TABLE 3

p3× FLAG-CMV10 (Sigma,) expression vectors The plasmid was designed with a fusion of three copies of a flu antigen (FLAG) epitope tag to the N terminus of a cloned sequence. Expression of the epitope tagged protein is by way of a CMV promoter. The 3× FLAG-BAP expression vector was supplied by Sigma.

Name Primers for PCR-based cloning Amino Acids Restriction Sites
CAR1 FP: GATCGAATTCTATGGCCAGTAGGGAAGATGAGC 1–348 EcoR1/Xba1
RP: BGH
CAR3 FP: GATCGAATTCTATGGCCAGTAGGGAAGATGAGC 1–353 EcoR1/Xba1
RP: BGH
  • FP, forward primer; RP, reverse primer.