TABLE 1

Primers used in this study for qPCR, promoter cloning and mutagenesis, and ChIP-qPCR

Primers
PCR for cloning
 2B7-1RATACGGTACCTGGTGCAATGCAATGCTTG
 2B7-240FGCTAGGTACCGCTGAAGGATAGCACTCATA
 2B7-283FGCATGGGTACCTTGCATAAGACAGATGGCAT
 2B7-1046FATAGACGCGTGACCTGAAGGAATACCTCAA
 2B7-2076FATGTACGCGTGCCGGTTTCTAAGGCATATA
 2B7-3026FATAGACGCGTTCAGCCTCCCACTTTGCAAT
 2B7-4026FATCAACGCGTAGTGATGCTTCAGGAAACTT
 2B7-4926FTACTACGCGTGAGCCCTGTAAACTCTTAAT
Mutagenesis
 2B7-MT1FGACACTCTTCTAAAATGCAGTGCATAAGACAGATG
 2B7-MT1RCATCTGTCTTATGCACTGCATTTTAGAAGAGTGTC
 2B7-MT2FCTAAAATATATTGCATGGATCAGATGGCATGTCCA
 2B7-MT2RTGGACATGCCATCTGATCCATGCAATATATTTTAG
 2B7-MT3FTTGCATAAGACAGATACAGTGTCCATACAAGATC
 2B7-MT3RGATCTTGTATGGACACTGTATCTGTCTTATGCAA
 2B7-MT4FATGTCCATACAAGATGGCAGATATTAGCTGAAGG
 2B7-MT4RCCTTCAGCTAATATCTGCCATCTTGTATGGACAT
 2B7-MT5FTACAAGATCCTTGATCGGTGCTGAAGGATAGCAC
 2B7-MT5RGTGCTATCCTTCAGCACCGATCAAGGATCTTGTA
qPCR
 CYP3A4FAGTATGGAAAAGTGTGGGGCT
 CYP3A4RTGGAGACAGCAATGATCGTAA
 p21FAGACTCTCAGGGTCGAAAAC
 p21RTAAGGCAGAAGATGTAGAGC
ChIP-qPCR
 2B7-7906/-7747FCCTTCCTTTGGATTTTGGCC
 2B7-7906/-7747RTGAATGACCTGGGGTGAATT
 2B7-355/-209FGTTTTGTGTCAAATGGACTGC
 2B7-355/-209RCCCTTTTATGTTTATGAGTGC
 2B7-3026/-2907FATAGACGCGTTCAGCCTCCCACTTTGCAAT
 2B7-3026/-2907RGCCACTCAGGCACGTGTAGA
 CYP3A4FTGGCAGAACTTGCCTTCAATT
 CYP3A4RTGCAGTTGGTGTTGTTCTGCA
  • +1, nucleotides of the primers are numbered from the UGT2B7 translation start site ATG codon with the A; F, forward; R, reverse; MT, mutation.