Advertisement
Research ArticleArticle

Influence of Gαq on the Dynamics of M3-Acetylcholine Receptor–G-Protein–Coupled Receptor Kinase 2 InteractionGraphic

Valerie Wolters, Cornelius Krasel, Jörg Brockmann and Moritz Bünemann
Molecular Pharmacology January 2015, 87 (1) 9-17; DOI: https://doi.org/10.1124/mol.114.094722

Abstract

G-protein–coupled receptor kinase 2 (GRK2) is a serine/threonine kinase with an important function in the desensitization of G-protein–coupled receptors. Based on its ability to bind G-protein βγ subunits as well as activated Gαq subunits, it can be considered as an effector for G-proteins. The recruitment of GRK2 to activated receptors is well known to be mediated by Gβγ together with negatively charged membrane phospholipids. In the current study, we address the role of Gαq on the interaction of GRK2 with activated Gq-protein–coupled receptors. Therefore, we established new Förster resonance energy transfer (FRET)–based assays to study the interaction of GRK2 with the M3-acetylcholine (M3-ACh) receptor as well as Gq-protein subunits with high spatiotemporal resolution in single living human embryonic kidney 293T cells. M3-ACh receptor stimulation with 10 µM acetylcholine resulted in distinct changes in FRET, which reflects interaction of the respective proteins. GRK2 mutants with reduced binding affinity toward Gαq [GRK2(D110A)] and Gβγ [GRK2(R587Q)] were used to determine the specific role of Gq-protein–binding by GRK2. Comparison of absolute FRET amplitudes demonstrated that Gαq enhances the extent and stability of the GRK2–M3-ACh receptor interaction, and that not only Gβγ but also Gαq can target GRK2 to the membrane. This reveals an important role of Gαq in efficient recruitment of GRK2 to M3-ACh receptors. Furthermore, interactions between Gαq and GRK2 were associated with a prolongation of the interaction between GRK2 and the M3-ACh receptor and enhanced arrestin recruitment by these receptors, indicating that Gαq influences signaling and desensitization.

Introduction

G-protein–coupled receptor kinases (GRKs) are a family of serine/threonine kinases that initiate the desensitization of G-protein–coupled receptors. By phosphorylating cytoplasmic regions of the receptor, they induce binding of arrestin proteins to activated receptors, resulting in an uncoupling of receptor signaling and initiation of receptor internalization (Krupnick and Benovic, 1998; Wu et al., 1998). Most GRKs are ubiquitously expressed (Pitcher et al., 1998), and alterations in their expression levels have been shown to be associated with several diseases, such as heart failure (Ungerer et al., 1993; Hata and Koch, 2003). The important influence of GRKs in the cardiovascular system and other fields demonstrates that a comprehensive knowledge about the various functions of GRKs is of great interest.

Structurally, GRKs are multidomain proteins, containing an N-terminal RGS (regulator of G-protein signaling) homology domain, followed by a central kinase domain and a C-terminal domain (Pitcher et al., 1998). The C-terminal domain is variable between the different GRKs, but in all cases is essential for their membrane targeting. GRK2 and GRK3 contain the largest C-terminal domain, including a pleckstrin homology domain that interacts with Gβγ subunits as well as negatively charged membrane phospholipids (Pitcher et al., 1992; Touhara et al., 1995). Because of overlapping binding sites, these GRKs compete with inactive Gαq subunits for Gβγ binding. Therefore, they only interact with Gβγ and translocate to the membrane after G-protein activation (Ford et al., 1998).

The RGS homology domain of GRK2 and GRK3 is known to interact with activated Gαq-proteins, but not with Gαs- or Gαi-proteins (Carman et al., 1999; Sallese et al., 2000). It has been shown by a crystal structure that even a simultaneous binding of Gβγ and Gαq is possible (Tesmer et al., 2005). The GRK binding site on Gαq includes the Gαq switching region, which enables the discrimination between the active and inactive state of Gαq (Carman et al., 1999). The GRK surface that binds Gαq (C-site) differs from the binding site RGS proteins use (A-site) (Zhong and Neubig, 2001; Sterne-Marr et al., 2003), which is a possible explanation for the weak or complete lack of GAP (GTPase-activating protein) function of GRK2 (Carman et al., 1999). The sequestration of activated G-protein subunits by GRK2 has been shown to desensitize the signaling of G-protein–coupled receptors independent of phosphorylation by preventing their interaction with downstream effectors (Raveh et al., 2010; Fernandez et al., 2011). However, whether binding of activated Gαq affects the function of GRK2 is still unknown and needs further investigation.

With the present study, we aimed to clarify the effects of Gαq on the interaction of GRK2 with activated Gq-protein–coupled receptors. Of special importance for our study were previously published GRK2 mutants with reduced binding affinity toward Gαq [GRK2(D110A)] (Sterne-Marr et al., 2003) and Gβγ [GRK2(R587Q)] (Carman et al., 2000). These mutants allowed determination of the individual contribution of the Gq-protein subunits for the recruitment and interaction of GRK2 with G-protein–coupled receptors. We established new Förster resonance energy transfer (FRET)–based assays to study the interaction of GRK2 with the M3-acetylcholine (M3-ACh) receptor (M3-AChR) as well as Gq-protein subunits with high spatiotemporal resolution in single living human embryonic kidney 293T (HEK293T) cells. Combining advantages of FRET imaging with the GRK2 mutants provided new insight into the influence of Gαq on extent and stability of GRK2 interaction with the M3-AChR.

Materials and Methods

Chemicals.

Agar, ampicillin, enhanced chemiluminescence solution, and lysogeny broth were purchased from AppliChem (Darmstadt, Germany); acrylamide, glycine, MgCl2, milk powder, SDS, and tetramethylethylenediamine were from Carl Roth (Karlsruhe, Germany); agarose was from Biozym (Hessisch Oldendorf, Germany); CaCl2 was from MERCK (Darmstadt, Germany); and Dulbecco’s modified Eagle’s medium, fetal calf serum, phosphate-buffered saline, penicillin/streptomycin, L-glutamine, and trypsin-EDTA were from Biochrom (Berlin, Germany). All other substances were purchased from Sigma-Aldrich (Steinheim, Germany).

Plasmids.

The M3-AChR was obtained from the Missouri S&T cDNA Resource Center (Rolla, MO). cDNAs for Gαq, Gαq–yellow fluorescent protein (YFP) (Hughes et al., 2001), Gβ1, Gγ2, α2A-adrenergic receptor (α2A-AR), Gαi1-YFP (C351I) (Bünemann et al., 2003), Gαi1 (C351I) (Wise et al., 1997), Gαo, Gβ1-Cer (Frank et al., 2005), M3-AChR–YFP (Hoffmann et al., 2012), arrestin3-YFP (Krasel et al., 2005), and GRK2 (Winstel et al., 1996) were described previously. M3-AChR–mTurquoise fluorescent protein (mTurq) was cloned analogously to M3-AChR–YFP. M2-AChR–cyan fluorescent protein (CFP) was generated by cloning CFP with a Ser-Arg linker to the C-terminus of human M2-AChR. GRK2-YFP and GRK2-mTurq were cloned by fusing the open reading frames of YFP and mTurquoise, respectively, to the C-terminus of human GRK2 using polymerase chain reaction. In these constructs, the last amino acid of GRK2 is connected to the second amino acid of the fluorescent protein by a Ser-Arg linker. The GRK2 mutants were generated from these plasmids by site-directed mutagenesis using the following primers: 5′ CAAGATGTACGCCATGAGGTGCCTGGACAAAAAG 3′ (K220R), 5′ CCGGGAGATCTTCGCCTCATACATCATG 3′ (D110A), 5′ CCTGTTCCCCAAC-CAGCTGGAGTGGCGGGGCG 3′ (R587Q).

Cell Culture and Transfection.

Experiments were performed in HEK293T cells cultured at 37°C in a humidified atmosphere with 5% CO2 in Dulbecco’s modified Eagle’s medium (4.5 g/l glucose) supplemented with 10% fetal bovine serum, 2 mM L-glutamine, 100 units/ml penicillin, and 0.1 mg/ml streptomycin. Transient transfection was conducted with Qiagen Effectene Transfection Reagent (Qiagen, Hilden, Germany) according to the manufacturer’s protocol. The general transfection protocol contained 0.5 µg M3-AChR, 1.6 µg Gαq, 0.5 µg Gβ1, 0.2 µg Gγ2, and 0.5 µg GRK2. In the experiments shown in Figs. 1, 4, and 6, the protocol was adapted to 1 µg M3-AChR and 0.1 µg GRK2 to adjust the expression levels. Experiments were performed 40–48 hours after transfection at room temperature.

Fig. 1.
Fig. 1.

FRET imaging enables investigation of GRK2 recruitment to M3-AChR. (A) HEK293T cells transiently transfected with YFP-labeled GRK2, M3-AChR–mTurq, and unlabeled Gαq, Gβ, and Gγ were subjected to single-cell FRET imaging recorded at 2 Hz. mTurq was excited at 425 nm, and mTurq and YFP fluorescence were recorded simultaneously. M3-AChR stimulation with 10 µM ACh, as indicated by the black bar, resulted in a reversible increase in YFP fluorescence (yellow trace) and a corresponding decrease in CFP fluorescence (blue trace), reflecting the interaction between GRK2 and M3-AChR (lower panel). The FRET ratio was determined as Δ(FYFP/FCFP) (upper panel). (B) Single-cell FRET recordings were averaged (mean ± S.E.M.; n ≥ 12) and displayed as absolute alterations in FRET. Experiments with α2A-AR [stimulated with 100 µM norepinephrine (NE)] and Gαi1 were used to control signal specificity. The absolute FRET amplitude of the underlying individual experiments was determined as described in the Materials and Methods section, and statistical analysis was performed by ANOVA with Bonferroni post-hoc test (*P < 0.05). (C) Images of the different conditions in the absence and presence of agonist (average of five sequential images recorded by live-cell confocal microscopy).

Translocation Experiments.

Translocation experiments were performed with an inverted microscope (IX71; Olympus, Hamburg, Germany) with a 100× oil immersion objective (UPlanSApo 100×/1.40 Oil; Olympus) equipped with a confocal fluorescence recovery after photobleaching imaging system (VT-HAWK; VisiTech International, Sunderland, UK) and the beam splitter 405/491/642 DC (VisiTech International). The samples were illuminated with 405 nm and 491 nm lasers (VisiTech International). An Optosplit II with T495lpxr, ET 470/40x and ET 535/30m (Chroma, Bellows Falls, USA) was used to split YFP and CFP emission on a CCD (charge-coupled device) camera (EM-CCD Digital Camera, Hamamatsu, Herrsching am Ammersee, Germany). Fluorescence recordings were processed using the software VoxCell Scan (VisiTech International). A pressurized perfusion system (Ala-VC3-8SP; ALA Scientific Instruments, Farmingdale, NY) was used to continuously superfuse the cells with buffer (137 mM NaCl, 5.4 mM KCl, 2 mM CaCl2, 1 mM MgCl2, 10 mM Hepes, pH 7.3) or agonist-containing buffer. For translocation experiments, GRK2-mTurq–transfected cells were excited at 405 nm, and mTurq emission was recorded at 2 Hz. Subsequently, YFP was directly excited at 491 nm, and YFP fluorescence recorded at 2 Hz to determine the relative expression level of M3-AChR and GRK2. To analyze membrane translocation of GRK2, two ROIs (region of interest) were defined: a polygonal ROI including the cell membrane and a rectangular ROI in the cytosol. Then the quotient of the fluorescence intensities (F(membrane)/F(cytosol)) was calculated. Δ(F(membrane)/F(cytosol)) of the individual recordings was averaged to compare translocation of the different GRK2 mutants.

Single-Cell FRET Imaging.

FRET experiments were performed on an inverted fluorescence microscope (Eclipse Ti; Nikon, Düsseldorf, Germany) as described in Milde et al. (2013). In some experiments, cells were not excited with the Lambda DG-4 (Sutter Instrument, Novato, CA) but with a light-emitting diode (LED) excitation system (pE-2; CoolLED, Andover, UK) containing LEDs emitting light at 425 and 500 nm, respectively. The intensity of both LEDs was set to 2%. All filters were unchanged. The recording interval is indicated in the figure legend of the respective experiment. Fluorescence data were corrected for background fluorescence, bleed-through, and false excitation, and the FRET ratio was determined as the quotient of the fluorescence intensities of YFP and CFP (FYFP/FCFP). The data shown in Fig. 6A and Supplemental Figs. 3 and 4A were additionally corrected for bleaching effects. Individual FRET recordings were averaged and displayed either as absolute alterations in FRET ratio or as data normalized to the individual maximal agonist-induced response to compare onset and offset kinetics of the agonist-induced effect. Absolute alterations in FRET were determined as the difference between the averaged FRET ratio of the last 10 time points before stimulation with and withdrawal of the agonist for each individual recording. Monoexponential onset and offset kinetics were fitted with an exponential function for each individual recording. The obtained k values were used for further statistics. Biexponential kinetics was analyzed with the mean traces of the different conditions.

Quantification of Relative Expression Levels.

Because of an influence on the extent of the FRET signal, the relative expression level of CFP and YFP was controlled. For calibration of the stoichiometry of the relative expression level, the construct YFP-β2-AR-CFP (Dorsch et al., 2009) and analogously cloned reference constructs with different fluorophores were used. Both fluorophores were excited individually, and fluorescence intensities were recorded and corrected for background fluorescence. The calibration factor was calculated as FCFP/FYFP. For each individual FRET recording, the factor FCFP/FYFP was calculated the same way. This factor was divided by the respective calibration factor to calculate the individual expression ratio.

For a reliable comparison of FRET signals, the relative expression ratio should not significantly differ between different conditions. An excess of the FRET acceptor YFP is advantageous, as an influence on the extent of the FRET signal is unlikely in that case.

Evaluation and Statistics.

Data evaluation was conducted with Excel 2010 (Microsoft, Redmond, WA) and Origin Pro 9.1 (OriginLab, Northampton, MA). Arithmetic mean and standard error were calculated where applicable. Statistics were analyzed by analysis of variance (ANOVA) with Bonferroni post-hoc test. P <0.05 were considered to represent significant differences between tested conditions.

Results

Interaction of GRK2 with M3-AChR.

To study dynamics of GRK2 interaction with M3-AChR, we set out to image FRET between mTurq-labeled M3-AChR and YFP-labeled GRK2. Functionality of a similarly C-terminally labeled M3-AChR was described previously (Ziegler et al., 2011). The C-terminally YFP-labeled GRK2 was functional, as it phosphorylated rhodopsin similarly to wild-type GRK2 (Supplemental Fig. 1). The fluorescently labeled constructs were transiently transfected in HEK293T cells and subjected to single-cell dual-emission FRET recording. mTurq was excited at 425 nm, and fluorescence of mTurq and YFP was recorded simultaneously, while cells were continuously superfused with buffer with or without agonist, allowing for determination of onset and offset kinetics as a function of agonist addition or withdrawal. Receptor stimulation with a saturating agonist concentration of ACh (10 µM) resulted in a reversible increase in YFP fluorescence (yellow trace) and a corresponding decrease in mTurq fluorescence (blue trace), reflecting the development of FRET due to the interaction between GRK2 and the M3-AChR (Fig. 1A). The emission ratio of both recordings was determined as Δ(FYFP/FCFP) and is referred to as FRET in the following paragraphs.

The kinase-deficient GRK2(K220R) (Kong et al., 1994), which was used to control for effects due to receptor phosphorylation by GRK2, was comparable to wild-type GRK2 in FRET change (Fig. 1B) and agonist-mediated membrane translocation (Fig. 1C). Therefore, a major influence of receptor phosphorylation on kinetics of GRK2–M3-AChR interactions can be excluded. To verify specificity of the agonist-dependent alteration of FRET, HEK293T cells were transfected with the same constructs, but additionally with unlabeled α2A-AR and Gαi1. GRK2 was recruited to the membrane after stimulation of α2A-AR with 100 µM norepinephrine (Fig. 1C). However, this membrane recruitment resulted in only a very minor development of “bystander” FRET between GRK2 and M3-AChR (Fig. 1B), thereby confirming high specificity of the GRK2–M3-AChR interaction.

Interaction of GRK2 with Gαq and Gβγ.

The Gαq-protein binding–attenuated GRK2 variant GRK2(D110A) and the Gβγ binding–attenuated GRK2(R587Q) were used to investigate the effect of Gαq and Gβγ binding by GRK2 on the GRK2–M3-AChR interaction. To determine the effectiveness of the inserted point mutations, FRET-based interaction assays between GRK2 and Gβγ or Gαq were established in HEK293T cells. M3-AChR stimulation with 10 µM ACh resulted in a reversible development of FRET that reflects Gβγ-GRK2 and Gαq-GRK2 interaction (Fig. 2, A and B). Between GRK2 and Gαi, only a minor rise in FRET was detectable, verifying specificity of the Gαq-GRK2 interaction (Supplemental Fig. 2A). GRK2(R587Q) showed a small FRET signal with Gβγ, and GRK2(D110A) showed a small FRET signal with Gαq, confirming that these mutants exhibit a substantially reduced affinity with respect to the binding of either Gβγ or Gαq, or both (Fig. 2, C and D; Supplemental Fig. 2, B and C). However, Gαq binding deficiency appeared not as potent as Gβγ binding deficiency.

Fig. 2.
Fig. 2.

Gαq binding by GRK2 is delayed compared with Gβγ binding. HEK293T cells transiently transfected with Gβ-Cer, GRK2-YFP, unlabeled M3-AChR, Gαq, and Gγ for the Gβγ-GRK2 interaction assay (A) and with Gαq-YFP, GRK2-mTurq, and unlabeled M3-AChR, Gβ, and Gγ for the Gαq-GRK2 interaction assay (B) were subjected to single-cell FRET imaging recorded at 2 Hz. M3-AChR stimulation with 10 µM ACh, as indicated, led to a development of FRET, reflecting the interaction of GRK2 with Gβ and Gαq, respectively [representative recordings in (A) and (B)]. Individual single-cell FRET recordings were averaged (mean ± S.E.M.; n ≥ 9) and displayed either as absolute alterations in FRET (C and D) or as data normalized to the individual maximal agonist-induced response to compare onset kinetics (E) and offset kinetics (F) of the agonist-induced effect. Statistics are given for analysis of absolute amplitudes or kinetics by ANOVA with Bonferroni post-hoc test (*P < 0.05).

Furthermore, the FRET signal between Gαq and GRK2(R587Q) was significantly diminished compared with wild-type GRK2, which confirms the importance of Gβγ for GRK2 translocation. However, Gαq alone recruited a substantial amount of this mutant to the membrane, which argues in favor of a contribution of Gαq to GRK2 recruitment.

Onset kinetics of the changes in FRET was evaluated by monoexponential fitting. The FRET signal between GRK2 and Gαq (half time [t1/2] = 3.34 seconds) developed about 3 times slower than between GRK2 and Gβγ (t1/2 = 0.95 seconds) (Fig. 2E). This suggests that membrane recruitment of GRK2 by Gαq is delayed compared with Gβγ.

Monoexponential fitting did not reveal significant differences in dissociation kinetics of Gβγ (t1/2 = 25.1 seconds) and Gαq (t1/2 = 27.1 seconds) from GRK2. However, the onset of Gαq dissociation was clearly delayed (Fig. 2F), which argues in favor of a higher binding affinity of GRK2 to Gαq than to Gβγ.

Dissociation of Gβγ was significantly accelerated with GRK2(D110A) (t1/2 = 16.3 seconds), which suggests that Gαq binding affects interaction stability of GRK2 with Gβγ.

Both Gαq and Gβγ Recruit GRK2 to the Membrane.

GRK2 membrane translocation was investigated by live-cell confocal microscopy with high temporal resolution. Representative examples demonstrated a clear agonist-dependent membrane targeting of GRK2, GRK2(D110A), and GRK2(R587Q) (Fig. 3A). In contrast, the double mutant was barely targeted to the membrane. Statistical evaluation confirmed these observations (Fig. 3B; Supplemental Fig. 2D), suggesting that Gαq as well as Gβγ can recruit GRK2 to the membrane.

Fig. 3.
Fig. 3.

Gβγ or Gαq binding is required for GRK2 membrane translocation. HEK293T cells transiently transfected with mTurq-labeled GRK2 mutants, M3-AChR–YFP, and unlabeled Gq-protein subunits were subjected to live-cell confocal microscopy recorded at 2 Hz. (A) Images of different GRK2 mutants in the absence and presence of agonist (average of five sequential images). (B) Individual recordings (mean ± S.E.M.; n ≥ 10) of GRK2 membrane translocation were evaluated and averaged as described in the Materials and Methods section. Δ(Fmembrane/Fcytosol), quotient of the fluorescence intensities in the membrane and the cytosol.

Effects of Gαq Binding on GRK2–M3-AChR Interaction.

Next we tested the contribution of Gβγ, Gαq, and both together in the interaction of GRK2 with M3-AChR by means of FRET. Only a minor rise in FRET between M3-AChR and GRK2 was observed with the Gβγ binding–attenuated GRK2(R587Q) and GRK2(D110A + R587Q), confirming the importance of Gβγ for GRK2 recruitment (Fig. 4A). However, the FRET development was significantly diminished with the Gαq binding–attenuated GRK2(D110A) as well, which supports our hypothesis that Gαq is significantly involved in membrane targeting of GRK2. In this context, it was very important to exclude that the reduction in the amplitude of the FRET signal was due to unfavorable relative expression levels of the fluorescent proteins. Therefore, relative expression levels of GRK2 and M3-AChR were determined for each individual recording as described in the Materials and Methods section (Fig. 4B). The results clearly showed that the observed differences in the amplitude of the FRET signal were not due to alterations in the relative expression levels of the fluorescent proteins.

Fig. 4.
Fig. 4.

Gαq improves the extent and stability of agonist-dependent interaction of GRK2 with M3-AChR. Individual single-cell FRET recordings were averaged (mean ± S.E.M.; n ≥ 12) and displayed either as absolute alterations in FRET (A) or as data normalized to the individual maximal agonist-induced response to compare onset kinetics (C) and offset kinetics (D) of the agonist-induced effect. The trace of wild-type (WT) GRK2 was already shown in Fig. 1B. Statistics are given for analysis of absolute amplitudes or kinetics by ANOVA with Bonferroni post-hoc test (*P < 0.05). (B) Relative expression levels of GRK2 mutants and M3-AChR in the assay shown in (A) were not significantly different between the conditions. (F) HEK293T cells transiently transfected analogously to (A), but without Gαq, Gβγ, or the whole heterotrimer were subjected to single-cell FRET imaging recorded at 2 Hz. Individual single-cell FRET recordings were averaged (mean ± S.E.M.; n ≥ 12) and displayed either as absolute alterations in FRET (E) or as data normalized to the individual maximal agonist-induced response to compare offset kinetics (F) of the agonist-induced effect.

We also compared onset kinetics and found no significant difference between wild-type GRK2 (t1/2 = 1.44 seconds) and GRK2(D110A), but significantly slowed onset kinetics with GRK2(R587Q) (t1/2 = 2.39 seconds) (Fig. 4C). As GRK2(R587Q), unlike the others, is recruited to the receptor primarily by Gαq, these slowed kinetics correspond with the results of the GRK2–G-protein interaction assay that already hint at a delayed membrane targeting of GRK2 by Gαq compared with Gβγ (Fig. 2E). Gβγ binding by GRK2(D110A) (t1/2 = 1.21 seconds) occurred shortly before M3-AChR interaction of this mutant (t1/2 = 1.76 seconds). Gαq binding by GRK2(R587Q) (t1/2 = 2.79 seconds) was not significantly different from its M3-AChR interaction (t1/2 = 2.39 seconds). These data suggest that GRK2 membrane translocation is the rate-limiting step for its receptor interaction.

Dissociation after withdrawal of the agonist proceeded with biphasic kinetics. An initial fast decline was followed by a slower phase that formed a major part (Fig. 4D). This indicates that the majority of GRK2 receptor complexes exhibited a prolonged interaction. GRK2(R587Q) showed a delayed dissociation, which was comparable to the delayed dissociation of Gαq from GRK2. This suggests that, in the absence of Gβγ binding, the dissociation of GRK2 from the receptor is mostly dependent on the dissociation from Gαq.

The role of Gαq in GRK2–M3-AChR interaction was further investigated in the same FRET assay without cotransfection of Gαq, Gβγ, or the whole heterotrimer. The reduced FRET signal without overexpressed Gq-proteins suggests that the endogenous G-proteins are not sufficient to effectively recruit the exogenous GRK2 to the exogenous receptors (Fig. 4E; Supplemental Fig. 2E). Also, with overexpressed Gαq or Gβγ, the development of FRET was diminished, which could argue that less functional Gq-proteins were formed. Dissociation of GRK2 was significantly accelerated without overexpressed Gαq, suggesting that Gαq binding to GRK2 prolongs interaction of GRK2 with M3-AChR (Fig. 4F).

Concentration-Response Curves.

To determine the sensitivity of the GRK2 interactions, we measured concentration-response curves for Gαq-GRK2, Gβγ-GRK2, and M3-AChR–GRK2 interactions under very similar conditions by utilizing the corresponding FRET assays (Fig. 5). Interestingly, the highest sensitivity was observed for the interaction between Gαq and GRK2, which exhibited a concentration-response curve that was significantly left-shifted compared with the Gβγ-GRK2 interaction. This argues in favor of a higher binding affinity between GRK2 and Gαq compared with GRK2 and Gβγ, which was already suggested by the GRK2–Gq-protein interaction assay (Fig. 2F). The concentration-response curve of the M3-AChR–GRK2 interaction was further right-shifted, which can be attributed to the requirement of an active conformation of the receptor. This is known as the spare receptor phenomenon and corresponds well with the concentration-response curve of M3-AChR activation (Ziegler et al., 2011).

Fig. 5.
Fig. 5.

Concentration-response curves of the different interaction assays. HEK293T cells transiently transfected as indicated in Figs. 1 and 2 were subjected to single-cell FRET imaging recorded at 2 Hz. The M3-AChR was stimulated with increasing ACh concentrations, and the agonist-mediated responses were normalized to the saturating ACh concentration (mean ± S.E.M.; n ≥ 9). Log(EC50) of the underlying individual experiments was determined, and statistical analysis was performed by ANOVA with Bonferroni post-hoc test (*P < 0.05). Compared with Gαq-GRK2 interaction [log(EC50) = −8.60 ± 0.07, EC50 = 2.52 nM ACh], the concentration-response curves of the Gβγ-GRK2 interaction [log (EC50) = −8.24 ± 0.08, EC50 = 5.82 nM ACh] and M3-AChR–GRK2 interaction [log (EC50) = −7.14 ± 0.09, EC50 = 71.9 nM ACh] were significantly right-shifted.

Functional Effects of Gαq Binding by GRK2.

To investigate, whether the effects of Gαq and Gβγ on GRK2 recruitment influence GRK2 function, we analyzed the interaction of arrestin3 with the M3-ACh receptor by measuring FRET between arrestin3-YFP and M3-AChR–mTurq. Arrestin binding to G-protein–coupled receptors requires both GRK-induced receptor phosphorylation (Lohse et al., 1990) and agonist binding to the receptor (Krasel et al., 2005). The latter study further describes that, upon agonist washout, the GRK2-induced receptor phosphorylation is more sustained than the arrestin binding to the receptor. For this reason, arrestin binds very rapidly to prephosphorylated receptors upon repeated stimulation. We confirmed this result with the M3-AChR and observed an accelerated arrestin recruitment during the second stimulation compared with the first stimulation (Supplemental Fig. 3). Accordingly, arrestin binding to the receptor reflects the GRK2-induced receptor phosphorylation, which demonstrates that real-time measurement of arrestin recruitment in response to agonist is a sensitive assay to study functionality of the different GRK2 mutants. Indeed, in the absence of overexpressed GRK2 or in the presence of the kinase-dead GRK2(K220R), the interaction of arrestin3 with the receptor was significantly reduced compared with wild-type GRK2 (Fig. 6A; Supplemental Fig. 4A). In these experiments, arrestin3 was always in excess of receptor (Supplemental Fig. 4B), and equal expression of the GRK2 mutants was verified by western blotting (Supplemental Fig. 4C). In the presence of the Gβγ binding–attenuated and the GRK2 double mutant, arrestin binding was reduced to levels observed in the absence of overexpressed GRK2. This demonstrates that, although the Gβγ binding–attenuated mutant is able to translocate to the membrane, binding of Gβγ by GRK2 is required for receptor phosphorylation. Importantly, the interaction between receptor and arrestin was significantly diminished in the presence of Gαq binding–attenuated GRK2 mutant as well, suggesting that binding of Gβγ and Gαq to GRK2 is required for full kinase function. Onset kinetics of the arrestin binding to the M3-AChR appeared faster in the presence of wild-type GRK2 compared with the GRK2 mutants, although a detailed analysis was precluded by the increased noise due to the much-reduced amplitude in the context of the mutants. In all conditions, we observed a fast initial rise in the FRET signal, which presumably can be attributed to arrestin binding to prephosphorylated receptors. However, in cases where no functional GRK2 was expressed, the signal decreased subsequently to various degrees, probably due to competition with either G-proteins or even GRKs. Offset kinetics after withdrawal of the agonist was not significantly different between the conditions (t1/2 = 2.82 seconds for GRK2), and was markedly faster than dissociation of GRK2 from the receptor.

Fig. 6.
Fig. 6.

Functional effects of Gq-protein binding to GRK2. (A) HEK293T cells transiently transfected with M3-AChR–mTurq, arrestin3-YFP, unlabeled Gαq, Gβ, Gγ, and the different GRK2 mutants were subjected to single-cell FRET imaging recorded at 5 Hz. Individual single-cell FRET recordings were corrected for bleaching, averaged (mean ± S.E.M.; n ≥ 13), and displayed as absolute agonist-induced alterations in FRET. Statistics are given for analysis of absolute amplitudes by ANOVA with Bonferroni post-hoc test (*P < 0.05). (B) HEK293T cells transiently transfected with M2-AChR–CFP, GRK2-YFP, or GRK2(D110A), unlabeled M3-AChR, Gαq, Gαo, Gβ, and Gγ were subjected to single-cell FRET imaging recorded at 2 Hz. Individual single-cell FRET recordings were averaged (mean ± S.E.M.; n ≥ 14) and displayed as absolute alterations in FRET. Statistics are given for analysis of absolute amplitudes or onset kinetics by ANOVA with Bonferroni post-hoc test (*P < 0.05).

Having demonstrated that Gαq binding to GRK2 contributes to functional GRK2–M3-ACh receptor interactions, we wondered whether it also affects interactions of GRK2 with Gi-protein–coupled receptors. We therefore studied the interaction of GRK2 with the Gi-protein–coupled M2-ACh receptor in the presence of the M3-ACh receptor and overexpressed Gq-proteins. We found no significant difference between the receptor interaction of wild-type GRK2 and the Gαq binding–attenuated GRK2 mutant, which suggests that Gαq does not contribute to an increased GRK2 binding to Gi-protein–coupled receptors (Fig. 6B; Supplemental Fig. 4D).

Discussion

In the present study, we investigated the contributions of Gαq and Gβγ to the agonist-dependent interaction of GRK2 with Gq-protein–coupled receptors and its function. For the first time, we were able to observe interactions between GRK2 and receptors or G-protein subunits in real time. Gαq contributed to GRK2 targeting to the membrane, enhanced the extent and stability of the interaction between GRK2 and the M3-AChR, and was important for maximal GRK2 function. These results were obtained from newly established FRET assays using GRK2 and GRK2 point mutants with impaired Gαq or Gβγ interaction. Single-cell FRET imaging allowed resolving association and dissociation kinetics in response to fast application or withdrawal of agonist. The loss of function of the Gαq or Gβγ binding–deficient GRK2 mutants used in this study was verified by FRET experiments (Fig. 2, C and D). Each of these mutants contains a point mutation which we consider unlikely to have a major effect on GRK2 interaction with the receptor, the respective unaffected G-protein subunit, or overall GRK2 folding. In addition, we controlled expression levels for each recording to ensure comparability of the FRET signals. Confocal imaging demonstrated that interaction of GRK2 with either Gαq or Gβγ was sufficient for membrane targeting upon receptor stimulation (Fig. 3). The role of Gβγ is more prominent, which was reflected in faster interaction of GRK2 with Gβγ than with Gαq (Fig. 2E), and in a higher extent of FRET between GRK2 and the receptor for the Gαq binding–attenuated GRK2 mutant than the Gβγ binding–attenuated mutant (Fig. 4A). However, Gαq binding to GRK2 significantly enhanced the extent and stability of the GRK2–M3-AChR interaction. This was shown by the reduced receptor interaction of the Gαq binding–attenuated GRK2 compared with wild-type GRK2 (Fig. 4A), and by the accelerated dissociation of GRK2 from M3-AChR after withdrawal of the agonist in the absence of Gαq (Fig. 4F). However, the Gαq binding–attenuated GRK2(D110A) did not dissociate faster from M3-AChR than wild-type GRK2 (Fig. 4D), which may be explained by the fact that this mutation only reduces the interaction between GRK2 and Gαq by about 70%. Furthermore, the affinity between GRK2 and Gαq seemed higher than between GRK2 and Gβγ. This was suggested by delayed dissociation of Gαq from GRK2 compared with Gβγ (Fig. 2F) and a significantly higher sensitivity of the GRK2-Gαq interaction to increasing agonist concentrations compared to the GRK2-Gβγ interaction (Fig. 5). This may suggest that the contribution of Gαq to GRK2 recruitment is higher at lower agonist concentrations. It has been previously shown that negatively charged phospholipids also play a role in the membrane targeting of GRK2 (Touhara, 1997). Most likely, these charged phospholipids will work in concert with G-protein subunits to recruit GRK2 to membranes and receptors. However, we did not address this issue in the present study. The phospholipid binding sites on GRK2 have been mapped and do not overlap with either the Gαq or the Gβγ binding site (Carman et al., 2000).

It has been shown previously that both agonist occupancy and receptor phosphorylation are necessary for arrestin binding to G-protein–coupled receptors (Krasel et al., 2005). Therefore, we used arrestin binding to the M3-AChR as a readout for receptor phosphorylation. Gβγ binding was absolutely required for GRK2 function (Fig. 6A), probably by placing GRK2 and the receptor in a favorable orientation as suggested by previous studies (Wu et al., 1998). In the absence of Gαq binding, some GRK2 activity was retained. However, efficient arrestin recruitment to the M3-AChR was observed only in the context of interactions of GRK2 with both Gαq and Gβγ. We therefore propose that simultaneous binding of GRK2 to Gβγ and Gαq (Tesmer et al., 2005) brings GRK2 to a position where it can optimally phosphorylate the sites on the M3-AChR that are required for arrestin binding. Accordingly, we hypothesize that, dependent on binding of Gαq or Gβγ or both, differential orientations or conformations of GRK2 in the receptor complex exist. In agreement with this hypothesis, we observed a delayed dissociation of the Gβγ binding–attenuated GRK2 mutant from the receptor upon agonist washout (Fig. 4D), which most likely was now dependent on the dissociation of Gαq from GRK2, which was similarly delayed (Fig. 2F).

Comparing the dynamics of GRK2 and arrestin3 interactions with M3-AChRs, we found that surprisingly, the dissociation of arrestin from the receptor was much faster than the dissociation of GRK2 (Figs. 4A and 6A). It is generally assumed that receptor phosphorylation does not affect receptor–G-protein coupling, and that receptor desensitization occurs only after binding of arrestins to the receptor (Lohse et al., 1992). However, the prolonged interaction of GRK2 with the M3-AChR that we observed suggests that, at least for this receptor, G-protein–mediated signaling could already be inhibited by GRK2 binding. Hence, GRK2 presumably contributes to the phosphorylation-independent desensitization of receptor signaling that was previously attributed to the sequestration of Gαq and Gβγ by GRK2 (Luo et al., 2008).

Taken together, we could visualize interactions of GRK2 with Gq-protein subunits and receptors in single cells and resolve detailed kinetics. Our results uncovered that Gαq binding to GRK2 enhances the recruitment of GRK2 to M3-ACh receptors. Gαq significantly prolongs the interaction of GRK2 with M3-AChR, leading to longer occupancy times of receptors, and improves GRK2 function, which likely contributes to altered signaling and desensitization of receptors.

Authorship Contributions

Participated in research design: Wolters, Krasel, Brockmann, Bünemann.

Conducted experiments: Wolters, Brockmann.

Performed data analysis: Wolters, Brockmann, Bünemann.

Wrote or contributed to the writing of the manuscript: Wolters, Krasel, Bünemann.

Footnotes

Abbreviations

ANOVA
analysis of variance
α2A-AR
α2A-adrenergic receptor
ACh
acetylcholine
AChR
acetylcholine receptor
CFP
cyan fluorescent protein
FRET
Förster resonance energy transfer
FYFP/FCFP
FRET ratio
GRK
G-protein–coupled receptor kinase
HEK
human embryonic kidney
LED
light-emitting diode
M3-AChR
M3-ACh receptor
mTurq
mTurquoise fluorescent protein
RGS
regulator of G-protein signaling
ROI
region of interest
t1/2
half time
YFP
yellow fluorescent protein

References

  1. ↵
    1. Bünemann M,
    2. Frank M, and
    3. Lohse MJ
    (2003) Gi protein activation in intact cells involves subunit rearrangement rather than dissociation. Proc Natl Acad Sci USA 100:16077–16082.
    OpenUrlAbstract/FREE Full Text
  2. ↵
    1. Carman CV,
    2. Barak LS,
    3. Chen C,
    4. Liu-Chen LY,
    5. Onorato JJ,
    6. Kennedy SP,
    7. Caron MG, and
    8. Benovic JL
    (2000) Mutational analysis of Gbetagamma and phospholipid interaction with G protein-coupled receptor kinase 2. J Biol Chem 275:10443–10452.
    OpenUrlAbstract/FREE Full Text
  3. ↵
    1. Carman CV,
    2. Parent JL,
    3. Day PW,
    4. Pronin AN,
    5. Sternweis PM,
    6. Wedegaertner PB,
    7. Gilman AG,
    8. Benovic JL, and
    9. Kozasa T
    (1999) Selective regulation of Galpha(q/11) by an RGS domain in the G protein-coupled receptor kinase, GRK2. J Biol Chem 274:34483–34492.
    OpenUrlAbstract/FREE Full Text
  4. ↵
    1. Dorsch S,
    2. Klotz KN,
    3. Engelhardt S,
    4. Lohse MJ, and
    5. Bünemann M
    (2009) Analysis of receptor oligomerization by FRAP microscopy. Nat Methods 6:225–230.
    OpenUrlCrossRefPubMed
  5. ↵
    1. Fernandez N,
    2. Gottardo FL,
    3. Alonso MN,
    4. Monczor F,
    5. Shayo C, and
    6. Davio C
    (2011) Roles of phosphorylation-dependent and -independent mechanisms in the regulation of histamine H2 receptor by G protein-coupled receptor kinase 2. J Biol Chem 286:28697–28706.
    OpenUrlAbstract/FREE Full Text
  6. ↵
    1. Ford CE,
    2. Skiba NP,
    3. Bae H,
    4. Daaka Y,
    5. Reuveny E,
    6. Shekter LR,
    7. Rosal R,
    8. Weng G,
    9. Yang CS,
    10. Iyengar R,
    11. et al.
    (1998) Molecular basis for interactions of G protein betagamma subunits with effectors. Science 280:1271–1274.
    OpenUrlAbstract/FREE Full Text
  7. ↵
    1. Frank M,
    2. Thümer L,
    3. Lohse MJ, and
    4. Bünemann M
    (2005) G Protein activation without subunit dissociation depends on a Gα(i)-specific region. J Biol Chem 280:24584–24590.
    OpenUrlAbstract/FREE Full Text
  8. ↵
    1. Hata JA and
    2. Koch WJ
    (2003) Phosphorylation of G protein-coupled receptors: GPCR kinases in heart disease. Mol Interv 3:264–272.
    OpenUrlCrossRefPubMed
  9. ↵
    1. Hoffmann C,
    2. Nuber S,
    3. Zabel U,
    4. Ziegler N,
    5. Winkler C,
    6. Hein P,
    7. Berlot CH,
    8. Bünemann M, and
    9. Lohse MJ
    (2012) Comparison of the activation kinetics of the M3 acetylcholine receptor and a constitutively active mutant receptor in living cells. Mol Pharmacol 82:236–245.
    OpenUrlAbstract/FREE Full Text
  10. ↵
    1. Hughes TE,
    2. Zhang H,
    3. Logothetis DE, and
    4. Berlot CH
    (2001) Visualization of a functional Galpha q-green fluorescent protein fusion in living cells. Association with the plasma membrane is disrupted by mutational activation and by elimination of palmitoylation sites, but not be activation mediated by receptors or AlF4-. J Biol Chem 276:4227–4235.
    OpenUrlAbstract/FREE Full Text
  11. ↵
    1. Kong G,
    2. Penn R, and
    3. Benovic JL
    (1994) A β-adrenergic receptor kinase dominant negative mutant attenuates desensitization of the β 2-adrenergic receptor. J Biol Chem 269:13084–13087.
    OpenUrlAbstract/FREE Full Text
  12. ↵
    1. Krasel C,
    2. Bünemann M,
    3. Lorenz K, and
    4. Lohse MJ
    (2005) β-arrestin binding to the β2-adrenergic receptor requires both receptor phosphorylation and receptor activation. J Biol Chem 280:9528–9535.
    OpenUrlAbstract/FREE Full Text
  13. ↵
    1. Krupnick JG and
    2. Benovic JL
    (1998) The role of receptor kinases and arrestins in G protein-coupled receptor regulation. Annu Rev Pharmacol Toxicol 38:289–319.
    OpenUrlCrossRefPubMed
  14. ↵
    1. Lohse MJ,
    2. Andexinger S,
    3. Pitcher J,
    4. Trukawinski S,
    5. Codina J,
    6. Faure JP,
    7. Caron MG, and
    8. Lefkowitz RJ
    (1992) Receptor-specific desensitization with purified proteins. Kinase dependence and receptor specificity of β-arrestin and arrestin in the β 2-adrenergic receptor and rhodopsin systems. J Biol Chem 267:8558–8564.
    OpenUrlAbstract/FREE Full Text
  15. ↵
    1. Lohse MJ,
    2. Benovic JL,
    3. Codina J,
    4. Caron MG, and
    5. Lefkowitz RJ
    (1990) β-Arrestin: a protein that regulates β-adrenergic receptor function. Science 248:1547–1550.
    OpenUrlAbstract/FREE Full Text
  16. ↵
    1. Luo J,
    2. Busillo JM, and
    3. Benovic JL
    (2008) M3 muscarinic acetylcholine receptor-mediated signaling is regulated by distinct mechanisms. Mol Pharmacol 74:338–347.
    OpenUrlAbstract/FREE Full Text
  17. ↵
    1. Milde M,
    2. Rinne A,
    3. Wunder F,
    4. Engelhardt S, and
    5. Bünemann M
    (2013) Dynamics of Gαi1 interaction with type 5 adenylate cyclase reveal the molecular basis for high sensitivity of Gi-mediated inhibition of cAMP production. Biochem J 454:515–523.
    OpenUrlAbstract/FREE Full Text
  18. ↵
    1. Pitcher JA,
    2. Freedman NJ, and
    3. Lefkowitz RJ
    (1998) G protein-coupled receptor kinases. Annu Rev Biochem 67:653–692.
    OpenUrlCrossRefPubMed
  19. ↵
    1. Pitcher JA,
    2. Inglese J,
    3. Higgins JB,
    4. Arriza JL,
    5. Casey PJ,
    6. Kim C,
    7. Benovic JL,
    8. Kwatra MM,
    9. Caron MG, and
    10. Lefkowitz RJ
    (1992) Role of β γ subunits of G proteins in targeting the β-adrenergic receptor kinase to membrane-bound receptors. Science 257:1264–1267.
    OpenUrlAbstract/FREE Full Text
  20. ↵
    1. Raveh A,
    2. Cooper A,
    3. Guy-David L, and
    4. Reuveny E
    (2010) Nonenzymatic rapid control of GIRK channel function by a G protein-coupled receptor kinase. Cell 143:750–760.
    OpenUrlCrossRefPubMed
  21. ↵
    1. Sallese M,
    2. Mariggiò S,
    3. D’Urbano E,
    4. Iacovelli L, and
    5. De Blasi A
    (2000) Selective regulation of Gq signaling by G protein-coupled receptor kinase 2: direct interaction of kinase N terminus with activated galphaq. Mol Pharmacol 57:826–831.
    OpenUrlAbstract/FREE Full Text
  22. ↵
    1. Sterne-Marr R,
    2. Tesmer JJG,
    3. Day PW,
    4. Stracquatanio RP,
    5. Cilente JAE,
    6. O’Connor KE,
    7. Pronin AN,
    8. Benovic JL, and
    9. Wedegaertner PB
    (2003) G protein-coupled receptor Kinase 2/G α q/11 interaction. A novel surface on a regulator of G protein signaling homology domain for binding G α subunits. J Biol Chem 278:6050–6058.
    OpenUrlAbstract/FREE Full Text
  23. ↵
    1. Tesmer VM,
    2. Kawano T,
    3. Shankaranarayanan A,
    4. Kozasa T, and
    5. Tesmer JJG
    (2005) Snapshot of activated G proteins at the membrane: the Galphaq-GRK2-Gbetagamma complex. Science 310:1686–1690.
    OpenUrlAbstract/FREE Full Text
  24. ↵
    1. Touhara K
    (1997) Binding of multiple ligands to pleckstrin homology domain regulates membrane translocation and enzyme activity of β-adrenergic receptor kinase. FEBS Lett 417:243–248.
    OpenUrlCrossRefPubMed
  25. ↵
    1. Touhara K,
    2. Koch WJ,
    3. Hawes BE, and
    4. Lefkowitz RJ
    (1995) Mutational analysis of the pleckstrin homology domain of the β-adrenergic receptor kinase. Differential effects on G β γ and phosphatidylinositol 4,5-bisphosphate binding. J Biol Chem 270:17000–17005.
    OpenUrlAbstract/FREE Full Text
  26. ↵
    1. Ungerer M,
    2. Böhm M,
    3. Elce JS,
    4. Erdmann E, and
    5. Lohse MJ
    (1993) Altered expression of β-adrenergic receptor kinase and β 1-adrenergic receptors in the failing human heart. Circulation 87:454–463.
    OpenUrlAbstract/FREE Full Text
  27. ↵
    1. Winstel R,
    2. Freund S,
    3. Krasel C,
    4. Hoppe E, and
    5. Lohse MJ
    (1996) Protein kinase cross-talk: membrane targeting of the β-adrenergic receptor kinase by protein kinase C. Proc Natl Acad Sci USA 93:2105–2109.
    OpenUrlAbstract/FREE Full Text
  28. ↵
    1. Wise A,
    2. Watson-Koken MA,
    3. Rees S,
    4. Lee M, and
    5. Milligan G
    (1997) Interactions of the α2A-adrenoceptor with multiple Gi-family G-proteins: studies with pertussis toxin-resistant G-protein mutants. Biochem J 321:721–728.
    OpenUrlAbstract/FREE Full Text
  29. ↵
    1. Wu G,
    2. Benovic JL,
    3. Hildebrandt JD, and
    4. Lanier SM
    (1998) Receptor docking sites for G-protein betagamma subunits. Implications for signal regulation. J Biol Chem 273:7197–7200.
    OpenUrlAbstract/FREE Full Text
  30. ↵
    1. Zhong H and
    2. Neubig RR
    (2001) Regulator of G protein signaling proteins: novel multifunctional drug targets. J Pharmacol Exp Ther 297:837–845.
    OpenUrlAbstract/FREE Full Text
  31. ↵
    1. Ziegler N,
    2. Bätz J,
    3. Zabel U,
    4. Lohse MJ, and
    5. Hoffmann C
    (2011) FRET-based sensors for the human M1-, M3-, and M5-acetylcholine receptors. Bioorg Med Chem 19:1048–1054.
    OpenUrlCrossRefPubMed
Back to top

In this issue

Download PDF
Article Alerts
Email Article
Citation Tools

Research ArticleArticle

Gαq Effects on M3-ACh Receptor–GRK2 Interaction

Valerie Wolters, Cornelius Krasel, Jörg Brockmann and Moritz Bünemann
Molecular Pharmacology January 1, 2015, 87 (1) 9-17; DOI: https://doi.org/10.1124/mol.114.094722
Reddit logo Twitter logo Facebook logo Mendeley logo

Jump to section

Advertisement