Designation of primers for cloning of CYP2C cDNAs
Based on the cDNA sequences derived from the Celera Discovery System analysis, primer pairs were designed to amplify the coding regions of the three CYP2C cDNAs. The initiation codon ATG is in bold. Positions are relative to the ATG as +1.
| cDNA and Direction | Primer Sequence | Corresponding Position |
|---|---|---|
| CYP2C50 | ||
| Forward | GTCCGCATGGATCCAATC | −6 to +12 |
| Reverse | CTTATGAAATTATGAGCAGGC | +1577 to +1597 |
| CYP2C54 | ||
| Forward | CAATCTCCATGGATCCAA | −8 to +10 |
| Reverse | GGCAGTGTGTTCAGTATGG | +1541 to +1559 |
| CYP2C55 | ||
| Forward | GAGAAAGCTGCATGGATC | −11 to +7 |
| Reverse | GGATCTGCATGGTAACTCTG | +1635 to +1654 |