TABLE 1

Nucleotide sequences of the primers used in real-time quantitative PCR

Transporter Forward Primer Reverse Primer
Oatp1a1 cagataaatggatttgccag gtcaacaaatagttacagag
Oatp1a4 atagcttcaggcgcatttac ttctccatcattctgcatcg
Oatp1b2 ttcaccacaacaatggccta ttttccccacagacaggttc
Mrp2 tctctggtttgcctgtta gcagaagacaatcaggttt
Mrp3 gctctcacaaggtggtacaa caggttgaaacaggcactca
Mrp4 gatcgcctacgtttctcagc ccggtctcctataaccgtca
Mdr1a tcattgcgatagctggag caaacttctgctcccgagtc
Mdr1b acctgctgttggcgtatttg ttcctccagactgctgttgc
Bcrp aaatggagcacctcaacctg cccatcacaacgtcatcttg
Bsep aaatcggatggtttgactgc tgacagcgagaatcaccaag
Mate1 aacaccatctcccagtttgc gccaaggataccactcagga
G3pdh tgcgacttcaacagcaactc cttgctcagtgtccttgctg