Abstract
Alternative splicing of mouse β3-adrenoceptor transcripts produces an additional receptor isoform (β3b-adrenoceptor) with a C terminus comprising 17 amino acids distinct from the 13 in the known receptor (β3a-adrenoceptor). We have shown that the β3b-adrenoceptor couples to both Gs and Gi, whereas the β3a-adrenoceptor couples only to Gs. To define the regions involved in this differential G protein coupling, we have compared wild-type, truncated, and mutant β3-adrenoceptors. In Chinese hamster ovary cells expressing β3-adrenoceptors truncated at the splicing point, cAMP accumulation with CL316243 [(R,R)-5-[2-[[2-(3-chlorophenyl)-2-hydroxyethyl]-amino]-propyl]1,3-benzodioxole-2,2-dicarboxylate] increased by 59% following pretreatment with pertussis toxin, suggesting that the C-terminal region of the β3a-adrenoceptor inhibits coupling to Gi. We next utilized the cell-penetrating peptide Transportan 10 (Tp10) to introduce peptides comprising the different C-terminal tail fragments into cells expressing β3a-adrenoceptor, β3b-adrenoceptor, and the truncated β3-adrenoceptor. Treatment with β3a-Tp10 (1 μM) caused cAMP responses to CL316243 in the β3a-adrenoceptor to become pertussis toxin-sensitive and display a 30% increase over control, whereas the other peptides did not affect any receptor. Mutation at a potential tyrosine phosphorylation site (Tyr392Ala β3a-adrenoceptor) did not alter responses or pertussis toxin sensitivity relative to the parent receptor. Surprisingly, a Ser388Ala/Ser389Ala mutant β3b-adrenoceptor became unresponsive to CL316243 while retaining an extracellular acidification rate response to SR59230A [3-(2-ethylphenoxy)-1-[(1,S)-1,2,3,4-tetrahydronapth-1-ylamino]-2S-2-propanol oxalate]. Our findings suggest that the β3a-adrenoceptor cannot couple to Gi because of conformational changes induced by a protein(s) that interacts with residues in the C-terminal tail or because this protein(s) affects the intracellular localization of the β3a-adrenoceptor.
The alternative splicing of transcripts encoding GPCRs has the potential to diversify the number of receptor subtypes beyond those encoded by distinct genes. Many GPCRs possess isoforms with differing C-terminal tails. These include the prostaglandin EP3 receptor (Namba et al., 1993), α1A-adrenoceptor (Hirasawa et al., 1995; Chang et al., 1998), serotonin 5-HT4 (Gerald et al., 1995) and 5-HT7 receptors (Krobert et al., 2001), and the somatostatin SRIF1A receptor (Vanetti et al., 1993). Although many splice variants share similar pharmacology, some show marked differences in signaling properties. For instance, four splice variants of the EP3 receptor couple to different subsets of G proteins (Namba et al., 1993), and 5-HT4 splice variants display differential G protein coupling (Pindon et al., 2002) and levels of constitutive activity (Claeysen et al., 1999).
The mouse β3-adrenoceptor gene contains two introns, both of which undergo alternate splicing (van Spronsen et al., 1993; Granneman and Lahners, 1995; Evans et al., 1999; Hutchinson et al., 2002). One alternately spliced mRNA encodes the β3b-adrenoceptor, with a C-terminal tail (-SSLL-REPRHLYTCLGYP) differing from that found in the β3a-adrenoceptor (-RFDGYEGARPFPT). The β3a-adrenoceptor tail contains a putative tyrosine phosphorylation site and the β3b-adrenoceptor tail a putative PKC phosphorylation site (Blom et al., 1999). Our previous studies have shown that although the splice variants display no significant pharmacological differences in binding affinity of [125I]cyanopindolol or in affinity of competitors for this binding, they do show differences in signaling properties (Hutchinson et al., 2002). Functional studies in Chinese hamster ovary (CHO-K1) cells expressing either the β3a- or the β3b-adrenoceptor were carried out to examine extracellular acidification rate (ECAR), cAMP accumulation, and Erk1/2 phosphorylation responses. ECAR responses to all β3-adrenoceptor agonists tested were greater in cells expressing β3a-adrenoceptor compared with β3b-adrenoceptor expressed at the same level. Pretreatment of cells expressing β3b-adrenoceptor but not those expressing β3a-adrenoceptor with pertussis toxin caused an increase in maximal ECAR and cAMP responses. Erk1/2 responses were unaffected by this treatment. The results suggested that in CHO-K1 cells, the β3b-adrenoceptor couples to both Gs and Gi, whereas the β3a-adrenoceptor couples solely to Gs. The increase in Erk1/2 phosphorylation following receptor activation was not dependent upon coupling of the receptors to Gi or the generation of cAMP (Hutchinson et al., 2002). However, activated β3-adrenoceptors can bind c-Src directly via four motifs (PXXP) present in the third intracellular loop and the C terminus (Cao et al., 2000). Mutation of the proline residues in these motifs prevents both c-Src binding and Erk1/2 phosphorylation. In β3a-or β3b-adrenoceptor CHO-K1 cells, Erk1/2 phosphorylation is inhibited by the c-Src inhibitor 4-amino-5-(4-chlorophenyl)-7-(t-butyl)pyrazolo[3,4-d]pyrimidine (Hutchinson et al., 2002).
To define the residues involved in differential G protein coupling of the β3a-adrenoceptor and β3b-adrenoceptor isoforms, we generated receptors mutated at key sites in the splice regions and truncated receptors lacking either of the splice regions. To examine this further, we generated cell-penetrating peptides (CPPs) to introduce the spliced C termini into cells expressing each of the β3a- and β3b-adrenoceptors and truncated receptor. The different C termini of the β3a- and β3b-adrenoceptors (p3a and p3b, respectively) were covalently linked to a transport peptide, Transportan 10 (Tp10) (Pooga et al., 1998) via a disulfide bridge. Tp10 is a CPP used as a carrier for bioactive cargo (Pooga et al., 1998).
Materials and Methods
Expression of the Mouse β3a- and β3b-Adrenoceptors and Receptor Mutants in CHO-K1 Cells. Plasmids (pcDNA3.1+) carrying the coding region for each of the β3a- and β3b-adrenoceptors were as previously described (Hutchinson et al., 2002). Four mutants were created to examine the potential importance of residues in the C terminus for G protein coupling. A construct for expression of the truncated mouse β3-adrenoceptor was made by replacing a 570-bp XhoI /XbaI fragment from the β3a-adrenoceptor plasmid with a 524-bp PCR fragment generated using the primers mb3.TF (5′ CGTCTATGCTCGAGTGTTCGTTGTGG 3′) and mb3.TR (5′ CCGCTCTAGACCCCTATCTGTTGAGC 3′) (restriction sites underlined). The Tyr392Ala β3a-adrenoceptor mutant was made in the same way, by inserting a 561-bp PCR fragment generated using the forward primer mb3.TF and a reverse primer, 5′ CGGTTCTAGACCCTTCACGTGGGAAACGGACGCGCACCTTCAGCGCCATC 3′ containing an XbaI site. All PCR reactions were carried out as described before (Hutchinson et al., 2002), using Platinum Pfx High Fidelity DNA polymerase (Invitrogen, Carlsbad, CA). The β3b-adrenoceptor mutant was made by QuikChange mutagenesis (Stratagene, La Jolla, CA). Primers for this Ser388,389Ala mutant were: forward, 5′ CCACCGCTCAACGCTGCCCTTCTTCGGGAACCC 3′; and reverse, 5′ GGGTTCCCGAAGAAGGGCAGCGTTGAGCGGTGG 3′. The complete insert and junctions with pcDNA3.1 were checked for each of the β3-adrenoceptor constructs by DNA sequencing on both strands (Micromon, Monash University, Victoria, Australia).
CHO-K1 cells were grown in a 50:50 Dulbecco's modified Eagle's medium/Ham's F12 medium supplemented with 10% (v/v) fetal bovine serum, glutamine (2 mM), penicillin (100 units/ml), and streptomycin (100 μg/ml) at 37°C with 5% CO2. Transfections were performed using Lipofectamine and the transfected cells selected in media containing 800 μg/ml Geneticin (G418), then maintained in media containing 400 μg/ml G418. Clonal cell lines were obtained by limiting dilution of mixed cell populations and were expanded and analyzed by a single-point [125I]cyanopindolol (800 pM) binding screen. Suitable clones were grown further for a full saturation binding analysis. The clonal cell lines chosen for further characterization were maintained under 5% CO2 at 37°C and passaged every 3 to 4 days. In experiments where cells were pretreated with specific agents, concentration and time of treatment are indicated with the data.
Peptide Synthesis. All peptides (see Table 3) were assembled on an ABI 433 synthesizer using low-load 4-methylbenzhydrylamine resin, N-{{2-[(triisopropylsilyl)oxy]benzyl}oxy}carbonyl-protected amino acids, and N,N′-dicyclohexylcarbodiimide/1-hydroxybenzotriazole activation. The p3b sequence contains a thiol group on the endogenous Cys residue that could easily be used to construct disulfides; however, it was necessary to add an N-terminal cysteine residue in the p3a sequence. Prior to cleavage an orthogonal fmoc group on Lys7 in the Tp10 sequence was removed, and N-{{2-[(triisopropylsilyl)oxy]-benzyl}oxy}carbonyl-Cys(NPyS) was added using O-(benzotriazol-1-yl)-N,N,N′,N′-tetramethyluronium tetrafluoroborate/1-hydroxybenzotriazole activation. The peptides were then cleaved with hydrofluoric acid containing 10% paracreosol for Tp10-N-Cys(NPyS) and 10% paracreosol/parathiocreosole for the others, followed by ether extraction and lyophilization. The peptides were then purified on a reversed phase C18 high-performance liquid chromatography column (Dionex, Sunnyvale, CA), and the mass was confirmed by matrix-assisted laser desorption ionization/time of flight mass spectrometry (Applied Biosystems, Foster City, CA). The constructs were obtained by dissolving the peptides in degassed ddH2O containing 0.1% tri-fluoroacetic acid and mixing them at 1:1.2 ratio (slight excess of the thiol-containing peptide) overnight at room temperature. The final constructs were purified by semipreparative high-performance liquid chromatography as above.
Radioligand Binding Assay. Cell membranes were prepared as described earlier (Hutchinson et al., 2002), and saturation-binding experiments were performed as described earlier (Hutchinson et al., 2002). Briefly, homogenate (10–20 μg of protein) was incubated with [125I]cyanopindolol (100–2000 pM) for 60 min at room temperature in the absence or presence of (–)-alprenolol (1 mM) to define nonspecific binding. Reactions were terminated by rapid filtration through GF/C filters presoaked for 30 min in 0.5% (v/v) polyethylenimine using a Packard Cell Harvester and radioactivity measured using a Packard Top Count. Experiments were performed in duplicate with n referring to the number of different membrane homogenate samples used.
cAMP Accumulation Studies. Cells (1 × 104 per well) were grown in 96-well plates in Dulbecco's modified Eagle's medium/Ham's F-12 medium containing 0.5% (v/v) fetal bovine serum for 2 days. On the day of experiment, media was aspirated and appropriate drugs diluted in stimulation buffer (1 mg ml–1 BSA, 0.5 mM IBMX, and 0.5 M Hepes, pH 7.4, in Hanks' balanced salt solution) added in a final volume of 100 μl. After 30 min of incubation at 37°C, media were removed and 100 μl of lysis buffer [1 mg ml–1 BSA, 0.3% (v/v) Tween 20, 0.5 M Hepes, and 0.5 mM IBMX, pH 7.4] added. Samples were rapidly frozen at –70°C to lyse cells prior to measurement of cAMP.
To examine the effect of pertussis toxin, cells were treated with toxin (100 ng ml–1) for 16 h before stimulation with appropriate drugs. The effects of CPPs based on the C terminus of the β3a- and β3b-adrenoceptors were examined by addition of 1 μM of peptide for 30 min prior to stimulation of cells with CL316243 for 30 min. In experiments to examine the possible coupling of the Ser388,389Ala β3b-adrenoceptor mutant to Gi, cells were treated with CL316243 for 30 min followed by treatment with forskolin (10 μM) for 30 min.
cAMP accumulation was measured utilizing the cAMP α-Screen Kit (PerkinElmer Life and Analytical Sciences, Boston, MA). Samples were thawed, and cAMP standards (10 pM to 1 μM) were prepared in detection buffer [0.4% (v/v) Hanks' balanced salt solution, 3 mM Hepes, 0.2% (v/v) Tween 20, and 0.1% (v/v) BSA, pH 7.4], and 5 ml of unknown samples or cAMP standards was transferred into a white 384-well plate. Five microliters of acceptor beads (anti-cAMP acceptor beads diluted in detection buffer) was aliquoted to each well and incubated for 30 min in the dark. Fifteen microliters of donor beads (streptavidin donor beads diluted in detection buffer and 1 M biotinylated cAMP) solution was added to each well, and the plate was sealed and incubated in the dark overnight. cAMP accumulation was detected utilizing the Fusion α microplate reader (PerkinElmer Life and Analytical Sciences). All results are expressed as the percentage of the forskolin response (10 μM) in a given experiment.
Cytosensor Microphysiometer Studies. The cytosensor microphysiometer (Molecular Devices, Sunnyvale, CA) was used to measure β3-adrenoceptor-mediated increases in ECAR as previously described (Hutchinson et al., 2002, 2005a). Briefly, CHO-K1 cells expressing the β3-adrenoceptor were seeded into 12-mm transwell inserts (Corning Life Sciences, Acton, MA) at 5 × 105 cells per cup and left to adhere overnight. On the day of experiment, cells were equilibrated for 2 h, and cumulative concentration-response curves to CL316243 or SR59230A were constructed in paired sister cells with cells exposed to each concentration of drug for 14 min. All drugs were diluted in modified RPMI 1640. All results are expressed as a percentage of the maximal response to SR59230A in a given experiment.
Data Analysis. All results are expressed as a mean ± S.E.M. of n. Data were analyzed using nonlinear curve fitting (GraphPad Prism version 4.0, GraphPad Software Inc., San Diego, CA) to obtain pEC50 values (cytosensor microphysiometer and cAMP experiments) or using a one-site fit to obtain Kd and Bmax values (saturation experiments). Statistical significance was determined using two-way analysis of variance tests or Student's t test. Probability values less than or equal to 0.05 were considered significant.
Drugs and Reagents. CL316243 was kindly supplied by Dr. T. Nash (Wyeth-Ayerst, Princeton, NJ). Drugs and reagents were purchased as follows: G418 from CalBiochem (San Diego, CA); [125I]cyanopindolol (2200 Ci mmol–1) from PerkinElmer Life and Analytical Sciences; pertussis toxin from Invitrogen; (–)-alprenolol, bacitracin, IBMX, polyethylenimine, and SR59230A from Sigma-Aldrich (St. Louis, MO); and aprotinin, leupeptin, and pepstatin A from MP Biomedicals (Irvine, CA). All cell culture media and supplements were obtained from Trace Biosciences (Castle Hill, NSW, Australia). Antibodies were obtained from Cell Signaling Technology Inc. (Beverly, MA). All other drugs and reagents were of analytical grade.
Results
Radioligand Binding Studies. Stably transfected cells were examined for levels of receptor expression in saturation experiments using[125I]cyanopindolol. Expression levels and pKd values for each individual β3-adrenoceptor are shown in Table 1. All of the receptors studied had similar pKd values, indicating that modifications to the C terminus of either the β3a- or β3b-adrenoceptor had little or no effect on receptor affinity (Fig. 1). Several clones were selected for each receptor to allow comparison at similar expression levels. In addition to the previously characterized β3a- and β3b-adrenoceptors (Hutchinson et al., 2002), saturation characteristics were determined for the truncated β3-adrenoceptor, the Ser388,389Ala β3b-adrenoceptor, and the Tyr392Ala β3a-adrenoceptor. Although expression levels for the Ser388,389Ala β3b-adrenoceptor mutant were somewhat lower than for the other β3-adrenoceptor variants, it is known from previous studies (Hutchinson et al., 2002) that the G protein-coupling properties of the receptors are retained over a wide range of expression levels.
Determination of the Role of the C Terminus. cAMP responses to CL316243 in CHO-K1 cells expressing β3a-adrenoceptors were unaffected by pretreatment of cells with pertussis toxin (100 ng ml–1, 16 h; Fig. 2A; Table 2), whereas responses in cells expressing β3b-adrenoceptor increased some 33% following pretreatment with pertussis toxin (P < 0.0001; Fig. 2B; Table 2), confirming our previous results (Hutchinson et al., 2002). The pEC50 values for CL316243 at the β3a- and β3b-adrenoceptors were not significantly different and were not altered significantly by pertussis toxin pretreatment (Table 2). The truncated β3-adrenoceptor that lacks the C-terminal tail of either the β3a- or β3b-adrenoceptor splice variants behaved similarly to the β3b-adrenoceptor (Fig. 1) and displayed pertussis toxin sensitivity (Fig. 2C; Table 2). The maximal response to CL316243 was increased some 59% by pertussis toxin pretreatment (P < 0.0001; Table 2). This suggested that rather than the β3b-adrenoceptor containing a motif that enables coupling to Gi, the C terminus of the β3a-adrenoceptor contains a motif that disables coupling to the inhibitory G protein. It should be noted that the responses observed here and in subsequent experiments result from β3-adrenoceptor activation because although CHO-K1 cells endogenously express low levels of β2-adrenoceptors (http://www.tumor-gene.org/GPCR/gpcr.html), CL316243 is a highly selective β3-adrenoceptor agonist with antagonist actions at β1- and β2-adrenoceptor.
The Effects of Cell-Penetrating Peptides Based on the C Terminus of the β3-Adrenoceptor Splice Variants. CHO-K1 cells expressing β3a-, β3b-, or the truncated β3-adrenoceptor were treated with a number of different peptides as indicated in Table 3. For all cell lines, the control treatment with the peptides p3a and p3b produced no significant alteration in basal cAMP production or in responses to CL316243 (10 nM), both in the presence or absence of pertussis toxin (Fig. 3) compared with cells not treated with the peptides (the β3a-adrenoceptor was still pertussis toxin insensitive, and the β3b-adrenoceptor or truncated β3-adrenoceptor were still pertussis toxin sensitive). Thus, the β3a- and β3b-adrenoceptor C-terminal tails alone are unlikely to penetrate cells and also have no discernible effect on the ability of any of the β3-adrenoceptors to produce a cAMP response.
In contrast, treatment of cells expressing β3a-adrenoceptor with the peptide Tp10-p3a (1 μM) caused the cAMP response to CL316243 to become pertussis toxin sensitive and display a 30% increase over control (P < 0.05; Fig. 3A). The same peptide had no effect on the pertussis toxin sensitivity of the β3b- (Fig. 3B) or the truncated β3-adrenoceptor (Fig. 3C). The other corresponding peptide, Tp10-p3b (1 μM), did not significantly affect responses of either of the pertussis toxin-sensitive receptors (β3b- and truncated β3-adrenoceptor) or the response of the β3a-adrenoceptor (Fig. 3). Neither Tp10-p3a nor Tp10-p3b had any effect on basal cAMP levels (Fig. 3).
The Effect of Mutations in the C Terminus of β3a- and β3b-Adrenoceptors on Signaling Properties. We generated a Tyr392Ala mutant β3a-adrenoceptor to examine the possibility that phosphorylation of the β3a-adrenoceptor tail contributes to its capacity to interfere with Gi coupling. In cells expressing this receptor, CL316243 increased cAMP levels with pEC50 values similar to the wild-type β3a-adrenoceptor (Fig. 4). There were no significant changes in the cAMP response between cells treated with vehicle and those with pertussis toxin (Fig. 4; Table 2). Thus, the Tyr392Ala mutant of the β3a-adrenoceptor behaves like the parent receptor and was not examined further for agonist-induced phosphorylation. A β3b-adrenoceptor mutant (Ser388,389Ala) was used to determine whether this putative phosphorylation site played a role in determining the type of G protein coupling. Surprisingly, although this mutant displayed similar binding characteristics (pKd) to the wild-type receptors and the other mutants (Table 1), it was not capable of stimulating cAMP accumulation in response to CL316243 (Fig. 5A). We also asked if this mutant could still couple to Gi by examining its ability to inhibit cAMP production in response to forskolin (10 μM). CL316243 had no effect at any concentration tested on cAMP accumulation following stimulation by forskolin (Fig. 5A). On the other hand, this receptor retained an ability to mediate a cytosensor response to SR59230A that must be independent of coupling to Gs or Gi (Fig. 5B). SR59230A displayed similar potency at the Ser388,389Ala β3b-adrenoceptor (pEC50 6.81) and the wild-type β3b-adrenoceptor (pEC50 6.88), but with a reduced maximal response (53.8%) (Fig. 5B). In contrast, there was virtually no ECAR response to stimulation of the Ser388,389Ala β3b-adrenoceptor with CL316243 compared with the wild-type β3b-adrenoceptor (Fig. 5B).
Discussion
In the β2-adrenoceptor, structural determinants for Gs coupling reside in the second and third intracellular loops and in helix 8, located in the proximal C-terminal tail (O'Dowd et al., 1988; Cheung et al., 1989). These regions are well conserved between the three β-adrenoceptors, suggesting that all subtypes share common determinants for coupling to Gs. In contrast, the β-adrenoceptors all have the capacity for Gi coupling, but the amino acid determinants and cell type dependence vary. When expressed in CHO-K1 or HEK 293 cells, both the β1- and β2-adrenoceptors undergo agonist-dependent phosphorylation and a consequent increase in Gi coupling (Martin et al., 2004). In cardiac myocytes, on the other hand, interaction with Gi accompanies receptor endocytosis. Interaction of the β2-adrenoceptor with Gi is dependent on a functional PDZ motif at the receptor C terminus (DSLL; Xiang and Kobilka, 2003), whereas the β1-adrenoceptor C-terminal PDZ motif (ESKV) prevents receptor internalization and Gi coupling (Xiang et al., 2002). Neither the β3a- nor the β3b-adrenoceptor has a known consensus PDZ motif at the C terminus, although our findings indicate that this region in the β3a-adrenoceptor is important for protein-protein interactions.
Coupling of the β3-adrenoceptor to Gi and resultant inhibition of cAMP accumulation has been reported in primary white and brown adipocytes and in 3T3-F442A adipocytes that express endogenous β3-adrenoceptors (Chaudhry et al., 1994; Soeder et al., 1999; Lindquist et al., 2000). Gi coupling has also been implicated in β3-adrenoceptor mediated phosphorylation of Erk1/2, although findings vary. Pretreatment of mouse 3T3-F442A and C3H10T1/2 adipocytes with pertussis toxin inhibits β3-adrenoceptor-mediated Erk1/2 phosphorylation (Soeder et al., 1999; Cao et al., 2000), whereas mouse 3T3-L1 adipocytes are not pertussis toxin-sensitive (Mizuno et al., 2000). In primary cultures of mouse brown adipocytes, Erk1/2 phosphorylation occurs exclusively via Gs activated pathways (Lindquist et al., 2000). Pertussis toxin inhibits Erk1/2 phosphorylation in CHO-K1 and HEK 293 cells expressing the human β3-adrenoceptor (Gerhardt et al., 1999; Soeder et al., 1999) but not in CHO-K1 cells expressing the mouse β3-adrenoceptor (Hutchinson et al., 2002). These inconsistencies indicate that the predominant Erk1/2 phosphorylation pathway is particularly receptor- and cell type-dependent.
The discovery of introns in the β3-adrenoceptor gene (Granneman et al., 1992) sparked a search for multiple mRNAs encoding functional β3-adrenoceptors (Granneman et al., 1992, 1993; Bensaid et al., 1993). We found two splice variants of the mouse β3-adrenoceptor (Evans et al., 1999) that have different properties, the β3b-adrenoceptor coupling to Gs and Gi, but the β3a-adrenoceptor coupling only to Gs (Hutchinson et al., 2002). To define the residues involved in this differential coupling, we generated truncated receptors lacking either splice region. CL316243-stimulated cAMP accumulation in cells expressing the truncated β3-adrenoceptor was increased 59% by pretreatment with pertussis toxin, indicating that like the β3b-adrenoceptor, this receptor is able to couple to Gi. Hence, the lack of Gi coupling displayed by the β3a-adrenoceptor must be due to interference by the C-terminal tail. This could happen in three ways: amino acid(s) in the unique C terminus undergo intramolecular interaction with residues in the Gi-coupling domains, amino acid(s) in the C terminus bind to a separate protein or complex that causes steric hindrance or a conformational change that favors coupling to Gs over Gi, or binding of a protein or complex results in localization of the receptor to a cellular compartment where it cannot couple to Gi.
We sought to distinguish intramolecular from intermolecular interactions by using peptides corresponding to the unique β3a- and β3b-adrenoceptor C termini. To deliver these peptides, the different C termini were linked via a disulfide bridge to the transport peptide Tp10, a deletion analog of transportan (Pooga et al., 1998). Transportan was originally made as a chimera of the neuropeptide Galanin(1–12) and the wasp venom mastoparan. Although mastoparan is a G protein activator (Higashijima et al., 1988), transportan is much less active than mastoparan, and Tp10 is inactive (Soomets et al., 2000). These tools were used to examine the responses of CHO-K1 cells expressing β3a-adrenoceptor, β3b-adrenoceptor, and the truncated β3-adrenoceptor to the β3-adrenoceptor agonist CL316243.
When Tp10-p3 conjugates enter the cell, the reductive environment reduces the disulfide bond within minutes, releasing the C-terminal peptides and also Tp10 as monomers (Hallbrink et al., 2001). Treatment of cells with the disulfide construct Tp10-p3a caused the cAMP responses to CL316243 in the β3a-adrenoceptor to become pertussis toxin sensitive and display a 30% increase over control. The corresponding Tp10-p3b peptide had no significant effect on responses to CL316243 by any of the β3-adrenoceptors. In particular, Tp10-p3b did not cause the β3a-adrenoceptor response to become pertussis toxin-sensitive, indicating that the Tp10 peptide per se does not affect G protein coupling. The observed effect of the Tp10-p3a peptide on the pertussis toxin sensitivity of the β3a-adrenoceptor also demonstrates that the introduction of an N-terminal cysteine in the conjugated p3a does not impair the ability of this peptide to alter signaling by the β3a-adrenoceptor. Furthermore, it does not cause the peptide to affect signaling by the β3b-adrenoceptor or the truncated β3-adrenoceptor.
Intramolecular binding within the β3a-adrenoceptor can be ruled out by our finding that the Tp10-p3a peptide restored the ability of this receptor to couple to Gi. If the peptide were competing with the C terminus for binding to site(s) within the receptor, it would suppress the Gi interaction rather than enhance it. Thus, our data are consistent with the view that the Tp10-p3a peptide competes with the endogenous β3a-adrenoceptor C terminus for binding of a separate protein or complex. It seems unlikely that this binding causes steric hindrance to interactions with Gi but not Gs because the amino acids involved in G protein coupling are thought to be within common intracellular domains, namely the second and third loops and the proximal C-terminal tail (O'Dowd et al., 1988; Marin et al., 2000). It is possible, though, that binding of other proteins to the β3a-adrenoceptor produces an allosteric effect, promoting a receptor conformation that has low affinity for Gi but unchanged affinity for Gs. An alternative hypothesis is that binding of protein(s) such as caveolin or other scaffolding proteins to the β3a-adrenoceptor C terminus localizes the receptor to membrane microdomains or intracellular compartments where it cannot couple to Gi. By analogy, the binding of proteins to the β1-adrenoceptor C-terminal PDZ motif prevents internalization of the receptor and Gi coupling in cardiac myocytes (Xiang et al., 2002).
To examine sites in the C-terminal tail that might inhibit or modulate Gi coupling, we asked whether signaling is altered by mutation of amino acids that constitute putative phosphorylation sites. The affinity of β-adrenoceptor ligands for the mutant receptors was unaltered, consistent with their identical sequences in the transmembrane domains that form the β3-adrenoceptor ligand-binding pocket (Guan et al., 1995; Granneman et al., 1998; Gros et al., 1998). The β3a-adrenoceptor C-terminal tail has a Tyr residue that may represent a target site for protein tyrosine kinases (Pinna and Ruzzene, 1996). We hypothesized that phosphorylation of the β3a-adrenoceptor C-terminal tail may facilitate the protein interactions deduced from our CPP experiments. However, the mutant Tyr392Ala receptor still lacked the capacity for Gi coupling. Thus, the identity of C-terminal amino acids conferring the β3a-adrenoceptor phenotype remains unknown because there are no other consensus phosphorylation sites or currently recognized motifs present.
We also examined a mutant β3b-adrenoceptor in which Ser388 and Ser 389 were mutated to Ala residues. Serine and threonine residues in the C-terminal tail are determinants for desensitization of GPCRs (Hausdorff et al., 1991). Unlike the β3a-adrenoceptor tail, the β3b-adrenoceptor tail contains two serine residues that hypothetically form part of a PKC consensus site, (R/K)1–3-(X)0–2-S/T(X)0–2-(R/K)1–3. Surprisingly, the Ser388,389Ala β3b-adrenoceptor was unable to couple to Gs or Gi, indicating a significant conformational change in this receptor relative to the wild-type β3b-adrenoceptor. It also displayed virtually no response to CL 316243 in the cytosensor. This is not, however, a dead receptor because it produced an ECAR response to SR59230A with similar potency to the wild-type receptor. The ECAR response is mediated by β3-adrenoceptors and antagonized by the neutral antagonist bupranolol and provides further evidence that SR59230A can activate cell signaling distinct from the Gs-cAMP pathway (Hutchinson et al., 2005a). Our recent studies indicate that changes in ECAR in response to CL316243 are mediated by cAMP but those to SR59230A may in addition involve p38 MAP kinase (Hutchinson et al., 2005b).
In conclusion, our results indicate that both the β3a- and β3b-adrenoceptors are inherently capable of coupling to Gs and Gi but that the β3a-adrenoceptor is restrained from coupling to Gi by interaction of residues in the C terminus with other protein(s). The difference between β3a- and β3b-adrenoceptor signaling cannot be altered by mutation of a residue potentially involved in Tyr phosphorylation (Tyr392 β3a-adrenoceptor). Competition for proteins interacting with the β3a-adrenoceptor by an internalized p3a-peptide allows coupling of the β3a-adrenoceptor to Gi as seen for the β3b- or truncated β3-adrenoceptor. The use of cell-permeable peptides corresponding to a particular receptor domain has provided a valuable approach to distinguishing between intra- and intermolecular interactions.
Footnotes
-
This work was supported by the National Health (NH) and Medical Research Council (MRC) of Australia Project Grant 236884 (to R.J.S.), by the Tage Erlanders Gästprofessur (to R.J.S.), by grants from European Community Framework 5 (Contract QLK3-CT-2002-01989 to U.L.), by the Swedish Research Council [Grant VR-M (to U.L.) and VR-NT (to U.L. and T.B.)], and by Jeanssonska Stiftelsen (to D.S.H.). D.S.H. is a C.J. Martin Research Fellow of the NH and MRC. M.S. is supported by a Monash University Graduate Scholarship. T.H. is a Monash University Honorary Research Fellow supported by the Kanae Foundation for Life and Socio-medical Science, the Naito Foundation, and Toho University.
-
doi:10.1124/jpet.105.091736.
-
ABBREVIATIONS: GPCR, G protein-coupled receptor; 5-HT, 5-hydroxytryptamine; PKC, protein kinase C; CHO-K1, Chinese hamster ovary; ECAR, extracellular acidification rate; CPP, cell-penetrating peptide; Tp10, Transportan 10; PCR, polymerase chain reaction; BSA, bovine serum albumin; IBMX, 3-isobutyl-1-methylxanthine; CL316243, (R,R)-5-[2-[[2-(3-chlorophenyl)-2-hydroxyethyl]-amino]-propyl]1,3-benzodioxole-2,2-di-carboxylate; SR59230A, 3-(2-ethylphenoxy)-1-[(1,S)-1,2,3,4-tetrahydronapth-1-ylamino]-2S-2-propanol oxalate.
- Received June 28, 2005.
- Accepted September 2, 2005.
- The American Society for Pharmacology and Experimental Therapeutics