TABLE 1

Primers used in this study for promoter cloning, mutagenesis, real-time PCR, EMSAs, and ChIP assays

Bold characters represent the putative FOXA1 site in its wild-type or mutated type. Underlined are mutated bases within the FOXA1 site. The –155G/A SNP is italic.

PrimerNucleotide Sequence (5′→3′)
Site-directed mutagenesis
    2B17 −694/-2M “A”GCCTTGACTAGAGTAATTGTAAATATAAAAGAACACC
    2B17-FOXA1-MT1GACTAGAGTAATTGCCCCCCTAAAAGAACACC
    2B17-FOXA1-MT2GACTAGAGTAATTGCGCATATAAAAGAACACC
EMSA
    2B17-FOXA1-GTAATTGTGAATATAAAAGAACACCAAACACACTAA
    2B17-FOXA1-ATAATTGTAAATATAAAAGAACACCAAACACACTAA
    2B17-FOXA1-MT3TAATTGCGCACATAAAAGAACACCAAACACACTAA
Quantitative real-time PCR
    FOXA1-ForGAAGATGGAAGGGCATGAAACCA
    FOXA1-RevTGGCATAGGACATGTTGAAGGACG
    PSA-ForGACCCCAAAGAAACTTCAGTGTGTGG
    PSA-RevGGTAATGCACCACCTTGGTGTACAG
    GAPDH-ForGAAGGTGAAGGTCGGAGTC
    GAPDH-RevGAAGATGGTGATGGGATTTC
ChIP assay
    2B17-ForGCACCACGATATTAAAAAATGG
    2B17-RevATACTGTTAAGAACAGTGGCAG
  • For, forward; Rev, reverse.