TABLE 1

Oligonucleotides used for the production of promoter fragments, plasmid construction, mobility shift assays, site-directed mutagenesis, RT-PCR, and quantitative PCR

Regarding the oligonucleotides used for the mobility shift assays and site-directed mutagenesis, the HNF1 recognition motif in the hOAT3 promoter region is underlined. Bold type indicates the difference in the sequence of the per and mut compared with wt sequence found in the hOAT3 promoter.


Oligonucleotide

Orientation

Sequence (5′ to 3′)
Primers and oligonucleotides used for cloning of 5′-flanking regions
hOAT3
−1471 Forward CGGGGTACCGGAACAGAGAGGTAAAGGC
−644 Forward CGGGGTACCGAGAGAAGCCTGTCCATTG
−308 Forward CGGGGTACCGATTCCTTCCCAGAATCTCC
+6 Reverse CCCAAGCTTCAAGCTGTGTTTGTGCCTCC
−35/+6 Sense CCCTTATATAAGCCCCCCTGGGGGAGGCACAAACACAGCTTGA
+6/−35 Antisense AGCTTCAAGCTGTGTTTGTGCCTCCCCCAGGGGGGCTTATATAAGGGGTAC
mOat3
−156 Forward CGGGGTACCATCAACAGCCTTGGCTGAGG
+6 Reverse CCCAAGCTTCAAGCTGTTTGTGTCTCC
Primers used for cloning of HNF1α and HNF1β
HNF1α Forward AAGCTTGCCATGGTTTCTAAACTGAGCC
Reverse GAATTCTGGTTACTGGGAGGAAGAGGCC
HNF1β Forward AAGCTTGAAAATGGTGTCCAAGCTCACG
Reverse GAATTCGGCATCACCAGGCTTGTAGAGG
Oligonucleotides used for construction of EMSA probe and competitor or site-directed mutagenesis
wt Sense CGCAAAAGAAAGTCAAACATTAGCCCGGGAAACAGC
per Sense CGCAAAAGAAAGTTAATCATTAACCCGGGAAACAGC
mut Sense CGCAAAAGAAAGTCACACATCGCCCCGGGAAACAGC
Primers used for RT-PCR or quantitative PCR
hOAT3 Forward GGCAGGTATACTGATTGGAG
Reverse TCCACCAGGATGATAGGAAG
HNF1α Forward TGGGTCCTACGTTCACCAAC
Reverse TCTGCACAGGTGGCATGAGC
HNF1β Forward TGCACAAAGCCTCAACACCT
Reverse GTTGGTGAGTGTACTGATGC
GAPDH Forward AATGACCCCTTCATTGAC

Reverse
TCCACGACGTACTCAGCGC