TABLE 2

pcDNA3.1(+) clones The parent plasmid contains a CMV promoter that yields robust expression of cloned sequences when transfected into mammalian cells. This plasmid is referred to in the text as “3.1”.

Name PCR/Mutagenesis Primers Amino Acids Restriction Sites
HA-CAR3 FP: GGAATTCGCCACCATGGC ATACCCATACGATGTTCCAGA TTACGCTATGGCCAGTAGGGA AGATGAGC N-terminal HA-Tag-1–353 EcoR1/Xba1
RP: BGH
CAR3-LBD FP: GATCGAATTCGCCACCAT GGTACTGTCGGCAGAAGCCC 80–352 EcoR1/Xba1
RP: BGH
CAR3-ΔAF2 FP: GATCGAATTCGTCATGGCCAGTAGGGAAGATGAG 1–345 EcoR1/Xba1
RP: GTCTAGACTACATCA TGGCAGACAGGCCCTG
RXRα FP: GATCGAATTCGCCGCCAT GGACACCAAACATTTCCTG 1–462 EcoR1/Xba1
RP: GATCTCTAGACTAAGTCATTT GGTGCGGCGC
RXRα-ΔAF1 FP: GGAATTCGCCACCATGGC CCACCCCTCAGGAAACATG 123–462 EcoR1/Xba1
RP: GATCTCTAGACTAAGTCATTT GGTGCGGCGC
RXRα- LBD FP: GGAATTCGCCGCCATGGG CATGAAGCGGGAAG 198–462 EcoR1/Xba1
RP: GATCTCTAGACTAAGTCATTT GGTGCGGCGC
RXRα-ΔAF2 FP: GATCGAATTCGCCGCCAT GGA CACCAAACATTTCCTG 1–449 EcoR1/Xba1
RP: GATCTCTAGATTAGGTGTCAA TGGGTGTGTCCC
RXRα-Y397A FP: GATCGAATTCGCCGCCAT GGACACCAAACATTTCCTG 1–462 EcoR1/Xba1
RP: GATCTCTAGACTAAGTCATTTGGTGCGGCGC
mtFP: GGAGAAGGTCGCTGCGTCCTTGGAGGCCTACTGCAAG
mtRP: CTTGCAGTAGGCCTCCAAGGACGCAGCGACCTTCTCC
  • FP, forward primer; RP, reverse primer.