TABLE 4

pM and pVP16 (BD Biosciences, Palo Alto, CA) clones In frame cloning of sequences into pM and VP16 generate fusion proteins of the GAL4-DNA binding domain and the viral protein 16 (VP16) activation domain, respectively. These plasmids were used in combinations to access interaction of proteins in mammalian cells. The multiple cloning sites of the plasmids are identical, therefore cloned sequences are interchangeable. The luciferase reporter employed in the mammalian 2-hybrid assays was pFR-Luc (Stratagene, La Jolla, CA).

Name Primers Amino Acids Restriction Sites
CAR1 FP: GATCGAATTCGTCATGGCCAGTAGGGAAGATGAG 1–348 EcoR1/Xba1
RP: BGH
CAR1-LBD FP: GATCGAATTCGCCACCAT GGTACTGTCGGCAGAAGCCC 80–348 EcoR1/Xba1
RP: BGH
CAR3- FP: GATCGAATTCGTCATGGCCAGTAGGGAAGATGAG 1–352 EcoR1/Xba1
RP: BGH
CAR1-LBD FP: GATCGAATTCGCCACCAT GGTACTGTCGGCAGAAGCCC 80–352 EcoR1/Xba1
RP: BGH
SRC-1 RID FP: GATCGAATTCCCTAGCAG ATTAAATATACAACCAG 570–780 EcoR1/Xba1
RP: GATCTCTAGATCACATCT GTTCTTTCTTTTCCACTT
RXRα FP: GATCGAATTCGCCGCCAT GGACACCAAACATTTCCTG 1–462 EcoR1/Xba1
RP: GATCTCTAGACTAAGTCATTT GGTGCGGCGC
RXRα-LBD FP: GGAATTCGCCGCCATGGG CATGAAGCGGGAAG 198–462 EcoR1/Xba1
RP: GATCTCTAGACTAAGTCATTT GGTGCGGCGC
  • FP, forward primer; RP, reverse primer.