Abstract
The uricosuric drug benzbromarone, widely used for treatment of gout, hyperpolarizes the membrane potential of airway smooth muscle cells, but how it works remains unknown. Here we show a novel role of benzbromarone in activation of large conductance calcium-activated K+ channels. Benzbromarone results in dose-dependent activation of macroscopic big potassium (BK) currents about 1.7- to 14.5-fold with an EC50 of 111 μM and shifts the voltage-dependent channel activation to a more hyperpolarizing direction about 10 to 54 mV in whole-cell patch clamp recordings. In single-channel recordings, benzbromarone decreases single BKα channel closed dwell time and increases the channel open probability. Coexpressing β1 subunit also enhances BK activation by benzbromarone with an EC50 of 67 μM and a leftward shift of conductance-voltage (G-V) curve about 44 to 138 mV. Site-directed mutagenesis reveals that a motif of three amino acids 329RKK331 in the cytoplasmic linker between S6 and C-terminal regulator of potassium conductance (RCK) gating ring mediates the pharmacological activation of BK channels by benzbromarone. Further ex vivo assay shows that benzbromarone causes reduction of tracheal strip contraction. Taken together, our findings demonstrate that uricosuric benzbromarone activates BK channels through molecular mechanism of action involving the channel RKK motif of S6-RCK linker. Pharmacological activation of BK channel by benzbromarone causes reduction of tracheal strip contraction, holding a repurposing potential for asthma and pulmonary arterial hypertension or BK channelopathies.
SIGNIFICANCE STATEMENT We describe a novel role of uricosuric agent benzbromarone in big potassium (BK) channel activation and relaxation of airway smooth muscle contraction. In this study, we find that benzbromarone is an activator of the large-conductance Ca2+- and voltage-activated K+ channel (BK channel), which serves numerous cellular functions, including control of smooth muscle contraction. Pharmacological activation of BK channel by the FDA-approved drug benzbromarone may hold repurposing potential for treatment of asthma and pulmonary arterial hypertension or BK channelopathies.
Introduction
The big potassium (BK) channel, also known as Maxi-K, is a voltage-gated and Ca2+-activated potassium channel characterized by its large conductance of potassium ions across cell membrane, comprising four symmetric pore-forming α subunits (Yellen, 2002; Hite et al., 2017; Tao et al., 2017) with or without association of regulatory β (Garcia-Calvo et al., 1994; Brenner et al., 2000; Orio et al., 2002) or γ subunits (Yan and Aldrich, 2010; Zhang and Yan, 2014). The structure of each BKα subunit is featured with seven-transmembrane (TM) domains (S0–S6) and a large intracellular C terminus containing two regulators of conductance of K+ (RCK) domains as Ca2+ sensor gating rings (Yellen, 2002; Yusifov et al., 2008; Zhang et al., 2010; Hite et al., 2017; Tao et al., 2017). The voltage sensing domains (VSDs) formed by S1 to S4 are activated by depolarization, and their subsequent movements result in the opening of pore domain formed by S5 and S6 (Ma et al., 2006). Two RCK domains bound by calcium are believed to open the channel by exerting pulling force on the passive spring S6-RCK1-linker (Niu et al., 2004). The VSD and the N-lobe of RCK1 are also found to contact each other by noncovalent interactions, allowing mutual modulation in addition to direct activation on the pore domain (Cox et al., 1997; Horrigan and Aldrich, 2002; Hite et al., 2017).
BK channels are abundantly expressed in smooth muscle cells and neurons, playing an important role in controlling cell membrane excitability (Latorre et al., 2017). BK channel activation modulates smooth muscle contractility by invoking the spontaneous transient outward potassium currents (STOCs) that hyperpolarize cell membrane potential (Bolton and Imaizumi, 1996; Hull et al., 2013). Activation of BK channels also contributes to repolarization of action potentials (Aps) and mediates the fast phase of fast afterhyperpolarization (fAHP) in neurons (Shao et al., 1999; Womack et al., 2009; Kimm et al., 2015). Functional deficit of BK channels is implicated in diseases such as epilepsy (Du et al., 2005; Lee and Cui, 2009), hypertension (Yang et al., 2013), urinary incontinence (Herrera et al., 2000; Hashitani and Brading, 2003; Meredith et al., 2004), and erectile dysfunction (González-Corrochano et al., 2013). Therefore, pharmacological activation of BK channels may hold promise for potential therapies, including asthma or pulmonary arterial hypertension (Vang et al., 2010), erectile disfunction (Boy et al., 2004), epilepsy (Boy et al., 2004; Lee and Cui, 2009; Vang et al., 2010), and brain ischemic stroke (Gribkoff et al., 2001).
Uricosuric agent benzbromarone is one of the most potent drugs for treatment of gout, a common type of arthritis that causes intensive pain and swelling in joints (Roddy and Doherty, 2010). Benzbromarone reduces serum urate level by inhibiting URAT-1 (Enomoto et al., 2002) and SLC2A9 (Caulfield et al., 2008) urate transporters located in the renal tubules, facilitating the dissolution of urate crystals. It is of interest that benzbromarone also inhibits the calcium-activated chloride channel (CaCC) ANO1/TMEM16A (Huang et al., 2012) and hyperpolarizes the membrane potential of airway smooth muscle cells (Danielsson et al., 2015). Some CaCC inhibitors such as tamoxifen (Duncan, 2005), niflumic acid, flufenamic acid, and NPPB (Gribkoff et al., 1996; Liu et al., 2015) can also activate BK channels. In addition, a structural analog of antiarrhythmic amiodarone (KB130015) also activates BK channels (Gessner et al., 2007). Based on the literature findings, we therefore hypothesized that uricosuric drug benzbromarone, a CaCC TMEM16A inhibitor, might also affect BK channels. To test this hypothesis, we investigated the effects of benzbromarone on BK channels with or without β subunits and contraction of constricted tracheal strips from mice. Our findings show that benzbromarone activates BK currents by interacting with the RKK motif of the channel S6-RCK1 linker. Benzbromarone also causes reduction of contracted tracheal strips, thus possessing therapeutic potential for asthma or diseases related to BK channel deficiency.
Materials and Methods
Chemicals and Solutions
Stock solutions of 100 mM benzbromarone from Aladdin (Shanghai, China), 100 mM Terbutaline from Aladdin, and 10 mM paxilline from Cayman (Ann Arbor, MI) in DMSO were stored at −20°C. Dilution to their final concentration in buffer was carried out immediately before use for electrophysiological recordings, with the highest concentration of compounds containing about DMSO about 0.3%. For ex vivo experiments, compounds were dissolved in the Krebs-Henseleit (K-H) buffer without DMSO. All other chemicals were of high grade (purity ≥98%) from Millipore-Sigma (St. Louis, MO).
Molecular Biology
Chinese hamster ovary (CHO) cells stably expressing human BK channel α subunits and β1 subunits (hBKα/β1) were used for subcloning. The cDNA of hBKα (gene accession number NM_001014797.2), expressed in smooth muscle tissue (McCobb et al., 1995), was subcloned into pcDNA3.1 (+) vector after reverse transcription. The translation of hBKα cDNA starts at the third ATG of hBKα cDNA that shares the same channel property as airway smooth muscle cells (Semenov et al., 2006; Lorca et al., 2014). Human BKβ1 (hBKβ1) was subcloned into vector pmCherry-N1, and the nucleotide sequence is identical to NM_004137.3.
The truncated BKα channel containing the N-terminal 342 residues without the gating ring of two tandem RCK1 and RCK2 (Budelli et al., 2013) was generated by polymerase chain reactions (PCRs) with forward primer (ACGCTAAGCTTATGGATGCGCTCATCATCC), reverse primer 1 (CACACAGAGATTC CTTAACTCCTCTTCCACTAACCGCACTATAGGA), and reverse primer 2 (CCGCTCGAGTCACACATCAGTTCCACACAGAGATTCCTTAACTCCT), using hBKα as the template with reverse primer 1 about 10% of reverse primer 2. A point mutation was introduced using Q5 polymerase for PCR, according to the manufacturer’s instructions, and mutagenic oligonucleotides were purchased from Tsingke Biologic Technology (Beijing, China). Mutagenic primers consisted of reverse complimentary 15-mers before and after the codon representing the targeted amino acid, whereupon nonsynonymous mutations were introduced to the sequence by PCR as reported (Braman et al., 1996). Mutant clones were confirmed by sequencing at Tsingke Biologic Technology.
Sequence Alignment
The Sequence alignment was conducted by using NCBI cobalt (https://www.ncbi.nlm.nih.gov/tools/cobalt/re_cobalt.cgi) and NCBI blastp with BKα protein sequences NP_001014797.1 (human), NP_001380629.1 (rat), and Q08460.2 (mouse).
Cell Culture and Transfection
Chinese hamster ovary (CHO) cells or CHO cells stably expressing hBKα/β1 were cultured in F12 medium (F12; Invitrogen, Carlsbad, CA) supplemented with 10% fetal bovine serum (Gibco) and maintained at 37°C in a humidified atmosphere with 5% CO2. CHO cells grown on 35-mm petri dishes were transfected with 1 μg construct cDNA of hBKα (or its mutants) alone or 0.25 μg hBKα (or its mutants) plus 0.75 μg auxiliary subunit using Lipofectamine 2000 (Invitrogen) 4 to 24 hours before patch-clamp experiments. Two hundred nanograms pEGFP-N1 was cotransfected for identification of transfected cells via fluorescence when needed.
Electrophysiology
Patch-clamp recordings were performed at room temperature of 20–24°C using an EPC-10 amplifier controlled via Patchmaster software (HEKA Elektronik). For whole-cell patch clamp recordings, the bath solution contained 140 mM KCl and 10 mM HEPES with pH adjusted to 7.4 using KOH. For the pipette solution, 10 mM EGTA was added for eliminating effect of intracellular calcium. For whole-cell recording condition at intracellular [Ca2+]I = 300 nM, CaCl2 was added into the pipette solution according to the WEBMAXC software (https://somapp.ucdmc.ucdavis.edu/pharmacology/bers/maxchelator/CaEGTA-TS.htm) before pH adjustment. For single-channel recordings in configuration of either on-cell patch or inside-out patch, the pipette solution was the same as the bath solution of whole-cell recordings. For whole-cell recordings, data were sampled at 50–100 kHz without low-pass filtering. Patch pipettes from borosilicate filaments had tip resistance of 3–5 MΩ. For on-cell single channel recordings, pipettes with tip resistance about 11 MΩ were used and data were sampled at 100 kHz and filtered at 1 kHz offline. Data for single-channel dwell time were collected and analyzed by pCLAMP 10.5 Software. Other data were collected and analyzed using Origin 8.0 Software. Drugs dissolved in the bath solution were perfused with an 8-Channel Valve Controlled Gravity Perfusion System (ALA Scientific Instruments).
Curve Fitting
The conductance (G) was derived from steady-state (peak) currents according to Ohm’s law: G = I/(V − EK), where EK = 0 mV in symmetrical [K+]. Data were expressed as the means ± S.D. The conductance-voltage (G-V) curves from individual recordings were fitted with the Boltzmann equation: G/Gmax = 1/(1 + e(Vm−V0.5)/S), where V0.5 is the voltage of half-maximum activation, S is the slope of the curve, Vm is the test potential, G is the conductance, and Gmax is the maximal conductance. The mean values of current amplitude or mechanical force in response to benzbromarone concentrations were fitted with the Hill equation: y = START + (END − START) * x^n/(k^n + x^n). For single-channel dwell time analysis, the average channel open or closed lifetimes (τ) were determined by fitting a single exponential distribution, N(t)/N(0) = exp(−t/τ), where N(t) denotes the number of channel opening or closing events with a lifetime longer than time t to each histogram.
Animals
All protocols describing animal care and experimental procedures are approved by the Animal Ethics Committee of Qingdao University (Qingdao, Shandong, China). Animal studies are reported in compliance with the ARRIVE guidelines (Kilkenny et al., 2010), and every effort aims to minimize animals’ suffering. For our experiments, Sprague-Dawley rats (8 weeks old, male) were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. (Beijing, China). They were housed in a pathogen-free environment at the Animals Housing Center of Qingdao University with proper ambient temperature (21°C) and a 12L:12D cycle and fed with a standard chow diet and water ad libitum.
Ex Vivo Measurements of Mouse Tracheal Strip Constriction
Isolated tracheal specimen assay was performed as previously described (Lai et al., 2013). Briefly, male Sprague-Dawley rats of 8 weeks old were asphyxiated with CO2 for 3 to 4 minutes in a special chamber, and their tracheas were quickly removed below the pharynx and above the primary bronchus bifurcation. A tracheal tube was transferred into cold oxygenated Krebs-Henseleit (K-H) buffer and gently dissected clean of surrounding tissues. Held by a thin glass stick, the rat tracheal was cut into spiral strips with proper length before being attached to a force transducer by a metal hook being before placed in an oxygenated K-H buffer. Resting tension was readjusted to 1 g before being challenged with 10 μM methacholine (MCh) solution for 5 minutes. After the baseline was stable, tracheal strips were challenged with benzbromarone and 10 μM MCh. The tracheal strips were recorded for 5 minutes in response to each drug application.
To evaluate the degree of tracheal constriction, the contraction rate was calculated using the following equation: The relaxation rate (%) = [the force when acetylcholine (ACh) was used alone − the force when ACh and test drugs were combined]/the force when ACh was used alone * 100%.
Data Analysis and Statistics
All data were expressed as means ± S.D. and analyzed using GraphPad 5. Statistical difference was assessed using either paired t tests or one-way ANOVA. A value of P < 0.05 was considered to be statistically significant and denoted with an asterisk (*) or (#) in the text or figures. P < 0.01 was noted with (**) or (##), and P < 0.001 was marked with (***) or (###). A value of P > 0.05 was considered to be statistically insignificant and denoted with (ns) or (NS) in the figures.
Results
Activation of BKα Channels by Benzbromarone in Dose-Dependent Manner
We started examining the effect of benzbromarone on human BK pore-forming α subunits transiently expressed in CHO cells using whole-cell patch clamp assay. Perfusing different concentrations of benzbromarone (1–300 µM) resulted in a dose-dependent activation of BK currents about 1.7- to 14.5-fold in response to 100 mV membrane depolarization with an EC50 of 111 ± 15 μM and a Hill coefficient value of 1.1 ± 0.2 (Fig. 1A). The 300 µM benzbromarone-mediated current was inhibited by a specific BK channel inhibitor paxilline at 0.3 µM (Fig. 1B). As a blank control, benzbromarone had no effect on untransfected CHO cells (Supplemental Fig. 1).
To further examine the effect of benzbromarone on voltage-dependent activation of BKα channels, we recorded the current evoked by a range of potentials from −80 mV to 240 mV in 20-mV increments in the presence or absence of benzbromarone (Fig. 1C). Plotting the G-V curve revealed that benzbromarone at 10 μM and 100 μM led to the leftward shift of BKα channel activation about Δ10 mV and Δ54 mV, respectively, from the half-activation voltage (V0.5) at 162 ± 18 mV (Fig. 1D; Table 1), and the benzbromarone-mediated effect on voltage-dependent activation of BKα was reversible upon washout (Fig. 1, C and D). These results indicate that benzbromarone acts as a BK channel activator.
Intracellular calcium concentration can vary from 100 nM to 1 μM under physiologic conditions. We tested the effect of benzbromarone on BKα activation under 300 nM [Ca2+]i. Benzbromarone (benz) caused the leftward shifts of BKα channel activation by about Δ9 mV(10 μM benz) and Δ53 mV(100 μM benz), respectively, from the half-activation voltage (V0.5) at 124 ± 2 mV (Fig. 1E; Table 1) which suggests that physiologic intracellular calcium does not influence the effect of benzbromarone on BKα.
Leftward Shift for Voltage-Dependent Activation of BKα Channels Coexpressed with β1 by Benzbromarone
Because auxiliary subunits can alter BK channel gating and pharmacology, we further tested the effect of benzbromarone on BKα/β1 channel complexes. Similarly, benzbromarone dose dependently activated BKα/β1 currents at 100 mV with an EC50 of 67 ± 7 μM and a Hill coefficient value of 1.6 ± 0.2, and the activated current was completely inhibited by paxilline at 0.3 μM (Fig. 2, A and B). Application of benzbromarone at 10 and 100 μM caused the voltage-dependent activation of BKα/β1 currents with larger leftward shifts about Δ44 mV and Δ138 mV, respectively (Fig. 2, C and D). Comparing the V0.5 of BK channel with or without β1 subunit, benzbromarone resulted in a larger left shift of voltage dependence of BKα/β1 complex activation (Fig. 2E), further demonstrating the effect of uricosuric agent benzbromarone on activating BK currents in the presence of auxiliary β1 subunits.
Increase of BKα or BKα/β1 Complex Single-Channel Open Probability by Benzbromarone
To further confirm and characterize the on-target effect of benzbromarone on BK channel, we recorded BKα single-channel currents in on-cell patch configuration, ensuring that the cell membrane and intracellular environment were intact. At holding potential of +100 mV on the intracellular side, benzbromarone at 10 μM and 100 μM increased BKα single-channel open probability (Po) of 2.4- and 27.0-fold, respectively, compared with the control group (Fig. 3, A–E). Benzbromarone had no effect on the unitary single channel conductance (Fig. 3F). Analysis of distribution of open interval duration revealed that benzbromarone at 100 μM increased the channel open time by increasing τopen about 2.3 times (Fig. 3G). Benzbromarone at 10 and 100 μM also decreased the channel closed interval duration by decreasing the τclosed about 2.8 and 14.0 times, respectively (Fig. 3H). These results indicate that benzbromarone activates BK channel mainly through destabilizing the channel closed state and stabilizing the channel open state.
We also examined the effect of benzbromarone on single-channel currents of BKα/β1 channel complexes. As shown in Fig. 4, A–F, the single-channel currents were recorded before and after 10 or 100 μM benzbromarone treatment, exhibiting an increased open probability without noticeable change of unitary single channel conductance. The mean open interval duration (τopen) showed an increase about 1.6-fold in response to 100 μM benzbromarone (Fig. 4G). The closed interval duration (τclosed) was decreased about 2.0-fold and 23.3-fold by 10 and 100 μM benzbromarone, respectively (Fig. 4H), which was further confirmed by inside-out patch recordings (Supplemental Fig. 2). These results are also consistent with the observation on aforementioned BKα alone.
Identification of the RKK Motif in the S6-RCK1 Linker Critical for BK Channel Activation by Benzbromarone
To identify the molecular determinant critical for benzbromarone-mediated BK activation, we generated a C-terminal truncated BKα channel lacking the two tandem RCK1 and RCK2 domains of the gating ring (Budelli et al., 2013) (Fig. 5A), and the truncated BKα exhibits a larger slope factor than wild-type (WT) BKα channels (Zhang et al., 2017). As shown in Fig. 5, B and C, benzbromarone at 10 and 100 μM increased the truncated BKα channel current and left shifted the G-V curve about 18 mV and 79 mV, respectively, compared with the control of V0.5 (218 ± 16 mV), which is similar to the leftward shift of full-length BKα channel activation by benzbromarone (Fig. 5F). Similarly, benzbromarone at 10 and 100 μM also caused a left shift of the G-V curve of the truncated BKα coexpressed with β1 (Fig. 5, D and E) in a similar extent as WT BKα/β1 (Fig. 5G). These results suggest that benzbromarone activates BK channel by interacting with the amino acids from the N terminus to S6-RCK1 linker.
To further identify molecular determinants critical for benzbromarone-mediated channel activation, we generated several BK channel mutants and tested their effects in response to benzbromarone. As shown in Figs. 6A and 7E, the channel mutant 9A9 (G327L, N328S, K330N, Y332F), known to reduce the channel sensitivity to BK activator NS1619 or Cym04 (Gessner et al., 2012), retained the sensitivity to voltage-dependent activation in response to benzbromarone at 10 μM and 100 μM. Similarly, mutating β1 (R11D), which reduces the channel sensitivity to activation of phosphatidylinositol 4,5-bisphosphate (PIP2) (Tian et al., 2015) and DHA (Hoshi et al., 2013a), also retained the channel activation by benzbromarone (Figs. 6B and 7G). In contrast, a triple mutation in the RKK motif (329RKK331 to AAA) of truncated BKα abolished the left shift of voltage-dependent channel activation by benzbromarone (Fig. 6, C and D). At the single-channel level, the triple mutant (329RKK331 to AAA) had no significant change of single-channel open probability (Fig. 6E) and the open or closed dwell time (Fig. 6, F and G) in response to benzbromarone at 10 and 100 μM. These results demonstrate that benzbromarone activates BK channel currents through interacting with the RKK motif in the S6-RCK linker of BK channels.
To further explore any residue within the RKK motif important for benzbromarone-mediated effect, we generated three individual mutations of R329A, K330A, and K331A. As shown in Fig. 7, A–C and E, none of the mutants significantly reduced the leftward shift of voltage-dependent activation of BK currents by benzbromarone. Similarly, we also examined a double mutant of E321A/E324A that still remained in the leftward shift of BK currents by benzbromarone (Fig. 7, D and E). In contrast, coexpressing β1 subunit with truncated BKα triple mutant (RKK to AAA) rescued the leftward shift of BK activation by benzbromarone, which is similar to that of wild-type (WT) BKα/β1 (Fig. 7, F and G; Table 1).
Benzbromarone Reduces Tracheal Contraction via BK Channel Activation
To evaluate whether BK channel activator benzbromarone had any effect on airway smooth muscle contraction, we used a rat ex vivo model of tracheal spiral strip constriction induced by methacholine (MCh) and tested the effect of benzbromarone on branchial relaxation. As shown in Fig. 8a, benzbromarone at 100 μM resulted in the complete remission of 10 μM MCh-induced constriction, which was rapidly reversed by coapplication of BK channel inhibitor paxilline (10 μM). However, this reverse was difficult to sustain, possibly because paxilline caused a reversible inhibition of channel currents (Sanchez and McManus, 1996). The dose-response relationship demonstrated that bath application of different concentrations of benzbromarone ranging from 1 μM to 300 μM resulted in concentration-dependent relaxation of MCh-induced constriction of tracheal strips with an IC50 of 3.0 ± 0.9 μM and a Hill coefficient of 0.7 ± 0.2 (Fig. 8B). These results showed that pharmacological activation of BK channels by benzbromarone can dilate the constricted tracheal strips.
Discussion
Benzbromarone Activates BK Channel
Pharmacological activation of BK channels reduces cellular excitability, which is considered to be a promising strategy for treatment of diseases such as asthma, arterial hypertension, and stroke (Latorre et al., 2017). Based on literature findings that BK channels are abundantly expressed in smooth muscle cells and a US Food and Drug Administration (FDA)-approved uricosuric agent benzbromarone hyperpolarizes airway smooth muscle cells (Danielsson et al., 2015; Miner et al., 2019), together with antiarrhythmic amiodarone derivative KB130015 that activates BK channels (Gessner et al., 2007), we in this study postulated that benzbromarone might also activate BK potassium channels. Here we show a previously unknown role of benzbromarone in pharmacological activation of BK channels, involving functional interaction in the RKK motif of the channel S6-RCK linker and also reducing the airway smooth muscle contraction. These key findings suggest that benzbromarone as a BK channel activator may hold repurposing potential for treatment of asthma, pulmonary arterial hypertension, or BK channel deficiency–related disease (Latorre et al., 2017).
The mechanism of action for benzbromarone is featured by the following: First, benzbromarone causes a significant left shift of voltage-dependent activation of both BKα and BKα/β1 complexes to hyperpolarizing direction, mainly by reducing the channel closed time. Second, auxiliary β1 subunit is specifically expressed in smooth muscle cells (Bhattarai et al., 2014), and coexpressing β1 subunit can further enhance the benzbromarone-mediated channel activation, suggesting more specific and better efficacy of benzbromarone likely for conditions related to smooth muscle cell dysfunction. Third, the 329RKK331 motif within the S6-RCK linker mediates the pharmacological activation of BK channels by benzbromarone, suggesting that targeting the segment of S6-RCK linker may lead to identification of more diversified and specific small molecules for modulation of the channel pharmacology (Gessner et al., 2012). Finally, benzbromarone is mechanistically distinct from other BK channel activators such as lithocholic acid (Bukiya et al., 2011), arachidonic acid (Martín et al., 2014) and 17β-estradiol (Valverde et al., 1999), which are unable to activate BKα channel without β1 subunits. Benzbromarone is also different in comparison with the agonist GoSlo-SR-5-6, which is independent on regulation of β1 subunit (Kshatri et al., 2017). In contrast, benzbromarone behaves similarly to activators such as KB130015 (Gessner et al., 2007), DHA, and PIP2 (Tian et al., 2015), with their activation effects dependent on β1 subunits.
The RKK Motif of the S6-RCK Linker Is Critical for Pharmacological Activation of BK Channels
The RKK motif of S6-RCK linker in BK channel has previously been shown to be a binding site of essential membrane lipid phosphatidylinositol 4,5-bisphosphate (PIP2) (Vaithianathan et al., 2008) as well as a binding site for two residues E321 and E324 from neighboring subunit (Tian et al., 2019). Both benzbromarone and PIP2 can destabilize the close state of channel, whereas β1 subunit potentiates their activation (Tian et al., 2015). Interestingly, benzbromarone works differently, as auxiliary β1 can only rescue benzbromarone-mediated effect on the 329RKK331/AAA mutant (Fig. 7, F and G) but not PIP2 (Vaithianathan et al., 2008; Tian et al., 2015).
Regulation of BK channels by auxiliary β subunits gives rise to functional diversity and tissue specificity. The recent cryogenic electronic microscopy (cryo-EM) structures of BK in complex with β4 reveals that four two-TM β4 subunits encircle BKα through multiple and simultaneous contacts between one α subunit and adjacent another α subunit (Tao and MacKinnon, 2019), thus forming a peripheral “tetrameric clamp” that enhances trafficking and surface expression. Interestingly, the bottom of TM1 of β4 near the intracellular membrane interface makes contacts between the S6-RCK linker of one α subunit and multiple S2-S3 linker and S0 regions from adjacent α subunit, thus indicating a critical role of S6-RCK linker segment in channel gating (Tao and MacKinnon, 2019) and regulating channel sensitivity to structurally diversified modulators such as DHA (Hoshi et al., 2013b), GoSlo-SR-5-6 (Webb et al., 2015), and cym04 (Gessner et al., 2012).
Comparing the Structural Diversity of Available Compounds May Lead to Identification of More Potent and Selective BK Activators
There are no BK activators that have been approved for clinical use. Up to date, several compounds in clinical trials, including BMS-204352, have been discontinued (Latorre et al., 2017) due to lack of clinical benefits over placebos (Kaczorowski and Garcia, 2016). BK activator andolast entered phase III clinical trial in 2015 for treatment of asthma and chronic obstructive pulmonary disease (Mushtaq, 2014), but there is no further information or report yet since then. Antiarrhythmic amiodarone inhibits cardiac type 1 human ether-a-go-go-related gene (hERG1) potassium channels without significant effect on BK channels, and its derivative KB130015, like its parent compound, blocks hERG but activates BK channels (Gessner et al., 2007). Comparing the chemical structures of amiodarone, KB130015, and benzbromarone reveals that amiodarone contains an n-butyl group and a triethylamine group that are structurally different from the corresponding groups in benzbromarone or KB130015 (Fig. 9), suggesting that retaining the common groups in the structures of benzbromarone or KB130015 may be important for BK activation. Thus, further structural modifications of benzbromarone may lead to identification of more potent and selective BK channel activators.
Repurposing Multitargeting Benzbromarone Can Be More Beneficial for Asthma with Fewer Side Effects
Previous in vitro and ex vivo studies show that uricosuric agent benzbromarone acts on multiple molecular targets, including inhibition of Ca2+-activated Cl- channel ANO1/TMEM16A (Huang et al., 2012; Zhang et al., 2013; Danielsson et al., 2015; Miner et al., 2019) and activation of Kv7/KCNQ channels (Zheng et al., 2015). In the airway smooth muscles where BK, ANO1, and Kv7 channels are expressed, we speculate that benzbromarone, with multimechanism of action involving activation of BK and Kv7 channels and inhibition of TMEM16A channels for synergistic hyperpolarization of smooth muscle cells, may be more beneficial for treatment of asthma with fewer side effects. Similarly, because these targets are also expressional in tissues such as bladder, vascular smooth muscle, and dorsal root ganglion (DRG) neurons (Passmore et al., 2003; Greenwood and Ohya, 2009; Cho et al., 2012; Anderson et al., 2013; Zhang et al., 2013; Bijos et al., 2014; Heinze et al., 2014; Haick and Byron, 2016; Latorre et al., 2017; Du et al., 2018), benzbromarone may also possess repurposing potential for treatment of bladder overreactivity, periphery nociception, and vascular hypertension.
We notice an existence of pharmacological overlap between BK channel activators and TMEM16A inhibitors. Also, a cluster of drugs such as rottlerin (mallotoxin), BMS-204352, and GoSlo function as activators for both BK and KCNQ channels (Schrøder et al., 2003; Manville and Abbott, 2018; Zavaritskaya et al., 2020). Although the underlying mechanism for this overlap is still unknown, our discovery of benzbromarone as a BK activator suggests a common activation mechanism shared by several channels such as BK, TMEM16A, and KCNQ channels (Danahay et al., 2020).
Benzbromarone is tolerable with poor penetration of the blood-brain barrier (Reinders et al., 2009; Zheng et al., 2015), rendering fewer concerns for adverse drug reactions such as depression and learning/memory impairment, likely involved in potent activation of neuronal BK channels. Clinical PK studies demonstrate that oral benzbromarone also exhibits high bioavailability in patients (Walter-Sack et al., 1988). Therefore, repurposing benzbromarone may represent an effective and safe strategy for therapy of asthma and pulmonary arterial hypertension.
Authorship Contributions
Participated in research design: X. Wang, K. Wang.
Conducted experiments: Gao, Yin, Dong, X. Wang.
Performed data analysis: Gao, Yin, Dong, X. Wang.
Wrote or contributed to the writing of the manuscript: Gao, Liu, K. Wang.
Footnotes
- Received October 12, 2022.
- Accepted December 19, 2022.
This work was supported by research grants awarded to K.W. from the National Natural Sciences Foundation of China [Grant 81573410], the Ministry of Science and Technology of China [Grant 2018ZX09711001-004-006], the Natural Sciences Foundation of Shandong Province [Grant ZR2015QL008], and the Science and Technology Program of Guangdong [Grant 2018B030334001].
No author has an actual or perceived conflict of interest with the contents of this article.
↵1Current affiliation: Washington University, St. Louis, Missouri.
↵This article has supplemental material available at molpharm.aspetjournals.org.
Abbreviations
- ACh
- acetylcholine
- benz
- benzbromarone
- BK
- big potassium
- CaCC
- calcium-activated chloride channel
- G-V
- conductance-voltage
- hBK
- human BK
- MCh
- methacholine
- PCR
- polymerase chain reaction
- PIP2
- phosphatidylinositol 4, 5-bisphosphate
- RCK
- regulator of potassium conductance
- RKK
- for amino acids of Arginine 329, Lysine 330, and Lysine 331
- TM
- transmembrane
- WT
- wild-type
- Copyright © 2023 by The American Society for Pharmacology and Experimental Therapeutics