′ - GTTCTCAGCCTTGACGGTGC - 3′ | 295—276 |