TABLE 1

Sequences of primers for quantitative RT-PCR


Gene

Forward Primer

Reverse Primer
FGF2 CGGCTGTACTGCAAAAACGG GATGTGAGGGTCGCTCTTCTCC
FGF7 GATCCTGCCAACTTTGCTCTACAG TGCTCTGGAGTCATGTCATTGC
FGF9 GAAAGACCACAGCCGATTTG TTCATCCCGAGGTAGAGTCC
FGFR1 TAATGGACTCTGTGGTGCCCTC ATGTGTGGTTGATGCTGCCG
FGFR2 CGCTGGTGAGGATAACAACACG TGGAAGTTCATACTCGGAGACCC
FLK1 TCTCTCTGCCTACCTCACCTGTTTC CTGACTGATTCCTGCTGTGTTGTC
FLT1 TTCCTCTGAAATGGATGGCTCC AGCAATACTCCGTAAGACCACACG
GAPDH
GCCAAATATGATGACATCAAGAAGG
GGTGTCGCTGTTGAAGTCAGAG