Advertisement
Research ArticleArticle

Modulation of Peroxisome Proliferator-Activated Receptor-α Activity by Bile Acids Causes Circadian Changes in the Intestinal Expression of Octn1/Slc22a4 in Mice

Erika Wada, Satoru Koyanagi, Naoki Kusunose, Takahiro Akamine, Hiroaki Masui, Hana Hashimoto, Naoya Matsunaga and Shigehiro Ohdo
Molecular Pharmacology February 2015, 87 (2) 314-322; DOI: https://doi.org/10.1124/mol.114.094979

Abstract

In addition to their digestive actions, bile acids modulate gene expression by altering the activity of peroxisome proliferator-activated receptor-α (PPARα). The modulatory effects of bile acids have been shown to affect the expression of genes responsible for lipid metabolism as well as membrane transporters. Bile acids are secreted in response to food intake and accumulate in intestinal epithelial cells. In the present study, we identified soluble carrier protein family 22 member 4 (Slc22a4), encoding organic cation transporter novel type-1 (Octn1), as a PPARα-regulated gene and its intestinal expression exhibited circadian oscillations in a bile acid–dependent manner. Nocturnally active mice mainly consumed their food around the early dark phase, during which bile acids accumulated in intestinal epithelial cells. PPARα activated the intestinal expression of Slc22a4 mRNA during the light period, and protein levels of Octn1 peaked before the start of the dark phase. The bile acids that accumulated in intestinal epithelial cells suppressed the PPARα-mediated transactivation of Slc22a4 in the dark phase. The time-dependent suppression of PPARα-mediated transactivation by bile acids regulated oscillations in the intestinal expression of Octn1/Slc22a4 during the daily feeding cycle. The results of a pharmacokinetic analysis also revealed that oscillations in the expression of Octn1 caused dosing time-dependent differences in the intestinal absorption of gabapentin (2-[1-(aminomethyl)cyclohexyl]acetic acid). These results suggest a molecular clock–independent mechanism by which bile acid–regulated PPARα activity governs the circadian expression of intestinal organic cation transporters. This mechanism could also account for interindividual variations in the pharmacokinetics of drugs that are substrates of Octn1.

Introduction

Daily variations in biologic functions are thought to affect the efficacy and/or toxicity of drugs; a large number of drugs cannot be expected to have the same potency at different administration time (Lévi, 1996; Hrushesky, 2001; Lis et al., 2003). Dosing time-dependent differences in the therapeutic effects of drugs have been, at least partly, attributed to circadian-related changes in drug disposition, for example, absorption, distribution, metabolism, and elimination (Ohdo, 2007). The small intestine is an important organ for the absorption of a drug after its oral administration, and various types of transporters are expressed on intestinal epithelial cells (Tsuji and Tamai, 1996; Bleasby et al., 2006; Stearns et al., 2008). Recent studies have reported that the mRNA levels of intestinal transporters exhibit 24-hour oscillations (Murakami et al., 2008; Stearns et al., 2008; Hamdan et al., 2012), which could account for dosing time-dependent changes in the absorption of drugs. However, a systematic analysis of the circadian regulation of intestinal transporters has not yet been conducted.

In mammals, 24-hour rhythms in various biologic processes are under the control of a molecular pacemaker consisting of circadian clock genes (Gekakis et al., 1998; Kume et al., 1999; Yoo et al., 2005). These gene products constitute an oscillatory mechanism that is based on self-sustained transcriptional/translational feedback loops (Gekakis et al., 1998; King et al., 1997). Clock was the first circadian clock gene to be identified in mammals. The Clock gene encodes the transcription factor, CLOCK protein, which dimerizes with BMAL to activate the transcription of Period (Per) and Cryptochrome (Cry) genes through E-box or E-box–like enhancer sequences (Gekakis et al., 1998; Preitner et al., 2002; Yoo et al., 2005). Once PER and CRY proteins have reached a critical concentration, they attenuate the transactivation of CLOCK/BMAL1, thereby generating circadian oscillations in their own transcription (Gekakis et al., 1998; Yoo et al., 2005). CLOCK/BMAL, PER, and CRY proteins also regulate the expression of the orphan nuclear receptor REV-ERBα, which, in turn, represses the transcription of Bmal (Preitner et al., 2002). This mechanism interconnects the positive and negative limbs of the circadian clockwork circuitry and also regulates 24-hour variations in output physiology through the periodic activation/repression of clock-controlled output genes (Jin et al., 1999; Maemura et al., 2000; Oishi et al., 2003). Proline- and acid-rich basic leucine zipper proteins, hepatic leukemia factor, thyrotroph embryonic factor, and D-site binding protein are examples of such output mediators because their expression is regulated by core oscillator components (Ripperger et al., 2000). The circadian-controlled output pathways include those that control the expression of many enzymes and regulators involved in xenobiotic detoxification, such as cytochrome P450 enzymes, carboxylesterases, and xenobiotic transporters (Gachon et al., 2006).

In addition to the intracellular molecular clock, circadian rhythms in cell physiology are also generated by extracellular factors (Balsalobre et al., 2000a,b; Terazono et al., 2003; Oishi et al., 2005). After the intake of food, bile acids are secreted into the lumen of the small intestine, in which they act not only as a digestive detergent of lipids but also as a modulator of gene expression in epithelial cells (Sinal et al., 2001). When food is plentiful, nocturnally active mice ingest most of their food during the dark phase (Ritskes-Hoitinga, 2004). In a recent study, we found that bile acids time-dependently accumulated in the intestinal epithelial cells of mice during their daily feeding cycle (Okamura et al., 2014). This time-dependent accumulation of bile acids generated circadian changes in the intestinal expression of peptide absorption transporter PepT1 through the periodic suppression of peroxisome proliferator-activated receptor-α (PPARα)–mediated transactivation (Okamura et al., 2014)

PPARα is a ligand-activated transcription factor that belongs to the nuclear-hormone receptor superfamily (Issemann and Green, 1990; Bookout et al., 2006). PPARα is highly expressed in the liver, heart, kidney, brown adipose tissue, muscle, and small intestine of mammals (Braissant et al., 1996). Numerous studies using PPARα-null mice have demonstrated that this nuclear receptor has critical roles in energy metabolism, hepatic steatosis, inflammation, cardiac pathophysiology, cell-cycle regulation, and oncogenesis (Lee et al., 2002; Lefebvre et al., 2006). In the present study, we screened PPARα-regulated genes whose intestinal expression was dependent on bile acids. DNA microarray analyses using RNA isolated from the intestinal epithelial cells of mice revealed that 58 genes were regulated by PPARα in a bile acid-dependent manner. Among these, the expression of the soluble carrier protein family 22 member 4 (Slc22a4) gene, encoding organic cation transporter novel type-1 (Octn1), exhibited significant circadian oscillations. Therefore, we focused on this gene to investigate how time-dependent oscillations in the intestinal expression of Octn1 affected the pharmacokinetics of its typical substrate.

Materials and Methods

Animals and Treatment.

Male PPARα-null mice (129S4-Svjae-PPARαmuGonzN12) with a JcI:ICR background and male wild-type mice of the same strain were housed in a temperature-controlled (24 ± 1°C) room under a 12-hour light/dark cycle. Under the light/dark cycle, zeitgeber time (ZT) 0 was designated as lights on and ZT12 as lights off. Mice were fed ad libitum at least 2 weeks before the experiments. Animals were treated in accordance with the guidelines stipulated by the Animal Care and Use Committee of Kyushu University. Gabapentin (2-[1-(aminomethyl)cyclohexyl]acetic acid; Tokyo Chemical Industry Co. Ltd., Tokyo, Japan) was dissolved in water and administered orally at 65 mg/kg body weight.

Microarray Analysis.

We performed oligonucleotide microarray analyses using RNA isolated from the intestinal epithelial cells of wild-type and PPARα-null mice to determine which PPARα-regulated genes were expressed in a bile acid-dependent manner. The proximal segments of the jejunum were isolated from mice at ZT12 when nocturnally active animals started daily feeding, and were then flushed with ice-cold saline. These segments were preincubated for 15 minutes at 37°C in Krebs-Ringer buffer (128.9 mM NaCl, 4.2 mM KCl, 1.5 mM CaCl2, 22.4 mM NaHCO3, 1.2 mM KH2PO4, 1.3 mM MgSO4, 10 mM d-glucose), and equilibrated with 95% O2 and 5% CO2. After the preincubation, cholic acid was added to the buffer to give a final concentration of 500 μM, and the segments were incubated at 37°C for 2 hours. The concentration of cholic acid is enough to suppress the expression of PPARα-target gene in small intestine of mice (Okamura et al., 2014). For vehicle control groups, dimethyl sulfoxide and ethanol were added to give final concentration of 0.05 and 0.25%, respectively.

After the incubation, total RNA (250 ng) was extracted from the epithelial cells of intestinal segments using RNAiso (Takara Bio, Otsu, Japan). The quality of the extracted RNA was analyzed using an Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA). The cRNA was amplified and labeled using a low-input quick amp labeling kit. Labeled cRNA was hybridized to a 44K Agilent 60-mer oligomicroarray (Whole Mouse Genome Microarray kit, version 2.0) according to the manufacturer’s instructions. All hybridized microarray slides were washed and scanned using an Agilent scanner.

Relative hybridization intensities and background hybridization values were calculated using Agilent Feature Extraction software (version 9.5.1.1). Raw signal intensities and flags for each probe were calculated from hybridization intensities and spot information according to the procedures recommended by Agilent. The raw signal intensities of two samples were log2-transformed and normalized by a quantile algorithm in the “preprocessCore” library package of the Bioconductor software. This produced a gene expression matrix consisting of 55,681 probe sets, and differentially expressed genes between samples were selected by calculating Z-scores and ratios (non–log scaled fold-change) as follows: for up-regulated genes a Z-score of 2.0 or more and a ratio of 2-fold or more, and for down-regulated genes a Z-score of −2.0 or less and a ratio of 0.5 or less. We used three criteria to identify putative bile acid-dependent PPARα-regulated genes: 1) wild-type (vehicle) > PPARα-null (vehicle); 2) wild-type (vehicle) > wild-type (cholic acid); and 3) PPARα-null (vehicle) = PPARα-null (cholic acid). Microarray data were submitted to the Gene Expression Omnibus at the National Center for Biotechnology Information (accession no. GSE55443).

RNA Extraction and Quantitative Real-Time Polymerase Chain Reaction Analysis.

RNA was extracted using RNAiso reagent (Takara Bio). The cDNA was synthesized using a ReverTra Ace real-time quantitative polymerase chain reaction kit (Toyobo, Osaka, Japan) and amplified by polymerase chain reaction (PCR). Real-time PCR analysis was performed on diluted cDNA samples using Thunderbird SYBR qPCR Mix (Toyobo) with the 7500 real-time PCR system (Applied Biosystems, Foster City, CA). Data were normalized using actin mRNA as a control because its intestinal expression was constant throughout the day. The sequences of mouse Slc22a4 primers were as follows: 5′-CCTGTTCTGTGTTCCCCTGT-3′ and 5′-GGTTATGGTGGCAATGTTCC-3′. The sequences of mouse Actin primers (internal control) were as follows: 5′-CACACCTTCTACAATGAGCTGC-3′ and 5′-CATGATCTGGGTCATCTTTTCA-3′. The sequences of human SLC22A4 primers were as follows: 5′-CCAGAAACCTTAGAGCAGATGCAGA-3′ and 5′-GTCAGTCCATTTCAGCGGGA-ACA-3′. The sequences of human ACTIN primers (internal control) were as follows: 5′-AGAGCTACGAGCTGCCTGAC-3′ and 5′- AGCACTGTGTTGGCGTACAG-3′.

Cells and Treatment.

Immortalized small intestine epithelial cells (aMoS7), established from adult murine intestinal crypts, were kindly provided by Dr. Totsuka (Tokyo University). The human colon carcinoma cell line Caco-2 was obtained from the American Type Culture Collection (Manassas, VA). These cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM; Sigma-Aldrich, St. Louis, MO) supplemented with 10% fetal bovine serum (FBS; Sigma-Aldrich), 25 U/ml of penicillin (GIBCO-BRL, Gaithersburg, MD), 25 μg/ml of streptomycin (GIBCO). For the luciferase reporter assay, aMoS7 were transfected with reporter and expression vectors encoding PPARα and its dimerization partner retinoid X receptor α (RXRα) using Lipofectamine-LTX reagent (Invitrogen/Life Technologies, Carlsbad, CA). Variations in transfection efficiency were corrected by cotransfecting cells with 0.5 ng of pGL4.74 [hRluc/TK] (Promega, Madison, WI). The total amount of DNA per well was adjusted by adding the pcDNA3.1 vector (Invitrogen).

To investigate the influence of PPARα and RXRα on the mRNA levels of Slc22a4, aMoS7 or Caco-2 cells were seeded on 24-well plates and then transfected with vectors encoding PPARα and RXRα as described earlier. Total RNA was extracted from cells 24 hours after transfection. To synchronize the circadian clocks in cultured aMoS7 cells, serum shock was performed as follows: cells were grown to semiconfluence in DMEM supplemented with 5% FBS. On the day of serum shock, 50% FBS was added for 2 hours, and cells were then incubated in DMEM supplemented with 1% FBS. Cells were harvested for RNA extraction at the indicated times after the serum treatment. We also treated aMoS7 cells with 500 μM cholic acid (Wako), the main composition of bile acids in mice (Okamura et al., 2014), for the indicated times.

Construction of Luciferase Reporter Vectors.

The 5′-flanking region of the mouse Slc22a4 gene (from −1064 bp to +33; +1 indicates the transcription start site) was amplified using Platinum PCR SuperMix High Fidelity (Invitrogen) using the forward primer 5′-CCCGGTTTGTGCAAAGTGTT-3′ and reverse primer 5′-CTTCCTAGGTGGCTGCGTG-3′. The PCR products were purified and ligated into pGL4.12 promoter vector (Promega). Two putative PPAR response elements (PPREs) on Slc22a4-Luc were mutated in combination with others, using a QuickChange Site-Directed mutagenesis kit (Stratagene, San Diego, CA). The changed sequences were as follows: base pairs (bp) of −847 to −835 were changed from TCCCTTCCTCCCT to TCCAGATCTTCCT, and base pairs of −653 to −640 were changed from AGGCCACAGGGAA to AGGCCTCGAGGAA.

Luciferase Reporter Assay.

At 24 hours after transfection of cells with reporters and expression constructs, cells were harvested, and the cell lysate was analyzed using a dual-luciferase reporter assay system (Promega). The ratio of firefly luciferase activity (expressed from reporter construct) to Renilla luciferase activity (expressed from pRL-TK) in each sample served as a measure of normalized luciferase activity.

Western Blotting.

Cell membrane fractions or nuclear extractions from epithelial cells of mouse small intestine were prepared at six time points as described previously elsewhere (Murakami et al., 2008). Then, 20 µg of total protein lysates was resolved by 8 or 10% SDS-PAGE, transferred to a polyvinylidene difluoride membrane, and probed with rat monoclonal antibodies against PPARα (Santa Cruz Biotechnology, Santa Cruz, CA), Octn1 (Alpha Diagnostic International, San Antonio, TX), or Actin (Santa Cruz Biotechnology). Specific antigen-antibody complexes were visualized using horseradish peroxidase-conjugated secondary antibodies and Chemi-Lumi One (Nacalai Tesque, Kyoto, Japan).

Down-Regulation of Octn1.

We designed small-interfering RNA (siRNA) for knockdown experiments using the BLOCK-iTTM RNAi Designer (https://rnaidesigner.invitrogen.com/rnaiexpress/). The target sequence of mouse Slc22a4 was as follows; GUUGGUACCGACACGUCUGACCUAA (GenBank accession no. NM_019687). The oligonucleotides were transfected into aMoS7 cells at a final concentration of 10, 50, or 100 pmol/well using Lipofectamine 2000 reagent (Invitrogen). The total amount of siRNA per well was adjusted by adding control siRNA. Down-regulation of Octn1 was confirmed by Western blotting.

Determination of Gabapentin Incorporation into aMoS7 Cells.

The aMoS7 cells were preincubated for 30 minutes at 37°C with 480 µl of Krebs-Ringer buffer and equilibrated with 95% O2, 5% CO2. After the preincubation, [3H]gabapentin (Muromachi Chemical, Tokyo, Japan) was added to the incubation medium to give a final concentration at 10 nM, and the cells were incubated for 30 minutes at 37°C. After the incubation, the cells were rinsed with ice-cold phosphate-buffered saline (PBS) twice. Thereafter, cells were homogenized in PBS. The radioactivity in each fraction was determined using a liquid scintillation counter after sufficient solubilization. The amounts of [3H]gabapentin incorporated into the aMoS7 cells were expressed as pmol/mg protein per minute.

Determination of Intestinal Accumulation of Gabapentin.

Proximal segments of the jejunum were isolated from wild-type mice at ZT2 and ZT14. The isolated intestinal segments were flushed with ice-cold saline and preincubated at 37°C for 20 minutes in Krebs-ringer buffer. After the preincubation, [3H]gabapentin was added to the incubation buffer at a final concentration of 5 μM, and the segments were incubated at 37°C for 30 minutes in the presence or absence of 10 mM TEA and 100 μM nonradiolabeled (cold) gabapentin. After the incubation, each segment was rinsed with ice-cold PBS 3 times and homogenized in 300 μl PBS. Radioactivity in the homogenate was determined using a liquid scintillation counter after sufficient solubilization. The intestinal accumulation of [3H]gabapentin was expressed as pmol/mg protein per minute.

Measurement of Gabapentin Concentrations in Serum.

Serum concentrations of gabapentin were measured by high performance liquid chromatography using DL-norvaline as an internal standard. Gabapentin and DL-norvaline were derivatized with o-phthaldialdehyde. The mobile phase of phosphate buffer (pH 3.0; 20 mM)–acetonitrile (4:3, v/v) was eluted at 1.0 ml/min through a 5C18-MS-II column (4.6 × 150 mm; Nacalai Tesque) using an LC-20AD pump (Shimadzu Corporation, Kyoto, Japan). The separated analyte was detected using the Spectrofluorometric Detector RF-550 (excitation and emission at 330 and 450 nm, respectively; Shimadzu). The total run time was 30 minutes, with DL-norvaline and gabapentin retention times of 7 and 15 minutes, respectively.

Pharmacokinetic Analysis.

Serum concentrations of gabapentin were analyzed using the nonlinear mixed effect model (NONMEM) program (ICON, Dublin, Ireland). NONMEM is a computer program designed to analyze pharmacokinetics in study populations by pooling data. Population pharmacokinetic parameters were calculated using 39 serum gabapentin concentrations obtained from 39 mice following the one-compartment model with first-order absorption (the PREDPP program, subroutines ADVAN2 and TRANS2). Bayesian estimates of individual pharmacokinetic parameters were obtained by the post hoc method of the NONMEM program. The improvement in fit obtained with the addition of a covariate was assessed by changes in the objective function (OBJ). At the assessing step, the OBJ values were compared between each model. A difference in −2 log likelihood difference was asymptotically distributed as chi-square with degrees of freedom equal to the number of parameters. A difference of 3.841 in the value of OBJ with freedom 1 was accepted as statistically significant (P < 0.05).

Statistical Analysis.

The significance of differences between groups was validated by the Bonferroni test for multiple comparisons. The 5% level of probability was considered to be significant for the Bonferroni test. Student’s t test was used for comparisons between two groups. The 1% level of probability was considered to be significant for the Student’s t test.

Results

Screening for PPARα-Regulated Genes Whose Expression Is Dependent on Bile Acids.

Bile acids repress PPARα-mediated expression of its target genes without changing the PPARα binding to the DNA response elements (Sinal et al., 2001). Because bile acids interfere with the recruitment of CBP/p300 to the PPARα/RXRα complexes, it is possible that the intestinal expression of a variety of PPARα-regulated genes is also modulated by bile acids. To screen PPARα-regulated genes whose intestinal expression is repressed by bile acids, we performed oligonucleotide microarray analyses using RNA isolated from the cholic acid-treated intestinal cells of wild-type or PPARα-null mice. Three criteria were used to select bile acid-dependent PPARα-regulated genes (see Materials and Methods). We identified 58 genes that were candidates for PPARα-regulated genes whose expression was suppressed by bile acids (Supplemental Table 1). They included seven genes that encoded lipid metabolism-related proteins. Known PPARα-target genes such as acyl CoA oxidase, fatty acid translocase (CD36), and apolipoprotein A-II were identified among the seven genes (Dreyer et al., 1992; Vu-Dac et al., 1995; Motojima et al., 1998).

On the other hand, 12 genes encoding plasma-membrane transporters were also screened as bile acid-dependent PPARα-regulated genes (Fig. 1A). Of these, the mouse Slc22a4 gene contained several PPREs in its promoter region (Fig. 1B). The results of luciferase reporter analysis revealed that the PPREs in the mouse Slc22a4 gene were responsible for the PPARα/RXRα-mediated transactivation (Fig. 1B). The mRNA levels of Slc22a4 in the cultured mouse intestinal cells, aMoS7, were significantly increased by the transfection of PPARα and RXRα (Fig. 1C, left).

Fig. 1.
Fig. 1.

Bile acids repress the PPARα/RXRα-induced expression of Slc22a4 in the intestinal epithelial cells. (A) The circle graph depicts the most highly represented categories of bile acid-dependent PPARα-regulated genes in the mouse intestinal epithelial cells. (B) Mutation of PPREs abrogates PPARα/RXRα-mediated transactivation of the mouse Slc22a4 gene. Luciferase activities of wild-type Slc22a4-Luc and PPRE-mutated Slc22a4-Luc (PPRE m1 and PPRE m2) were assessed by cotransfecting with expression vector encoding PPARα and RXRα. (C) Immortalized epithelial cells, aMoS7 (left) and Caco-2 (right) were transfected with both PPARα and RXRα expression vectors. At 24-hours after transfection, cholic acid (CA) was added into the media at final concentration of 100, 250, or 500 µM. The values shown are the mean ± S.E. of three samples. *P < 0.05, significantly different from control (pcDNA) group. #P < 0.05, significantly different from the PPARα- and RXRα-transfected cells without cholic acid treatment.

Consistent with studies showing bile acid represses PPARα activity, the PPARα/RXRα-induced expression of Slc22a4 was suppressed by the cholic acid treatment. A similar putative PPRE was also located in the promoter region of the human SLC22A4 gene. As shown in Fig. 1C (right panel), the repressing effect of cholic acid on the PPARα/RXRα-induced expression of SLC22A4 was observed in the human colon carcinoma cell line Caco-2, which is often used as an in vitro model of the intestinal system.

Bile Acid-Regulated PPARα Activity Is Responsible for the Time-Dependent Expression of Slc22a4 in Intestinal Epithelial Cells.

As reported previously by Ritskes-Hoitinga (2004), wild-type mice consumed ∼80% of their food during the dark phase when they were fed ad libitum (Fig. 2A). The amount of bile acids in the intestinal epithelial cells of wild-type mice exhibited obvious circadian oscillations, with higher levels being observed during the dark phase (Fig. 2B). PPARα-null also showed the obvious circadian accumulation of bile acids; however, no significant differences were observed in the temporal pattern of food intake and intestinal bile acid accumulation between PPARα-null and wild-type mice (Fig. 2, A and B). These results suggested that the secretory function of bile acids in response to food intake in PPARα-null mice may not be PPARα-dependent.

Fig. 2.
Fig. 2.

Circadian expression of Slc22a4 in the small intestinal of mice. (A) Temporal pattern of food intake by wild-type and PPARα-null mice. (B) Temporal accumulation profiles of bile acids in the intestinal cells of wild-type and PPARα-null mice. (C) Temporal expression profile of Slc22a4 mRNA in the small intestine of wild type and PPARα-null mice. (D) Temporal expression profiles of PPARα and Octn1 protein in the small intestine of wild-type and PPARα-null mice. For panels (A)–(C), the values shown are the mean ± S.E. of four to six mice for all panels *P < 0.05, significantly different from wild-type mice at the corresponding time point. For panel (D), the band intensity of protein was normalized to actin and converted to the ratio to maximal level of wild-type mice (set as 1.0). The values are plotted in the photographs of the immunoblot.

A significant circadian oscillation in Slc22a4 mRNA levels was observed in the small intestine of wild-type mice under the ad libitum feeding condition (P < 0.05, Fig. 2C); mRNA levels increased during the light phase and then decreased after the start of the dark phase. The oscillation in the expression of Slc22a4 mRNA was nearly the antiphase to that in bile acid accumulation. The expression of PPARα protein in the intestinal epithelial cells in wild-type mice was detected at all examined time points, although the protein levels were not obviously oscillated in a circadian time-dependent manner (Fig. 2D).

By contrast, the protein levels of Octn1 oscillated in a circadian time-dependent manner. They peaked before the start of the dark phase (Fig. 2D). The deletion of PPARα had a negligible effect on oscillations in bile acid accumulation in intestinal epithelial cells, but the amplitude of the rhythms in Slc22a4 mRNA and the Octn1 protein decreased in PPARα-null mice (Fig. 2, C and D). These results suggest that PPARα acts as a positive regulator of Slc22a4 expression in intestinal epithelial cells. The PPARα-mediated expression of Slc22a4 appeared to be repressed by bile acids during the dark phase.

Temporal Exposure of Intestinal Epithelial Cells to Bile Acids Causes an Oscillation in Slc22a4 mRNA Expression.

The oscillations observed in the intestinal accumulation of bile acids in wild-type mice were antiphase to the Slc22a4 mRNA rhythm. To investigate whether the cyclic exposure of intestinal epithelial cells to bile acids resulted in the generation of Slc22a4 mRNA oscillations, we examined the temporal expression profile of Slc22a4 mRNA in cultured intestinal epithelial cells during repetitive treatments with cholic acid. In this experiment, we also set comparative cells whose circadian clock was synchronized by a treatment with 50% serum (Balsalobre et al., 2000a). The exposure of aMoS7 to 50% serum for 2 hours resulted in the circadian expression of Per1 and Per2 (Fig. 3A, upper). The circadian expression of Per1 and Per2 persisted for up to 48 hours after the serum treatment.

Fig. 3.
Fig. 3.

Periodic stimulation with bile acid induce an oscillation in the expression of Slc22a4 in cultured aMoS7 cells. (A) Temporal mRNA expression profiles of Per1, Per2 (upper), and Slc22a4 (lower) in aMoS7 cells whose circadian clock was synchronized by the treatment with 50% serum for 2 hours. (B) Temporal mRNA expression profiles of Per1, Per2 (upper), and Slc22a4 (lower) in aMoS7 cells treated repetitively with 500 µM cholic acid (CA) for 4 hours. The values shown are the mean ± S.E. of four to five samples.

In contrast, Slc22a4 mRNA levels transiently increased after the serum treatment; however, a persistent circadian oscillation was not detected in mRNA expression levels (Fig. 3A, lower). The treatment of aMoS7 cells with 500 µM cholic acid for 4 hours caused a significant decrease in Slc22a4 mRNA levels (P < 0.05; Fig. 3B, lower), whereas mRNA levels gradually increased after the removal of cholic acid from the medium. The restored Slc22a4 mRNA levels were also suppressed by the treatment of cells with 500 µM cholic acid. However, the repetitive treatment of cells with cholic acid had a negligible effect on the expression of Per1 and Per2 (Fig. 3B, upper). These results further supported the notion that oscillations in the intestinal expression of Slc22a4 mRNA is dependent on the cyclic accumulation of bile acids.

Influence of Down-Regulation of Slc22a4 on the Uptake of Gabapentin into aMoS7 Cells.

A previous study demonstrated that genetic polymorphisms in the human SLC22A4 gene affected the pharmacokinetics of gabapentin (Urban et al., 2008). Consequently, gabapentin was considered to be an attractive candidate as a substrate for Octn1; however, there is no direct evidence for the contribution of Octn1 to the transport of gabapentin. Therefore, we investigated whether Octn1 mediated the incorporation of gabapentin into intestinal epithelial cells.

The treatment of aMoS7 cells with 500 µM cholic acid for 4 hours transiently decreased the protein levels of Octn1 (Fig. 4A). The incorporation of gabapentin into intestinal epithelial cells was decreased in parallel with Octn1 protein levels. Gabapentin incorporation was re-elevated according to an increase in Octn1 protein levels, implying that an abundance of Octn1 protein in the intestinal epithelial cells is correlated with its transport activity. The transfection of aMoS7 cells with siRNA against Slc22a4 reduced Octn1 protein levels (Fig. 4B). The transfection of siRNA dose-dependently decreased the incorporation of gabapentin into aMoS7 cells. These results indicated that Octn1 contributed to the incorporation of gabapentin into cultured mouse intestinal epithelial cells.

Fig. 4.
Fig. 4.

Down-regulation of Octn1 diminishes the uptake of gabapentin into aMoS7 cells. (A) Treatment of aMoS7 cells with 500 µM cholic acid (CA) for 4 hours transiently decreases the protein levels of Octn1 and gabapentin incorporation. Upper panels show immunoblots of Octn1 protein after cholic acid treatment. *P < 0.05, significantly different from basal levels (indicated as 0 h). (B) aMoS7 cells were transfected with control siRNA (indicated as 0) or specific siRNA against Slc22a4 gene (Slc22a4 siRNA). The protein levels of Octn1 and gabapentin incorporation were assessed at 48 hours after transfection. The values shown are the mean with S.E. of three to four samples. *P < 0.05, significantly different from control siRNA-transfected group (indicated as 0). The band intensity was plotted by normalizing to actin, and mean value of basal levels was set as 1.0. The values are plotted in the photographs of the immunoblot.

Influence of Dosing Times on Gabapentin Pharmacokinetics.

Because the intestinal expression of Octn1 oscillated in a time-dependent manner in wild-type mice (Fig. 2D), we determined whether this oscillation affected the pharmacokinetics of gabapentin. After incubation of jejunal segments with 5 μM [3H]gabapentin, accumulation of the radiolabeled compound in the epithelial cells showed a significant time-dependent variation (Fig. 5A). The amount of [3H]gabapentin incorporation was significantly higher at ZT14 than at ZT2 (P < 0.05). The intestinal accumulation of [3H]gabapentin was suppressed when the segments were incubated in the presence of 10 mM TEA, a typical substrate of Octn1 (Tamai et al., 2000), but the accumulation was still higher at ZT14 than at ZT2. Furthermore, the time-dependent difference in the intestinal accumulation of [3H]gabapentin was disappeared by incubating the segments with both 10 mM TEA and 100 μM nonradiolabeled (cold) gabapentin.

Fig. 5.
Fig. 5.

Dosing time-dependent change in the pharmacokinetics of gabapentin after oral administration. (A) Time-dependency of [3H]gabapentin accumulation in the small intestine of wild-type mice. The jejunal segments were incubated with 5 μM [3H]gabapentin in the presence or absence of 10 mM TEA and/or nonradiolabeled (cold) gabapentin. The values shown are the mean with S.E. of six mice. *P < 0.05 compared between the two groups. (B) Wild-type mice were orally administered with gabapentin (65 mg/kg) at ZT2 (○) or ZT14 (●). The values shown are the mean with S.E. of six mice. *P < 0.05 compared with the value for ZT2 administration.

Serum concentrations peaked 0.5 hour after the oral administration of gabapentin (65 mg/kg body weight) (Fig. 5B), while a significant dosing time-dependent difference was observed in the maximum serum concentrations (Cmax) of gabapentin (Fig. 5B). Serum gabapentin concentrations 0.5 hours after the drug injection at ZT14 were significantly higher than those after the injection at ZT2 (P < 0.05).

The pharmacokinetics of gabapentin were analyzed using 39 serum concentrations obtained from 39 mice. The final model derived from all data were as follows: CL/F (l/h per kg) = 2.22, Vd (l/kg) = 0.758, and ka (h−1) = 0.948 ☓ 2.05DT, where CL is the apparent clearance, Vd is the apparent volumes of distribution, and ka is the absorption rate constant. DT represented the dosing time: DT = 0 if the injection of the drug was at ZT2; DT = 1 if the injection of the drug was at ZT14.

Using population parameters, individual pharmacokinetic parameters were also calculated based on Bayesian estimates, and the area under the curve of the serum concentration-time curve and half-life (t1/2) were then derived from them (Table 1). The value of ka was significantly larger in mice administered gabapentin at ZT14 than at ZT2 (P < 0.01), whereas no significant dosing time-dependent difference was observed in the other pharmacokinetic parameters of gabapentin.

View this table:
TABLE 1

Influence of dosing times on pharmacokinetic parameters after the oral administration of gabapentin (65 mg/kg) at ZT2 or ZT14

Values are the mean ± S.E. of 39 mice. Statistically significant differences between the two groups were evaluated by the Student’s t test. The 1% level of probability was considered to be statistically significant.

Discussion

Circadian rhythms in various biologic processes are considered to be driven by an internal timekeeping system consisting of clock genes, whereas several rhythms observed in cell physiology are also generated by stimulations from extracellular signals. When food moves through the gastrointestinal tract, bile juices are secreted into the small intestine, in which they act not only as a digestive detergent of lipids but also as a modulator of gene expression in epithelial cells. Under the ad libitum feeding condition, nocturnally active mice ingested most of their food during the dark phase, during which bile acids accumulated in intestinal epithelial cells. The present study showed that the time-dependent accumulation of bile acids caused oscillations in the intestinal expression of Slc22a4/Octn1 through the periodic suppression of PPARα-mediated transactivation.

PPARα activates the transcription of its target genes by binding to PPREs. A computer-aided analysis of the mouse Slc22a4 promoter region identified several putative sequences resembling PPRE. In fact, the response elements located at base pairs from –847 to –835 and base pairs from –653 to –640 were responsible for the PPARα-mediated transactivation of the Slc22a4 gene. As PPARα was constantly expressed throughout the day in the epithelial cells of small intestine, bile acid-induced repression of Slc22a4 was unlikely associated with a decrease in the PPARα abundance. A previous study demonstrated that bile acids repressed the expression of PPARα-regulated genes by interfering with the recruitment of the cotranscriptional activator CBP/p300 (Sinal et al., 2001). The repressive action of bile acids may also be applicable to the PPARα-mediated transactivation of the Slc22a4 gene.

Circadian gene expression is caused not only by a cell-autonomous mechanism but also by time-dependent changes in extracellular stimuli (Terazono et al., 2003; Oishi et al., 2005). Such rhythmic expression of these genes is also observed in cultured cells after brief treatment with various compounds (Balsalobre et al., 2000a,b); therefore, the peripheral oscillator in cultured cells is used as an in vitro model for the circadian clock. Although treatment of aMoS7 cells with high concentration serum induced the oscillation in the mRNA expression of Per1 and Per2 with a period length of about 24 hours, no significant circadian expression of Slc22a4 mRNA was detected in the serum-treated cells. By contrast, the repetitive treatment of aMoS7 cells with cholic acid decreased and increased the mRNA levels of Slc22a4 without affecting the expression of Per1 and Per2. These findings suggest that oscillation in the intestinal expression of Slc22a4 is not driven by a cell-autonomous mechanism. The cyclic accumulation of bile acids in the intestinal epithelial cells appears to cause circadian expression of Slc22a4.

The expression of Octn1/Slc22a4 has not only been detected in the small intestine but also in the kidney and adipose tissues (Bleasby et al., 2006). Three types of Octn transporters have been identified in mice (Tamai et al., 1997, 2000; Wu et al., 1998). Both Octn1 and Octn2 transport carnitine and TEA, whereas Octn1 selectively transports TEA (Tamai et al., 2000). Genetic polymorphisms in the human SLC22A4 gene were found to be relevant to interindividual differences in the pharmacokinetics of gabapentin (Urban et al., 2008). Therefore, OCTN1 is considered to be responsible for the membrane transportation of gabapentin. However, direct evidence has not yet been produced to confirm whether the intestinal absorption of gabapentin is dependent on Octn1. As a result of experiments using cultured mouse intestinal epithelial cells, the protein levels of Octn1 were decreased and increased after transient treatment with cholic acid. The fluctuation of Octn1 was paralleled with that of gabapentin incorporation. Furthermore, incorporation of gabapentin into aMoS7 cells was also decreased by the down-regulation of Octn1. These findings suggest that the organic cation transporter is capable of incorporating gabapentin into mouse intestinal epithelial cells. The ability of Octn1 to transport gabapentin was also confirmed by the fact that accumulation of [3H]gabapentin into the intestinal segments was suppressed when segments were incubated with both gabapentin and typical Octn1’s substrate TEA. However, after incubating the segment with excessive amount of TEA, the intestinal accumulation of [3H]gabapentin was still higher at ZT14 than at ZT2, suggesting that a second transporter mediates uptake and that the activity of second transporter also oscillated in a circadian-dependent manner. In fact, that the time-dependent difference in the intestinal accumulation of [3H]gabapentin was disappeared by incubating the segments with both TEA and excessive amount of nonradiolabeled gabapentin. Another type of bile acid-dependent PPARα target transporter may also contribute to uptake of gabapentin into the intestinal epithelial cells.

Under the ad libitum feeding condition, Octn1 protein levels in the small intestines of mice were increased during the dark phase. Oscillations in the levels of the Octn1 protein were delayed by approximately 8 hours relative to its mRNA rhythm. This delay in the expression of Octn1 in the membrane fraction of intestinal epithelial cells may have been due to the kinetics of protein synthesis or membrane transportation. The maximum serum concentrations (Cmax) of gabapentin after the administration of the drug at the dark phase (ZT14) were significantly higher than those after the same injection at the light phase (ZT2). Higher concentrations of gabapentin coincided with increases in the intestinal expression of Octn1.

The contribution of Octn1 to dosing time-dependent changes in the absorption of gabapentin was also supported by the pharmacokinetic analysis using the NONMEM program. In this analysis, we determined the pharmacokinetic parameters following the one-compartment model with first-order absorption. The dosing time-dependent difference in the serum concentrations of gabapentin was attributed to circadian changes in the absorption rate constant (ka). These results indicate that circadian oscillations in the intestinal expression of Octn1 may have caused the time-dependent change in the absorption process of gabapentin. Only a few compounds have so far been identified as Octn1 substrates. An increase in the intestinal expression of Octn1 during the feeding time may also contribute to enhancements in the absorption of some nutrients.

The individualization of pharmacotherapy has mainly been achieved by monitoring drug concentrations. Consequently, dosage adjustments have been based on interindividual differences in drug pharmacokinetics; however, intraindividual and interindividual variabilities should be considered to further improve rational pharmacotherapy because the pharmacokinetics of many drugs also vary depending on circadian changes in each process including absorption, distribution, metabolism, and excretion (Ohdo, 2007). In the present study, we found a molecular clock-independent mechanism by which bile acid-regulated PPARα activity governed the circadian expression of Octn1/Slc22a4 in the small intestines of mice. A microarray analysis revealed that several types of PPARα target genes encoding membrane transporters were expressed in a bile acid-dependent manner. Consequently, the intestinal expression of these membrane transporters may also exhibit circadian oscillations that are driven by time-dependent interactions between bile acids and PPARα. Hereafter, we should systematize the circadian regulation mechanism underlying transporter functions, and make a strategic arrangement to predict the absorption of a drug after its oral administration.

Acknowledgments

The authors thank the Center of Advanced Instrumental Analysis, Kyushu University, for technical support in the measurement of platinum.

Authorship Contributions

Participated in research design: Wada, Koyanagi, Ohdo.

Conducted experiments: Wada, Koyanagi, Kusunose, Akamine.

Contributed new reagents or analytic tools: Wada, Matusnaga.

Performed data analysis: Wada, Koyanagi, Masui, Hashimoto.

Wrote or contributed to the writing of the manuscript: Wada, Koyanagi, Ohdo.

Footnotes

    • Received July 26, 2014.
    • Accepted November 24, 2014.

  • This work was supported by a Grant-in-Aid for Scientific Research on Innovative Areas [Grant 25136716] (to S.O.); a Grant-in-Aid for Scientific Research (A) [Grant 25253038] (to S.O.); and Grants-in-Aid for Challenging Exploratory Research [Grant 25670079] (to S.O.) and [Grant 26670317] (to S.K.) from the Japan for the Promotion of Science.

  • dx.doi.org/10.1124/mol.114.094979.

  • ↵Embedded ImageThis article has supplemental material available at molpharm.aspetjournals.org.

Abbreviations

DMEM
Dulbecco’s modified Eagle’s medium
FBS
fetal bovine serum
OBJ
objective function
PBS
phosphate-buffered saline
PCR
polymerase chain reaction
PPRE
PPAR response element
siRNA
small-interfering RNA
TEA
tetraethylammonium
ZT
zeitgeber time

References

  1. ↵
    1. Balsalobre A,
    2. Marcacci L, and
    3. Schibler U
    (2000a) Multiple signaling pathways elicit circadian gene expression in cultured Rat-1 fibroblasts. Curr Biol 10:1291–1294.
    OpenUrlCrossRefPubMed
  2. ↵
    1. Balsalobre A,
    2. Brown SA,
    3. Marcacci L,
    4. Tronche F,
    5. Kellendonk C,
    6. Reichardt HM,
    7. Schütz G, and
    8. Schibler U
    (2000b) Resetting of circadian time in peripheral tissues by glucocorticoid signaling. Science 289:2344–2347.
    OpenUrlAbstract/FREE Full Text
  3. ↵
    1. Bleasby K,
    2. Castle JC,
    3. Roberts CJ,
    4. Cheng C,
    5. Bailey WJ,
    6. Sina JF,
    7. Kulkarni AV,
    8. Hafey MJ,
    9. Evers R,
    10. Johnson JM,
    11. et al.
    (2006) Expression profiles of 50 xenobiotic transporter genes in humans and pre-clinical species: a resource for investigations into drug disposition. Xenobiotica 36:963–988.
    OpenUrlCrossRefPubMed
  4. ↵
    1. Bookout AL,
    2. Jeong Y,
    3. Downes M,
    4. Yu RT,
    5. Evans RM, and
    6. Mangelsdorf DJ
    (2006) Anatomical profiling of nuclear receptor expression reveals a hierarchical transcriptional network. Cell 126:789–799.
    OpenUrlCrossRefPubMed
  5. ↵
    1. Braissant O,
    2. Foufelle F,
    3. Scotto C,
    4. Dauça M, and
    5. Wahli W
    (1996) Differential expression of peroxisome proliferator-activated receptors (PPARs): tissue distribution of PPAR-alpha, -beta, and -gamma in the adult rat. Endocrinology 137:354–366.
    OpenUrlCrossRefPubMed
  6. ↵
    1. Dreyer C,
    2. Krey G,
    3. Keller H,
    4. Givel F,
    5. Helftenbein G, and
    6. Wahli W
    (1992) Control of the peroxisomal β-oxidation pathway by a novel family of nuclear hormone receptors. Cell 68:879–887.
    OpenUrlCrossRefPubMed
  7. ↵
    1. Gachon F,
    2. Olela FF,
    3. Schaad O,
    4. Descombes P, and
    5. Schibler U
    (2006) The circadian PAR-domain basic leucine zipper transcription factors DBP, TEF, and HLF modulate basal and inducible xenobiotic detoxification. Cell Metab 4:25–36.
    OpenUrlCrossRefPubMed
  8. ↵
    1. Gekakis N,
    2. Staknis D,
    3. Nguyen HB,
    4. Davis FC,
    5. Wilsbacher LD,
    6. King DP,
    7. Takahashi JS, and
    8. Weitz CJ
    (1998) Role of the CLOCK protein in the mammalian circadian mechanism. Science 280:1564–1569.
    OpenUrlAbstract/FREE Full Text
  9. ↵
    1. Hamdan AM,
    2. Koyanagi S,
    3. Wada E,
    4. Kusunose N,
    5. Murakami Y,
    6. Matsunaga N, and
    7. Ohdo S
    (2012) Intestinal expression of mouse Abcg2/breast cancer resistance protein (BCRP) gene is under control of circadian clock-activating transcription factor-4 pathway. J Biol Chem 287:17224–17231.
    OpenUrlAbstract/FREE Full Text
  10. ↵
    1. Hrushesky WJ
    (2001) Tumor chronobiology. J Control Release 74:27–30.
    OpenUrlCrossRefPubMed
  11. ↵
    1. Issemann I and
    2. Green S
    (1990) Activation of a member of the steroid hormone receptor superfamily by peroxisome proliferators. Nature 347:645–650.
    OpenUrlCrossRefPubMed
  12. ↵
    1. Jin X,
    2. Shearman LP,
    3. Weaver DR,
    4. Zylka MJ,
    5. de Vries GJ, and
    6. Reppert SM
    (1999) A molecular mechanism regulating rhythmic output from the suprachiasmatic circadian clock. Cell 96:57–68.
    OpenUrlCrossRefPubMed
  13. ↵
    1. King DP,
    2. Zhao Y,
    3. Sangoram AM,
    4. Wilsbacher LD,
    5. Tanaka M,
    6. Antoch MP,
    7. Steeves TD,
    8. Vitaterna MH,
    9. Kornhauser JM,
    10. Lowrey PL,
    11. et al.
    (1997) Positional cloning of the mouse circadian clock gene. Cell 89:641–653.
    OpenUrlCrossRefPubMed
  14. ↵
    1. Kume K,
    2. Zylka MJ,
    3. Sriram S,
    4. Shearman LP,
    5. Weaver DR,
    6. Jin X,
    7. Maywood ES,
    8. Hastings MH, and
    9. Reppert SM
    (1999) mCRY1 and mCRY2 are essential components of the negative limb of the circadian clock feedback loop. Cell 98:193–205.
    OpenUrlCrossRefPubMed
  15. ↵
    1. Lee Y,
    2. Yu X,
    3. Gonzales F,
    4. Mangelsdorf DJ,
    5. Wang MY,
    6. Richardson C,
    7. Witters LA, and
    8. Unger RH
    (2002) PPAR α is necessary for the lipopenic action of hyperleptinemia on white adipose and liver tissue. Proc Natl Acad Sci USA 99:11848–11853.
    OpenUrlAbstract/FREE Full Text
  16. ↵
    1. Lefebvre P,
    2. Chinetti G,
    3. Fruchart JC, and
    4. Staels B
    (2006) Sorting out the roles of PPAR α in energy metabolism and vascular homeostasis. J Clin Invest 116:571–580.
    OpenUrlCrossRefPubMed
  17. ↵
    1. Lévi F
    (1996) Chronopharmacologie et chronothérapie des cancers. Pathol Biol (Paris) 44:631–644.
    OpenUrlPubMed
  18. ↵
    1. Lis CG,
    2. Grutsch JF,
    3. Wood P,
    4. You M,
    5. Rich I, and
    6. Hrushesky WJ
    (2003) Circadian timing in cancer treatment: the biological foundation for an integrative approach. Integr Cancer Ther 2:105–111.
    OpenUrlAbstract/FREE Full Text
  19. ↵
    1. Maemura K,
    2. de la Monte SM,
    3. Chin MT,
    4. Layne MD,
    5. Hsieh CM,
    6. Yet SF,
    7. Perrella MA, and
    8. Lee ME
    (2000) CLIF, a novel cycle-like factor, regulates the circadian oscillation of plasminogen activator inhibitor-1 gene expression. J Biol Chem 275:36847–36851.
    OpenUrlAbstract/FREE Full Text
  20. ↵
    1. Motojima K,
    2. Passilly P,
    3. Peters JM,
    4. Gonzalez FJ, and
    5. Latruffe N
    (1998) Expression of putative fatty acid transporter genes are regulated by peroxisome proliferator-activated receptor α and γ activators in a tissue- and inducer-specific manner. J Biol Chem 273:16710–16714.
    OpenUrlAbstract/FREE Full Text
  21. ↵
    1. Murakami Y,
    2. Higashi Y,
    3. Matsunaga N,
    4. Koyanagi S, and
    5. Ohdo S
    (2008) Circadian clock-controlled intestinal expression of the multidrug-resistance gene mdr1a in mice. Gastroenterology 135:1636–1644, e3.
    OpenUrlCrossRefPubMed
  22. ↵
    1. Okamura A,
    2. Koyanagi S,
    3. Dilxiat A,
    4. Kusunose N,
    5. Matsunaga N,
    6. Shibata S, and
    7. Ohdo S
    (2014) Bile acid-regulated peroxisome proliferator-activated receptor-α (PPARα) activity underlies circadian expression of intestinal peptide absorption transporter PepT1/Slc15a1. J Biol Chem 289:25296–25305.
    OpenUrlAbstract/FREE Full Text
  23. ↵
    1. Ohdo S
    (2007) Chronopharmacology focused on biological clock. Drug Metab Pharmacokinet 22:3–14.
    OpenUrlCrossRefPubMed
  24. ↵
    1. Oishi K,
    2. Miyazaki K,
    3. Kadota K,
    4. Kikuno R,
    5. Nagase T,
    6. Atsumi G,
    7. Ohkura N,
    8. Azama T,
    9. Mesaki M,
    10. Yukimasa S,
    11. et al.
    (2003) Genome-wide expression analysis of mouse liver reveals CLOCK-regulated circadian output genes. J Biol Chem 278:41519–41527.
    OpenUrlAbstract/FREE Full Text
  25. ↵
    1. Oishi K,
    2. Amagai N,
    3. Shirai H,
    4. Kadota K,
    5. Ohkura N, and
    6. Ishida N
    (2005) Genome-wide expression analysis reveals 100 adrenal gland-dependent circadian genes in the mouse liver. DNA Res 12:191–202.
    OpenUrlAbstract/FREE Full Text
  26. ↵
    1. Preitner N,
    2. Damiola F,
    3. Lopez-Molina L,
    4. Zakany J,
    5. Duboule D,
    6. Albrecht U, and
    7. Schibler U
    (2002) The orphan nuclear receptor REV-ERBα controls circadian transcription within the positive limb of the mammalian circadian oscillator. Cell 110:251–260.
    OpenUrlCrossRefPubMed
  27. ↵
    1. Ripperger JA,
    2. Shearman LP,
    3. Reppert SM, and
    4. Schibler U
    (2000) CLOCK, an essential pacemaker component, controls expression of the circadian transcription factor DBP. Genes Dev 14:679–689.
    OpenUrlAbstract/FREE Full Text
  28. ↵
    1. Hedrich H
    1. Ritskes-Hoitinga M
    (2004) Nutrition of laboratory mice, in The Laboratory Mouse (Hedrich H, ed) pp 463–479, Elsevier Academic, London.
  29. ↵
    1. Sinal CJ,
    2. Yoon M, and
    3. Gonzalez FJ
    (2001) Antagonism of the actions of peroxisome proliferator-activated receptor-α by bile acids. J Biol Chem 276:47154–47162.
    OpenUrlAbstract/FREE Full Text
  30. ↵
    1. Stearns AT,
    2. Balakrishnan A,
    3. Rhoads DB,
    4. Ashley SW, and
    5. Tavakkolizadeh A
    (2008) Diurnal rhythmicity in the transcription of jejunal drug transporters. J Pharmacol Sci 108:144–148.
    OpenUrlCrossRef
  31. ↵
    1. Tamai I,
    2. Ohashi R,
    3. Nezu JI,
    4. Sai Y,
    5. Kobayashi D,
    6. Oku A,
    7. Shimane M, and
    8. Tsuji A
    (2000) Molecular and functional characterization of organic cation/carnitine transporter family in mice. J Biol Chem 275:40064–40072.
    OpenUrlAbstract/FREE Full Text
  32. ↵
    1. Tamai I,
    2. Yabuuchi H,
    3. Nezu J,
    4. Sai Y,
    5. Oku A,
    6. Shimane M, and
    7. Tsuji A
    (1997) Cloning and characterization of a novel human pH-dependent organic cation transporter, OCTN1. FEBS Lett 419:107–111.
    OpenUrlCrossRefPubMed
  33. ↵
    1. Terazono H,
    2. Mutoh T,
    3. Yamaguchi S,
    4. Kobayashi M,
    5. Akiyama M,
    6. Udo R,
    7. Ohdo S,
    8. Okamura H, and
    9. Shibata S
    (2003) Adrenergic regulation of clock gene expression in mouse liver. Proc Natl Acad Sci USA 100:6795–6800.
    OpenUrlAbstract/FREE Full Text
  34. ↵
    1. Tsuji A and
    2. Tamai I
    (1996) Carrier-mediated intestinal transport of drugs. Pharm Res 13:963–977.
    OpenUrlCrossRefPubMed
  35. ↵
    1. Urban TJ,
    2. Brown C,
    3. Castro RA,
    4. Shah N,
    5. Mercer R,
    6. Huang Y,
    7. Brett CM,
    8. Burchard EG, and
    9. Giacomini KM
    (2008) Effects of genetic variation in the novel organic cation transporter, OCTN1, on the renal clearance of gabapentin. Clin Pharmacol Ther 83:416–421.
    OpenUrlCrossRefPubMed
  36. ↵
    1. Vu-Dac N,
    2. Schoonjans K,
    3. Kosykh V,
    4. Dallongeville J,
    5. Fruchart JC,
    6. Staels B, and
    7. Auwerx J
    (1995) Fibrates increase human apolipoprotein A-II expression through activation of the peroxisome proliferator-activated receptor. J Clin Invest 96:741–750.
    OpenUrlCrossRefPubMed
  37. ↵
    1. Wu X,
    2. Prasad PD,
    3. Leibach FH, and
    4. Ganapathy V
    (1998) cDNA sequence, transport function, and genomic organization of human OCTN2, a new member of the organic cation transporter family. Biochem Biophys Res Commun 246:589–595.
    OpenUrlCrossRefPubMed
  38. ↵
    1. Yoo SH,
    2. Ko CH,
    3. Lowrey PL,
    4. Buhr ED,
    5. Song EJ,
    6. Chang S,
    7. Yoo OJ,
    8. Yamazaki S,
    9. Lee C, and
    10. Takahashi JS
    (2005) A noncanonical E-box enhancer drives mouse Period2 circadian oscillations in vivo. Proc Natl Acad Sci USA 102:2608–2613.
    OpenUrlAbstract/FREE Full Text
View Abstract
Back to top

In this issue

Download PDF
Article Alerts
Email Article
Citation Tools
Research ArticleArticle

Circadian Regulation of Intestinal Expression of Octn1/Slc22a4

Erika Wada, Satoru Koyanagi, Naoki Kusunose, Takahiro Akamine, Hiroaki Masui, Hana Hashimoto, Naoya Matsunaga and Shigehiro Ohdo
Molecular Pharmacology February 1, 2015, 87 (2) 314-322; DOI: https://doi.org/10.1124/mol.114.094979
del.icio.us logo Digg logo Reddit logo Twitter logo CiteULike logo Facebook logo Google logo Mendeley logo

Jump to section