TABLE 1

Primer pairs for PCR-mediated amplification of prostanoid and CXCR4 receptors

Primer Forward (5′–3′)Primer Reverse (5′–3′)bp
mEP1AGCAGGAGCCAAGTTCCAGCATCCGCTAGGCTCAGGTTA106
mEP2TTATGACCATCACCTTCGCCTAAAAACCGAAGAGCTCGGA110
mEP3TGGATCCCTGGGTTTATCTGGGGAAACAGGTACTGCAATGA102
mEP4TCTCTGGTGGTGCTCATCTGTGCAAATCTGGGTTTCTGCT107
mIPGGGCACGAGAGGATGAAGTGATGGCCTGAGTGAAGCCT107
mDP1AAGGCTCCATAGTACGCACGCTCAGACTACAGGCACGGGT129
mHprt1TTTTCCAAATCCTCGGCATACTTCCTCCTCAGACCGCTTT146
hEP1GAGAGCCAGGGCGCAGTGCAAGGGCTCATGTCAGG101
hEP2CCACCTCATTCTCCTGGCTATTTCCTTTCGGGAAGAGGTT101
hEP3AGCGACCATTTGGAAAGATGTGATGTGATCCTGGCAGAAA93
hEP4TTACTCATTGCCACCTCCCTCGCTCCAAACTTGGCTGATA95
hIPGTGTGCTCCCTGCCTCTCGGGGTTGAAGGCGTAGAAG108
hDP1CGGAGGTCTTCTGCTTCTTCCACTATGTGTTCTCTGCCCG99
hCXCR4AGGAAGCTGTTGGCTGAAAACTCACTGACGTTGGCAAAGA96
hHprt1CACCCTTTCCAAATCCTCAGCTCCGTTATGGCGACCC112