Cloning and characterization of a novel human 5-HT4 receptor variant that lacks the alternatively spliced carboxy terminal exon. RT-PCR distribution in human brain and periphery of multiple 5-HT4 receptor variants
Introduction
The existence of 5-HT4 receptors was proposed in 1988 as a non-classical 5-HT (5-hydroxytryptamine) receptor positively coupled with adenylate cyclase and presenting a differential pharmacology (Dumuis et al., 1988, Dumuis et al., 1989). Since this initial proposal, the characteristics and distribution of this receptor have been studied extensively in brain and in peripheral tissues thanks to the development of several selective agonists and antagonists (Ford and Clarke, 1993, Eglen et al., 1995, Hegde and Eglen, 1996). Structural information on 5-HT4 receptors became available in 1995 with the cloning of two cDNAs from rat brain that encoded what appeared to be two splice variants of 5-HT4 receptors differing in the length and sequence of the carboxy-terminal (C-terminal) tail (Gerald et al., 1995). Since this initial report, several C-terminal variants of 5-HT4 receptors have been described by cDNA cloning in human and other species. Following the recommendations of the Serotonin Receptor Nomenclature Committee (Hoyer and Martin, 1997), the different putative C-terminal splice variants have been named alphabetically and chronologically. Thus, variants 4(a), 4(b), 4(c), 4(d) and 4(e) have been described in human (Claeysen et al., 1997, Claeysen et al., 1999; Van den Wyngaert et al., 1997; Mialet et al., 2000a; Blondel et al., 1997, Blondel et al., 1998a), variants 4(a), 4(b) and 4(e) in rat (Gerald et al., 1995, Claeysen et al., 1999), and variants 4(a), 4(b), 4(e) and 4(f) in mouse (Claeysen et al., 1996, Claeysen et al., 1998, Claeysen et al., 1999). Within each species, these variants are identical up to aminoacid Leu358 after which they diverge in sequence and length (Blondel et al., 1998a, Claeysen et al., 1999). More recently, the structure of the human 5-HT4 receptor gene has been reported (Bender et al., 2000). It spans more than 130 kb and contains at least 10 exons. Exons 2–5 encode most of the common part shared by all variants up to Leu358. Downstream of exon 5, several other exons have been identified and also termed alphabetically to match the previous nomenclature given to the variants obtained by cDNA cloning. Thus, for all the different C-terminal variants reported so far, the corresponding exonic sequences have been found in the gene (Bender et al., 2000). In addition, an internal splice variant has been detected that results in the insertion of 14 amino acids into the second extracellular loop of the receptor. The corresponding exon has been named exon h, and when combined with the C-terminal exon b results in a variant termed h5-HT4(hb) (Bender et al., 2000). In the light of the known gene structure, the previously reported h5-HT4(e) variant, which was thus named because it was similar (although not identical) to the rat 5-HT4(e) receptor (Claeysen et al., 1999, Mialet et al., 2000a) has been re-named h5-HT4(g) (Bender et al., 2000). This new name seems more appropriate in view of the existence, at least in human, of the so-called exon ‘gef’, which can account for three different variants: the re-named human variant 4(g) and the putative human variants 4(e) and 4(f), which would be the true human counterparts of rat and mouse variants 4(e) and 4(f) (Claeysen et al., 1999).
The aims of the present work were to characterize further the variability in the human 5-HT4 receptor family. We report the cloning from human hippocampal cDNA of a novel 5-HT4 receptor variant that lacks the C-terminal exon which constitutes the varying domain in the other variants. We also report the distribution in monkey brain and human brain and periphery of this novel and other existing C-terminal variants.
Section snippets
5′ and 3′ RACE amplifications
A partial nucleotide sequence encoding a fragment encompassing most of the third cytoplasmic loop of a human 5-HT4 receptor (Ullmer et al., 1995) was used to design and synthesize PCR primers to be used in RACE reactions (Rapid Amplification of cDNA Ends) to amplify the 5′-half and the 3′-half of human 5-HT4 receptors. Primers and oligonucleotides were custom synthesized by Amersham Pharmacia Biotech (Little Chalfont, UK). Two antisense primers, p1 (5′ AGAATTCGGTCTCTGTCCTCATGCGATGAGTG) and p2
5′ RACE
Marathon-Ready cDNA from human hippocampus was subjected to amplification with the anchor primer AP1 and gene specific antisense primer p1, followed by a nested PCR with AP1 and gene specific primer p2 (see Fig. 1). Upon Southern blot analysis of the reaction products and hybridization with oligonucleotide probe on1, a hybridizing DNA fragment of approximately 800 bp was observed in both PCR reactions. The products of the nested PCR were subcloned and screened with probe on1. Sequencing of
Discussion
We report the cloning of a novel human 5-HT4 receptor C-terminal splice variant. It is of interest to note that three other isoforms already described in the literature were also cloned from the same human hippocampus cDNA library (not shown), indicating the complexity of 5-HT4 receptor variant expression in certain brain regions.
In our initial RACE experiments, two 3′RACE fragments were obtained, one of them corresponding to the already described h5-HT4(b) variant (Van den Wyngaert et al., 1997
Acknowledgements
This work was supported by grants from CICYT, SAF 96-0336 and SAF 97-0117. The authors wish to thank Dr F. Artigas and Ms L. Campa for their expert HPLC measurements of 5-HT in cell culture medium. In the very initial phases of this project, M.T.V. was recipient of a Long Term EMBO fellowship (ALTF 448-1992). Support from the CIRIT (Generalitat de Catalunya) to the Department of Neurochemistry (IIBB/CSIC) as Grup de Recerca Consolidat (1999 SGR-00210) is acknowledged.
References (38)
- et al.
Modulation of forskolin-mediated adenylyl cyclase activation by constitutively active G(S)-coupled receptors
FEBS Letters
(1997) - et al.
Molecular and functional characterization of a 5-HT4 receptor cloned from human atrium
FEBS Letters
(1997) - et al.
Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction
Analytical Biochemistry
(1987) - et al.
Cloning, expression and pharmacology of the mouse 5-HT(4L) receptor
FEBS Letters
(1996) - et al.
Identification and characterization of serotonin 5-HT4 receptor binding sites in human brain: comparison with other mammalian species
Molecular Brain Research
(1994) - et al.
Central 5-HT4 receptors
Trends in Pharmacological Science
(1995) - et al.
5-HT receptor classification and nomenclature: towards a harmonization with the human genome
Neuropharmacology
(1997) - et al.
Quantitative autoradiography of 5-HT4 receptors in brains of three species using two structurally distinct radioligands, [3H]GR113808 and [3H]BIMU-1
Neuropharmacology
(1994) - et al.
Localization of serotonin-4 receptors in the striatonigral pathway in rat brain
Neuroscience
(1995) - et al.
Expression of serotonin receptor mRNAs in blood vessels
FEBS Letters
(1995)
Localization of 5-HT4 receptor mRNA in rat brain by in situ hybridization histochemistry
Molecular Brain Research
5HT4(a) and 5-HT4(b) receptors have nearly identical pharmacology and are both expressed in human atrium and ventricle
Naunyn-Schmiedebergs Archiv fuer Pharmakologie
Structure of the human serotonin 5-HT4 receptor gene and cloning of a novel 5-HT4 splice variant
Journal of Neurochemistry
Cloning, expression, and pharmacology of four human 5-hydroxytryptamine4 receptor isoforms produced by alternative splicing in the carboxyl terminus
Journal of Neurochemistry
The 5-HT4 receptor antagonist ML10375 inhibits the constitutive activity of human 5-HT4(c) receptor
British Journal of Pharmacology
Mapping of serotonin 5-HT(4) receptor mRNA and ligand binding sites in the post-mortem human brain
Synapse
Cloning and expression of human 5-HT4S receptors. Effect of receptor density on their coupling to adenylyl cyclase
Neuroreport
5-HT4 receptors: cloning and expression of new splice variants
Annals of the New York Academy of Sciences
Novel brain-specific 5-HT4 receptor splice variants show marked constitutive activity: role of the C-terminal intracellular domain
Molecular Pharmacology
Cited by (64)
Constitutive activity of 5-HT receptors: Factual analysis
2020, NeuropharmacologyCitation Excerpt :It corresponds to one of the most complex genes (Hiroi et al., 2001). According to their different C-terminal sequences, four mouse (A,B,E,F), three rat and eight human (A,B,C,D,E,F,G,N) distinct splice variants have been characterized (Blondel et al., 1997, 1998; Claeysen et al., 1996, 1999a; Gerald et al., 1995; Mialet et al., 2000a, 2000b; Vilaro et al., 2002). Based on studies carried out with the light receptor rhodopsin, the C-terminal internal sequences appear to affect the allosteric transition between different functional states of the receptor (Fig. 1A).
Therapeutic potential of serotonin 4 receptor for chronic depression and its associated comorbidity in the gut
2020, NeuropharmacologyCitation Excerpt :5-HT4R is widely expressed both in CNS and gut (Fig. 3B) (Bockaert and Dumuis, 1998; Hegde and Eglen, 1996; Reynolds et al., 1995). Except for isoform (d), human 5-HT4R isoforms (a–i and n) are highly expressed in the CNS (Blondel et al., 1998; Bockaert et al., 2004; Vilaró et al., 2002). Of these, isoform (b) is the most abundant form in the CNS and periphery and is expressed in the caudate nucleus, putamen, amygdala, pituitary gland, and small intestine.
Distribution of 5-HT receptors in the central nervous system: an update
2020, Handbook of Behavioral NeuroscienceAlternative Splicing of G Protein-Coupled Receptors: Relevance to Pain Management
2015, Mayo Clinic ProceedingsIdentification of alternatively spliced multiple transcripts of 5-hydroxytryptamine receptor in mouse
2012, Brain Research Bulletin
- 1
Permanent address: Almirall Prodesfarma SA. Cardener, 68, Barcelona 08036, Spain.