TABLE 1

PCR primers and conditions for site-directed mutagenesis to create variants of ABCG2

Sites of mutagenesis are indicated by underlining. GC indicates the percentage of guanine and cytosine contents in the PCR primer set. Tm shows the melting temperature (Tm) for each PCR primer set.

Variant and Primers Primer Sequence (5′ → 3′) Primer Length GC Tm
bases % °C
V12M 33 39 55
    Forward CGAAGTTTTTATCCCAATGTCACAAGGAAACAC
    Reverse GTGTTTCCTTGTGACATTGGGATAAAAACTTCG
G51C 42 35 59
    Forward ATCGAGTAAAACTGAAGAGTTGCTTTCTACCTTGTAGAAAAC
    Reverse GTTTTCGACAAGGTAGAAAGCAACTCTTCAGTTTTACTCGAT
Q126stop 40 40 62
    Forward GTAATTCAGGTTACGTGGTATAAGATGATGTTGTGATGGG
    Reverse CCCATCACAACATCATCTTATACCACGTAACCTGAATTAC
Q141K 35 42 55
    Forward CGGTGAGAGAAAACTTAAAGTTCTCAGCAGCTCTT
    Reverse AAGAGCTGCTGAGAACTTTAAGTTTTCTCTCACCG
T153M 42 40 60
    Forward CGGCTTGCAACAACTATGATGAATCATGAAAAAAACGAACGG
    Reverse CCGTTCGTTTTTTTCATGATTCATCATAGTTGTTGCAAGCCG
Q166E 35 42 55
    Forward GGATTAACAGGGTCATTGAAGAGTTAGGTCTGGAT
    Reverse ATCCAGACCTAACTCTTCAATGACCCTGTTAATCC
I206L 36 44 59
    Forward CTTATCACTGATCCTTCCCTCTTGTTCTTGGATGAG
    Reverse CTCATCCAAGAACAAGAGGGAAGGATCAGTGATAAG
F208S 35 45 55
    Forward TGATCCTTCCATCTTGTCCTTGGATGAGCCTACAA
    Reverse TTGTAGGCTCATCCAAGGACAAGATGGAAGGATCA
S248P 35 40 55
    Forward TTCATCAGCCTCGATATCCCATCTTCAAGTTGTTT
    Reverse AAACAACTTGAAGATGGGATATCGAGGCTGATGAA
E334stop 35 31 55
    Forward TCATAGAAAAATTAGCGTAGATTTATGTCAACTCC
    Reverse GGAGTTGACATAAATCTACGCTAATTTTTCTATGA
F431L 28 60 62
    Forward AGCTGGGGTTCTCCTCTTCCTGACGACC
    Reverse GGTCGTCAGGAAGAGGAGAACCCCAGCT
S441N 34 47 59
    Forward AACCAGTGTTTCAGCAATGTTTCAGCCGTGGAAC
    Reverse GTTCCACGGCTGAAACATTGCTGAAACACTGGTT
F489L 46 34 62
    Forward GAGGATGTTACCAAGTATTATACTTACCTGTATAGTGTACTTCATG
    Reverse CATGAAGTACACTATACAGGTAAGTATAATACTTGGTAACATCCTC
F571I 36 47 61
    Forward GTCATGGCTTCAGTACATCAGCATTCCACGATATGG
    Reverse CCATATCGTGGAATGCTGATGTACTGAAGCCATGAC
N590Y 42 38 62
    Forward CATAATGAATTTTTGGGACAATACTTCTGCCCAGGACTCAAT
    Reverse ATTGAGTCCTGGGCAGAAGTATTGTCCCAAAAATTCATTATG
D620N 32 56 62
    Forward GGTAAAGCAGGGCATCAATCTCTCACCCTGGG
    Reverse CCCAGGGTGAGAGATTGATGCCCTGCTTTACC