TABLE 1

Sequences of oligonucleotides used for cloning, for mutagenesis, as EMSA probes, and in ChIP assays

Only the top strands are shown for oligonucleotides used in EMSA assays. Where applicable, restriction sites introduced are underlined and corresponding enzymes used are given in parentheses. Nucleotides mutated for experiments in figures 4 and 5 are shown in bold.

OligonucleotideSequence (5′→3′)Purpose
hOAT5 −764 forwardACGCGTGTTATTTCTTGCAACTGCATGTAAATCTATAATAAT (MluI)hOAT5 (−764/+187) cloning
hOAT5 + 187 reverseCTCGAGGAGGCACAATGGCTTTACGGAGA (XhoI)hOAT5 (−764/+187) cloning
hOAT5 −471 forwardACGCGTGAGCTGAACACTGCCTTTCTCTTCTATTT (MluI)hOAT5 (−471/+187) cloning
hOAT5 −265 forwardACGCGTAAACCCTGACTTTCTGCTCTTTTCATGG (MluI)hOAT5 (−265/+187) cloning
hOAT5 −41 forwardACGCGTGAAGTATCTCTATGAAATAATGATCTCTATGACTAC (MluI)hOAT5 (−41/+187) cloning
hOAT7 −848 forwardACGCGTGCTAAGTGGGATGTGTGAATAAAAATGGAGAGTTAC (MluI)hOAT7 (−848/+249) cloning
hOAT7 +249 reverseCTCGAGTAGAGGCAAAATGACTGTATCCAGAGAGG (XhoI)hOAT7 (−848/+249) cloning
hOAT7 −73 forwardACGCGTCAGAAAAGTGTAGACCAAAGTCCAGTG (MluI)hOAT7 (−73/+249) cloning
hOAT7 +16 forwardACGCGTCGACTGGGAGTATCTGAGC (MluI)hOAT7 (+16/+249) cloning
hHNF-1α forwardGAATTCGAGCCATGGTTTCTAAACTGAGCCAG (EcoRI)cloning hHNF-1α
hHNF-1α reverseGGATCCGTGGTTACTGGGAGGAAGAGG (BamHI)cloning hHNF-1α
hOAT5-HNF-1α mut1 (−173/−160)CCTAGAAATAACAACACTGTTCCCCCGATTTCTTTTAGCsite-directed mutagenesis
hOAT5-HNF-1α mut2 (−68/−56)GGAGAGAGTAAACCTTCCCACGGATTTTATTGTCAACAGCsite-directed mutagenesis
hOAT7-HNF-1α mut (−14/−2)GACATGAAAAAGTAGAATTTCCCACACATTTCATTGTAAACGACTGsite-directed mutagenesis
hOAT5 WT (−173/−160)AGCTATAACAACACTGTTTAACCGATTTCTTTTAEMSA
hOAT5 mut 1 (−173/−160)AGCTATAACAACACTGTTCCCCCGATTTCTTTTAEMSA
hOAT5 WT (−68/−56)AGCTAGAGAGTAAACCTTTAAACGGATTTTATTGEMSA
hOAT5 mut 2 (−68/−56)AGCTAGAGAGTAAACCTTCCCACGGATTTTATTGEMSA
hOAT7 WT (−14/−2)AGCTAAGTAGAATTTTAAACACATTTCATTGTAAACGACTGGGEMSA
hOAT7 mut (−14/−2)AGCTAAGTAGAATTTCCCACACATTTCATTGTAAACGACTGGGEMSA
HNF-1a consensusAGCTGGTTAATCATTAACGEMSA
hOAT5 −256 forwardAACCCTGACTTTCTGCTCTTTTCATGGAAChIP
hOAT5 −3 reverseCATAGAGATCATTATTTCATAGAGATACTTCTAGCChIP
hOAT5 intron forwardCCAGACAGATCTCAAACTCCTGACCChIP
hOAT5 intron reverseGAAATCCACTCTGATTTGCTTCTGTAACATGChIP
hOAT7 −120 forwardCCTGGAATGACCGCATACCATGTAGChIP
hOAT7 + 89 reverseCGTTTTGGGGTCAGATAGGTAGCCChIP
hOAT7 intron forwardGTATGTGACCTGGGTGTTTAGAATAACACChIP
hOAT7 intron reverseCAATGACAGGCTGAGCATCACTGACChIP
hOATP1B1 −132 forwardTGGCAACTGGAGTGAACTCTTAAAACTChIP
hOATP1B1 +169 reverseGGGCTCAGAATGTAAGCGTGTGGAChIP
hOATP1B1 intron forwardCCCTTCTCCAATTCAGAAAGTTGTCTGCCChIP
hOATP1B1 intron reverseAGGAGTGGGGTGCAGGACAGAATCChIP