TABLE 1

Primer sequences for real-time polymerase chain reaction

Target GeneForward Primer Sequence (5′ to 3′)Reverse Primer Sequence (5′ to 3′)
L19GCGGAAGGGTACAGCCAATGCAGCCGGCGCAAA
GAPDHTGATGACATCAAGAAGGTGGTGAAGTCCTTGGAGGCCATGTAGGCCAT
CCL2TCTGTGCCTGCTGCTCATAGAGATCTCCTTGGCCACAATG
CCL5CCATATTCCTCGGACACCACTGTACTCCCGAACCCATTTC
COX-2TGTGCAACACTTGAGTGGCTACTTTCTGTACTGCGGGTGG
IL-6CCTTCCAAAGATGGCTGAAAAGCTCTGGCTTGTTCCTCAC
IL-8GCCTTCCTGATTTCTGCAGCCGCAGTGTGGTCCACTCTCA
SOD2TTGGCCAAGGGAGATGTTACAGTCACGTTTGATGGCTTCC
  • GAPDH, glyceraldehyde 3-phosphate dehydrogenase; SOD, superoxide dismutase