Article Figures & Data
Figures
- Fig. 1.
Quantitation of mRNA and protein levels for enzymes required for triglyceride synthesis in normal mammary epithelial cells. A, HMECs were cultured at low confluence and were treated with solvent or 1 μM bexarotene (Bex) for 24 h. Subsequently, RNA was extracted and quantitative real-time RT-PCR was used to determine the expression levels of SCD1, ACSL1, and DGAT1. Molecule numbers were extrapolated from a standard curve, and relative mRNA levels were expressed with respect to levels of the housekeeping gene cyclophilin. **, p < 0.005; *, p < 0.05. B, Western-blot analysis of SCD1, ACSL1, and DGAT1 protein levels in cell extracts from HMECs treated with vehicle or 1 μM bexarotene for 48 h. C, densitometric analysis of the Western blots for quantitation of protein expression of the lipogenic enzymes SCD1, ACSL1, and DGAT1. **, p < 0.005; *, p < 0.05.
- Fig. 2.
Multiparametric assessment of lipid accumulation and expression and localization of RXRα and ADFP in HMECs in the absence or presence of bexarotene. A and B, cells were treated with vehicle or 1 μM bexarotene for 96 h, fixed, and stained for RXRα (Alexa594; red), neutral lipids (LipidTox; green), and DNA (DAPI; blue). Twenty Z-stack images per treatment, taken at 60× magnification with a DeltaVision system (Applied Precision Instruments), were deconvolved and maximum-projected into single, plain, red/green/blue images for analysis. Scale bars, 10 μm. C, analysis of the labeled cellular compartments through segmentation of the nuclei, lipid droplets, and RXRα protein with CyteSeer software (Vala Sciences, San Diego, CA) (McDonough et al., 2009). D, cell-by-cell measurement of the neutral lipid contents in lipid droplets after bexarotene treatment. E–G, lipid droplet metrics in HMECs. Lipid droplet counts formed as a result of the accumulation of neutral lipids (E), average lipid droplet diameter (F), and average neutral lipid content (G) were quantitated in HMECs after 4 days of bexarotene (Bex) treatment. H and I, immunofluorescent labeling of ADFP (Alexa594; red channel) localized to the outer rims of lipid droplets (labeled with LipidTox; green channel) in bexarotene-treated cells. Nuclear DNA was stained with DAPI. Scale bars, 10 μm. J, quantitation of ADFP protein on the basis of cellular integrated signal intensity from deconvolved projected images at 60× magnification. K, progression of ADFP mRNA levels in the absence (Vehicle) or presence (Bex) of 1 μM bexarotene. **, p < 0.005; *, p < 0.05.
- Fig. 3.
Characterization of the lipid-accumulative effect of bexarotene on HMECs. A, dose-response relationship of total lipid contents in HMECs treated with bexarotene for 4 days. Lipid contents were measured with high-throughput microscopy (IC-100 system; Beckman Coulter), on the basis of integrated intensity under the lipid masks. B, comparison of lipid droplet counts formed in HMECs in response to agonists of the nuclear receptors RXR [bexarotene (Bex) and LGD100268 (LG268)], PPARγ [rosiglitazone (Rosi)], PPARα [WY14643 (WY)], and RAR [(E)-4-[2-(5,6,7,8-tetrahydro-5,5,8,8-tetramethyl-2-naphthalenyl-1-propenyl]benzoic acid (TTNPB)]. C, PPARγ expression levels in cell nuclei after 4 days of bexarotene treatment. PPARγ protein levels were measured with high-throughput microscopy, on the basis of immunofluorescent labeling of the receptor. D, PPARγ mRNA levels after 24 h of treatment with bexarotene (left) and after knockdown with nontargeting control (siNT) or PPARγ-specific (siPPARγ) siRNAs. E, comparison of relative neutral lipid contents in HMECs treated with solvent (control) or bexarotene for 4 days, after knockdown of the nuclear receptors RXRα (siRXRα), PPARα (siPPARα), PPARδ (siPPARδ), or PPARγ (siPPARγ). F, comparison of ADFP mRNA levels in control or bexarotene-treated cells after knockdown with nontargeting control (siNT) or PPARγ-specific (siPPARγ) siRNAs. **, p < 0.005; *, p < 0.05.
- Fig. 4.
Lipid-accumulative and growth-suppressive effects of the combination of bexarotene and rosiglitazone in mammary epithelial cells. A, comparison of total neutral lipid contents in HMECs at the end of 6-day treatment with bexarotene (Bex) (1 μM), rosiglitazone (Rosi) (2 μM), or bexarotene and rosiglitazone in combination. B, time-course growth assay comparing cell counts after treatment with bexarotene (1 μM), rosiglitazone (2 μM), or the combination of the two drugs in normal HMECs. **, p < 0.005; *, p < 0.05.
- Fig. 5.
Synergistic growth-suppressive effects on HMECs of combined doses of bexarotene and rosiglitazone. A, high-throughput microscopy was used to compare cell counts after 4 days of treatment with bexarotene (Bex), rosiglitazone (Rosi), or the two drugs in combination. Means of average cell counts from triplicate wells with 45 imaged microscopic fields per well are shown for each drug concentration. The data bars corresponding to the six bexarotene/rosiglitazone combinations confirmed in D as statistically significantly different, compared with the ED50 values of the two individual compounds, and thus synergistic are circled. B, isobologram analysis comparing the effects of bexarotene/rosiglitazone dose pairs on the basis of dose-effect calculations obtained through the median effects method (Chou and Talalay, 1984). Dose values of single agents with equal potencies mark the line of additivity, which segregates dose pairs with synergistic and antagonistic interactions between two dugs. C, table summarizing doses of bexarotene and rosiglitazone and the combination indexes derived from the resulting isobologram (only combinations containing 0.2, 0.66, and 2 μM rosiglitazone are shown). Combination index (CI) values of less than 0.9 indicate synergy, whereas values of more than 1.3 indicate antagonism. The identification numbers for combinations found to be synergistic or antagonistic in the secondary tests (see D) are highlighted with a light gray background, and those found to be antagonistic are highlighted with a dark gray background. D, statistical evaluation of synergism. The significance of the synergistic effect associated with dual bexarotene/rosiglitazone treatment was established through direct comparison, with two-tailed Student's t tests, of variant dose combinations with the relative effects of the two individual drugs at ED50, as described previously by Laska et al. (1994). E, scatter plots of cell growth and lipid accumulation of HMECs treated with 0, 10, or 100 nM bexarotene in conjunction with increasing doses of rosiglitazone (0, 0.2, 0.66, 2, and 6.66 μM, represented by data points of proportionally increasing size within each of the three bexarotene treatment groups). The directional shifts of the dose-response curves are indicated by arrows a and b. Each data point represents the mean of four replicate wells, and values are plotted according to average cellular lipid contents and cell counts per field (as shown on y-axis of E).
Tables
- TABLE 1
Primer and probe sequences used in quantitative real-time RT-PCR assays to measure mRNA levels of lipogenic genes
Transcript quantitation based on real-time monitoring of amplification was carried out according to the parameters defined under Materials and Methods.
Gene Name or Symbol GenBank Accession No. Primers (5′→3′) TaqMan Probe (5′→3′) Forward Reverse SCD1 NM_005063 CACCTCTTCGGATATCGTCCT GTAGTTGTGGAAGCCCTCACC FAM-ATGACAAGAACATTAGCCCCCGGGAG-BHQ ACSL1 NM_001995 AGATCTTGCAGTAATTTGTTTCACAA CGCTCACTATGTTTCGGTGAGT FAM-TGGAACTACAGGCAACCCCAAAGGAG-BHQ DGAT1 NM_012079 TGGAACATCCCTGTGCACA TGCCCCGTCGAAGCAT FAM-TGGTGCATCAGACACTTCTACAAGCCC-BHQ Adfp NM_001122 GTGACTGGCAGTGTGGAGAAG TCCGACTCCCCAAGACTGT FAM-CCAAGTCTGTGGTCAGTGGCAGCA-BHQ PPARγ NM_138712 ATGCTGGCCTCCTTGATGA GCTTTCGCAGGCTCTTTAGAA FAM-TCTCATATCCGAGGGCCAAGGCTTC-BHQ Cyclophilin NM_021130 ACGGCGAGCCCTTGG TTTCTGCTGTCTTTGGGACCT FAM-CGCGTCTCCTTTGAGCTGTTTGCA-BHQ FAM, 5-carboxyfluorescein; BHQ, black hole quencher.
