TABLE 2

Primers designed for qPCR for Phh-grd, Phh-lcch3, Phh-rdl, and β-actin

PrimersSequences (5′-3′)Amplicon Sizes (bp)
Phh-grd forwardGGTTTGGAAGCAAGAACGGAC155
Phh-grd reverseCCGAAATAACATTCACCCGAACCG
Phh-lcch3 forwardGGGTATAACCACGGTACTAAC171
Phh-lcch3 reverseCTTGCTCCCCAATATGTATAG
Phh-rdl forwardGCGAAAAAGTAGATTTATGGCG174
Phh-rdl reverseGTACCTCCTTTGGAATGAGC
β-actin forwardTGCCACATGCTATTCTCCGT60
β-actin reverseCGGCAGTGGTAGTGAATGAA