TABLE 1

Primer sequences and conditions used for RT-PCR

TranscriptForward (5′-3′)Reverse (5′-3′)Annealing Temperature (°C)
rAC1CCTTTTGGTCACCTTCGTGTGGTTTTCCGTGGCTAACTCA55
rAC2TTCAACGACTTCAAACTGCACCTCTTCATCACTTCTTCC55
rAC3CTTCATAACGCTGCCACTCATCTGCAAACAGGATGCTGAC55
rAC4TGTGGAGAGAGCAGACATGGGGAGAAGGAAGAGAAGGAAGG65
rAC5CGGAAAGAAGAGAAGGCCATGCCAAATCGGTCATCCACCTGC65
rAC6AGTCACACCCCACTGAGGACAGGGGTCATGTATTTGAGCG65
rAC7AAGGCAGCTGAGGACTGGTACCCCAGGTATGCTGTTCACT58
rAC8AGCCACACTGGATTGCCTCATTATAGTCTTCTGCCGTGGT55
rAC9TAATGAAGCAGGGGGATGAGCGATGGCTTTTATCATGCCT65
rAC10ACCACCTACATCACACTCTCAATCACCTCTCCTTCC55
rGAPDHGTTACCAGGGCTGCCTTCTCGGGTTTCCCGTTGATGACC55
  • GAPDH, glyceraldehyde-3-phosphate dehydrogenase.