TABLE 3

Primers used to construct plasmids for protein expression

Bold letters show the modified N-terminal sequence, and underline indicates the NdeI or XbaI restriction site for forward or reverse primers, respectively.

cDNA and Direction Sequence (5′ → 3′)
CYP2C20
Forward GGAATTCCATATGGCTCTGTTATTAGCAGTTTTTCTCTGTCTCTCCTTTGTGC
Reverse GCTCTAGACAGATGGGCTAGCATTCTTCA
CYP2C43/CYP2C75
Forward GGAATTCCATATGGCTCTGTTATTAGCAGTTTTTCTCTGTCTCTCCTGTTTGC
Reverse GCTCTAGACCAGACCATCTGCTCTTCTT
CYP2C76
Forward GGAATTCCATATGGCTCTGTTATTAGCAGTTTTTATTTGTCTTTCTTGTCTGAT
Reverse GCTCTAGACTAGCAGCCAGACACTTCA