Table 1

Primers

PrimerPrimer Sequence (5′ → 3′)
CYP2C9-65.815F AGGAAAAGCACAACCAACCA
CYP2C9-65.903R TCTCAGGGTTGTGCTTGTC
β-Actin-F GAGCTATGAGCTGCCTGACG
β-Actin-R CACTTGCGGTGCACGATG
2C9-212NheIF GCTAGCGAGTGGACAATGGAAC
2C9-1NcoIR CATGCCATGGTTGAAGCCTTCTC
2C9-2923F/NheIF GCTAGCCCATAGAATGTACAAC
2C9-2898fullF CTAGAATGAACCCTACATAAACTATGAGCTTTGGTTGAT
2C9-2898fullR CTAGAATGAACCAACATTGACGCATCATCATCAACCAAA
2C9-NR1F CTAGAATGAACCCTACATAAACTAT
2C9-NR1R CTAGATAGTTTATGTAGGGTTCATT
2C9-NR2F CTAGATGCGTCAATGTTGGTTCA
2C9-NR2R CTAGAATGAACCAACATTGACGC
2B6-NR1F CTAGACTGTACTTTCCTGACCCTG
2B6-NR1R CTAGCAGGGTCAGGAAAGTACAGT
QX-2C9-m1818F GTTATAAAACAAACTCTTCTCTGGTCTCAATCTAGTCAA
QX-2C9-m1818R TTGACTAGATTGAGACCAGAGAAGAGTTTGTTTTATAAC
QX-2C9-m2898F GTACAACACAAAGAAGGGACCCTACATAAACTATG
QX-2C9-m2898R CATAGTTTATGTAGGGTCCCTTCTTTGTGTTGTAC